Comparative Analysis of Commercial and Home-Made Media on RSPO1/S6R Axis in Organoids with Different Wnt Backgrounds: A Methodological Guide for the Selection of Intestinal Patient-Derived Organoids Culture Media
Abstract
1. Introduction
2. Results and Discussion
2.1. Commercial Wnt Supplement and Home-Made WNT3A-CM Induce Comparable Wnt Activation in HEK293 STF Reporter Cells
2.2. WNT3A-Containing Commercial and Home-Made Media Influence the Activation of Wnt-β-Catenin Differently in Non-APC Mutated CRC NM PDOs
2.3. RSPO1 in the Home-Made WNT3A-CM Medium Guides LGR5-Dependent p-S6R Downregulation in Non-APC Mutated CRC NM PDOs
2.4. Different Activation of Wnt/β-Catenin and PI3K/mTOR Triggered by WNT3A-Containing Commercial and Home-Made Media Did Not Affect Organoid Viability
2.5. In FAP NM PDOs, A+B Induced a Lower LGR5 Activation Compared to CRC NM PDOs Without Affecting p-S6R Downregulation
2.6. RSPO1 Exacerbates p-S6R Downregulation in APC-Mutated FAP NM PDOs Without Affecting the Levels of LGR5 Activation
3. Materials and Methods
3.1. Cell Culture
3.2. Tissue Collection and Organoid Isolation
3.3. APC Gene Target Sequencing
3.4. Organoid Culture
3.5. Organoid Viability
3.6. Imaging
3.7. Luciferase Assay
3.8. RNA Extraction and Quantitative PCR
3.9. Western Blot Analysis
3.10. Statistical Analysis
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Liu, J.; Xiao, Q.; Xiao, J.; Niu, C.; Li, Y.; Zhang, X.; Zhou, Z.; Shu, G.; Yin, G. Wnt/β-Catenin Signalling: Function, Biological Mechanisms, and Therapeutic Opportunities. Signal Transduct. Target. Ther. 2022, 7, 3. [Google Scholar] [CrossRef] [PubMed]
- De Lau, W.; Barker, N.; Low, T.Y.; Koo, B.K.; Li, V.S.W.; Teunissen, H.; Kujala, P.; Haegebarth, A.; Peters, P.J.; Van De Wetering, M.; et al. Lgr5 Homologues Associate with Wnt Receptors and Mediate R-Spondin Signalling. Nature 2011, 476, 293–297. [Google Scholar] [CrossRef] [PubMed]
- Clevers, H. Wnt/Beta-Catenin Signaling in Development and Disease. Cell 2006, 127, 469–480. [Google Scholar] [CrossRef] [PubMed]
- Fodde, R.; Smits, R.; Clevers, H. APC, Signal Transduction and Genetic Instability in Colorectal Cancer. Nat. Rev. Cancer 2001, 1, 55–67. [Google Scholar] [CrossRef]
- McGough, I.J.; Vincent, J.P. APC Moonlights to Prevent Wnt Signalosome Assembly. Dev. Cell 2018, 44, 535–537. [Google Scholar] [CrossRef]
- Wnt Target Genes | The Wnt Homepage. Available online: https://web.stanford.edu/group/nusselab/cgi-bin/wnt/target_genes (accessed on 1 February 2024).
- Ahmad, R.; Singh, J.K.; Wunnava, A.; Al-Obeed, O.; Abdulla, M.; Srivastava, S.K. Emerging Trends in Colorectal Cancer: Dysregulated Signaling Pathways (Review). Int. J. Mol. Med. 2021, 47, 14. [Google Scholar] [CrossRef]
- Prossomariti, A.; Piazzi, G.; Alquati, C.; Ricciardiello, L. Are Wnt/β-Catenin and PI3K/AKT/MTORC1 Distinct Pathways in Colorectal Cancer? Cell Mol. Gastroenterol. Hepatol. 2020, 10, 491–506. [Google Scholar] [CrossRef]
- Barbáchano, A.; Fernández-barral, A.; Bustamante-madrid, P.; Prieto, I.; Rodríguez-salas, N.; Larriba, M.J.; Muñoz, A. Organoids and Colorectal Cancer. Cancers 2021, 13, 2657. [Google Scholar] [CrossRef]
- Holloway, E.M.; Czerwinski, M.; Tsai, Y.H.; Wu, J.H.; Wu, A.; Childs, C.J.; Walton, K.D.; Sweet, C.W.; Yu, Q.; Glass, I.; et al. Mapping Development of the Human Intestinal Niche at Single-Cell Resolution. Cell Stem Cell 2021, 28, 568–580.e4. [Google Scholar] [CrossRef]
- Sato, T.; Stange, D.E.; Ferrante, M.; Vries, R.G.J.; Van Es, J.H.; Van Den Brink, S.; Van Houdt, W.J.; Pronk, A.; Van Gorp, J.; Siersema, P.D.; et al. Long-Term Expansion of Epithelial Organoids from Human Colon, Adenoma, Adenocarcinoma, and Barrett’s Epithelium. Gastroenterology 2011, 141, 1762–1772. [Google Scholar] [CrossRef]
- Drost, J.; Van Jaarsveld, R.H.; Ponsioen, B.; Zimberlin, C.; Van Boxtel, R.; Buijs, A.; Sachs, N.; Overmeer, R.M.; Offerhaus, G.J.; Begthel, H.; et al. Sequential Cancer Mutations in Cultured Human Intestinal Stem Cells. Nature 2015, 521, 43–47. [Google Scholar] [CrossRef] [PubMed]
- VanDussen, K.L.; Sonnek, N.M.; Stappenbeck, T.S. L-WRN Conditioned Medium for Gastrointestinal Epithelial Stem Cell Culture Shows Replicable Batch-to-Batch Activity Levels across Multiple Research Teams. Stem Cell Res. 2019, 37, 101430. [Google Scholar] [CrossRef] [PubMed]
- He, G.W.; Lin, L.; DeMartino, J.; Zheng, X.; Staliarova, N.; Dayton, T.; Begthel, H.; van de Wetering, W.J.; Bodewes, E.; van Zon, J.; et al. Optimized Human Intestinal Organoid Model Reveals Interleukin-22-Dependency of Paneth Cell Formation. Cell Stem Cell 2022, 29, 1333–1345. [Google Scholar] [CrossRef] [PubMed]
- Wilson, S.S.; Mayo, M.; Melim, T.; Knight, H.; Patnaude, L.; Wu, X.; Phillips, L.; Westmoreland, S.; Dunstan, R.; Fiebiger, E.; et al. Optimized Culture Conditions for Improved Growth and Functional Differentiation of Mouse and Human Colon Organoids. Front. Immunol. 2021, 11, 547102. [Google Scholar] [CrossRef]
- Yokota, J.; Yamashita, T.; Inui, T.; Nomoto, R.; Kishimoto, W.; Nakase, H.; Mizuguchi, H. Comparison of Culture Media for Human Intestinal Organoids from the Viewpoint of Pharmacokinetic Studies. Biochem. Biophys. Res. Commun. 2021, 566, 115–122. [Google Scholar] [CrossRef]
- Hogenson, T.L.; Xie, H.; Phillips, W.J.; Toruner, M.D.; Li, J.J.; Horn, I.P.; Kennedy, D.J.; Almada, L.L.; Marks, D.L.; Carr, R.M.; et al. Culture Media Composition Influences Patient-Derived Organoid Ability to Predict Therapeutic Responses in Gastrointestinal Cancers. JCI Insight 2022, 7, 22. [Google Scholar] [CrossRef]
- Binnerts, M.E.; Kim, K.A.; Bright, J.M.; Patel, S.M.; Tran, K.; Zhou, M.; Leung, J.M.; Liu, Y.; Lomas, W.E.; Dixon, M.; et al. R-Spondin1 Regulates Wnt Signaling by Inhibiting Internalization of LRP6. Proc. Natl. Acad. Sci. USA 2007, 104, 14700–14705. [Google Scholar] [CrossRef]
- Zhao, Z.; Chen, X.; Dowbaj, A.M.; Sljukic, A.; Bratlie, K.; Lin, L.; Fong, E.L.S.; Balachander, G.M.; Chen, Z.; Soragni, A.; et al. Organoids. Nat. Rev. Methods Primers 2022, 2, 94. [Google Scholar] [CrossRef]
- He, K.; Gan, W.J. Wnt/β-Catenin Signaling Pathway in the Development and Progression of Colorectal Cancer. Cancer Manag. Res. 2023, 15, 435–448. [Google Scholar] [CrossRef]
- de Lau, W.; Peng, W.C.; Gros, P.; Clevers, H. The R-Spondin/Lgr5/Rnf43 Module: Regulator of Wnt Signal Strength. Genes Dev. 2014, 28, 305–316. [Google Scholar] [CrossRef]
- Kim, K.A.; Wagle, M.; Tran, K.; Zhan, X.; Dixon, M.A.; Liu, S.; Gros, D.; Korver, W.; Yonkovich, S.; Tomasevic, N.; et al. R-Spondin Family Members Regulate the Wnt Pathway by a Common Mechanism. Mol. Biol. Cell 2008, 19, 2588–2596. [Google Scholar] [CrossRef] [PubMed]
- Maher, M.T.; Mo, R.; Flozak, A.S.; Peled, O.N.; Gottardi, C.J. Beta-Catenin Phosphorylated at Serine 45 Is Spatially Uncoupled from Beta-Catenin Phosphorylated in the GSK3 Domain: Implications for Signaling. PLoS ONE 2010, 5, e10184. [Google Scholar] [CrossRef] [PubMed]
- Mukherjee, A.; Dhar, N.; Stathos, M.; Schaffer, D.V.; Kane, R.S. Understanding How Wnt Influences Destruction Complex Activity and β-Catenin Dynamics. iScience 2018, 6, 13–21. [Google Scholar] [CrossRef] [PubMed]
- Krausova, M.; Korinek, V. Wnt Signaling in Adult Intestinal Stem Cells and Cancer. Cell Signal 2014, 26, 570–579. [Google Scholar] [CrossRef]
- Yan, K.S.; Janda, C.Y.; Chang, J.; Zheng, G.X.Y.; Larkin, K.A.; Luca, V.C.; Chia, L.A.; Mah, A.T.; Han, A.; Terry, J.M.; et al. Non-Equivalence of Wnt and R-Spondin Ligands during Lgr5+ Intestinal Stem-Cell Self-Renewal. Nature 2017, 545, 238–242. [Google Scholar] [CrossRef]
- Fleming-de-Moraes, C.D.; Rocha, M.R.; Tessmann, J.W.; de Araujo, W.M.; Morgado-Diaz, J.A. Crosstalk between PI3K/Akt and Wnt/β-Catenin Pathways Promote Colorectal Cancer Progression Regardless of Mutational Status. Cancer Biol. Ther. 2022, 23, 1–13. [Google Scholar] [CrossRef]
- He, D.; Wu, H.; Xiang, J.; Ruan, X.; Peng, P.; Ruan, Y.; Chen, Y.G.; Wang, Y.; Yu, Q.; Zhang, H.; et al. Gut Stem Cell Aging Is Driven by MTORC1 via a P38 MAPK-P53 Pathway. Nat. Commun. 2020, 11, 37. [Google Scholar] [CrossRef]
- Sampson, L.L.; Davis, A.K.; Grogg, M.W.; Zheng, Y. MTOR Disruption Causes Intestinal Epithelial Cell Defects and Intestinal Atrophy Postinjury in Mice. FASEB J. 2016, 30, 1263–1275. [Google Scholar] [CrossRef]
- Garg, H.; Suri, P.; Gupta, J.C.; Talwar, G.P.; Dubey, S. Survivin: A Unique Target for Tumor Therapy. Cancer Cell Int. 2016, 16, 49. [Google Scholar] [CrossRef]
- King, C.M.; Marx, O.M.; Ding, W.; Koltun, W.A.; Yochum, G.S. TCF7L1 Regulates LGR5 Expression in Colorectal Cancer Cells. Genes 2023, 14, 481. [Google Scholar] [CrossRef]
- Okamoto, Y.; Saito, T.; Tani, Y.; Toki, T.; Hasebe, A.; Koido, M.; Tomida, A. The Kinase PERK Represses Translation of the G-Protein-Coupled Receptor LGR5 and Receptor Tyrosine Kinase ERBB3 during ER Stress in Cancer Cells. J. Biol. Chem. 2020, 295, 4591–4603. [Google Scholar] [CrossRef] [PubMed]
- McGowan, K.P.; Delgado, E.; Keeley, T.M.; Hibdon, E.S.; Turgeon, D.K.; Stoffel, E.M.; Samuelson, L.C. Region-Specific Wnt Signaling Responses Promote Gastric Polyp Formation in Patients with Familial Adenomatous Polyposis. JCI Insight 2023, 8, e174546. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Chen, L.; Tan, J.; Zhang, L.; Xia, J.; Cheng, B.; Zhang, W. Rspo1-LGR4 Axis in BMSCs Protects Bone against Radiation-Induced Injury through the MTOR-Dependent Autophagy Pathway. J. Cell. Physiol. 2021, 236, 4273–4289. [Google Scholar] [CrossRef] [PubMed]
- Di Paola, F.J.; Alquati, C.; Conti, G.; Calafato, G.; Turroni, S.; D’Amico, F.; Ceccarelli, C.; Buttitta, F.; Bernardi, A.; Cuicchi, D.; et al. Interplay between WNT/PI3K-MTOR Axis and the Microbiota in APC-Driven Colorectal Carcinogenesis: Data from a Pilot Study and Possible Implications for CRC Prevention. J. Transl. Med. 2024, 22, 1–15. [Google Scholar] [CrossRef]
- Tsai, Y.H.; Czerwinski, M.; Wu, A.; Dame, M.K.; Attili, D.; Hill, E.; Colacino, J.A.; Nowacki, L.M.; Shroyer, N.F.; Higgins, P.D.R.; et al. A Method for Cryogenic Preservation of Human Biopsy Specimens and Subsequent Organoid Culture. Cell Mol. Gastroenterol. Hepatol. 2018, 6, 218–222.e7. [Google Scholar] [CrossRef]
- Pleguezuelos-Manzano, C.; Puschhof, J.; van den Brink, S.; Geurts, V.; Beumer, J.; Clevers, H. Establishment and Culture of Human Intestinal Organoids Derived from Adult Stem Cells. Curr. Protoc. Immunol. 2020, 130, e106. [Google Scholar] [CrossRef]
- Han, S.H.; Shim, S.; Kim, M.J.; Shin, H.Y.; Jang, W.S.; Lee, S.J.; Jin, Y.W.; Lee, S.S.; Lee, S.B.; Park, S. Long-Term Culture-Induced Phenotypic Difference and Efficient Cryopreservation of Small Intestinal Organoids by Treatment Timing of Rho Kinase Inhibitor. World J. Gastroenterol. 2017, 23, 964. [Google Scholar] [CrossRef]
- Inciuraite, R.; Steponaitiene, R.; Raudze, O.; Kulokiene, U.; Kiudelis, V.; Lukosevicius, R.; Ugenskiene, R.; Adamonis, K.; Kiudelis, G.; Jonaitis, L.V.; et al. Prolonged Culturing of Colonic Epithelial Organoids Derived from Healthy Individuals and Ulcerative Colitis Patients Results in the Decrease of LINE-1 Methylation Level. Sci. Rep. 2024, 14, 4456. [Google Scholar] [CrossRef]






| FAP Patient | Amplicon | Forward Primer (5′ → 3′) | Reverse Primer (5′ → 3′) | Size (bp) | A.T. |
|---|---|---|---|---|---|
| FAP NM 01 | Exon 16 | TGGAGAACTAGATACACCAATA | CGTTCACTATAATTGGTAGGC | 384 | 56 °C |
| FAP NM 03 | Exon 9 | CAGACACTTCATTTGGAGTACC | AGTAGAGATGGGGTTTTGCC | 369 | 60 °C |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Calafato, G.; Alquati, C.; Bernardi, A.; Di Paola, F.J.; Ricciardiello, L. Comparative Analysis of Commercial and Home-Made Media on RSPO1/S6R Axis in Organoids with Different Wnt Backgrounds: A Methodological Guide for the Selection of Intestinal Patient-Derived Organoids Culture Media. Int. J. Mol. Sci. 2024, 25, 11526. https://doi.org/10.3390/ijms252111526
Calafato G, Alquati C, Bernardi A, Di Paola FJ, Ricciardiello L. Comparative Analysis of Commercial and Home-Made Media on RSPO1/S6R Axis in Organoids with Different Wnt Backgrounds: A Methodological Guide for the Selection of Intestinal Patient-Derived Organoids Culture Media. International Journal of Molecular Sciences. 2024; 25(21):11526. https://doi.org/10.3390/ijms252111526
Chicago/Turabian StyleCalafato, Giulia, Chiara Alquati, Alice Bernardi, Floriana Jessica Di Paola, and Luigi Ricciardiello. 2024. "Comparative Analysis of Commercial and Home-Made Media on RSPO1/S6R Axis in Organoids with Different Wnt Backgrounds: A Methodological Guide for the Selection of Intestinal Patient-Derived Organoids Culture Media" International Journal of Molecular Sciences 25, no. 21: 11526. https://doi.org/10.3390/ijms252111526
APA StyleCalafato, G., Alquati, C., Bernardi, A., Di Paola, F. J., & Ricciardiello, L. (2024). Comparative Analysis of Commercial and Home-Made Media on RSPO1/S6R Axis in Organoids with Different Wnt Backgrounds: A Methodological Guide for the Selection of Intestinal Patient-Derived Organoids Culture Media. International Journal of Molecular Sciences, 25(21), 11526. https://doi.org/10.3390/ijms252111526

