Contrast Relative Humidity Response of Diverse Cowpea (Vigna unguiculata (L.) Walp.) Genotypes: Deep Study Using RNAseq Approach
Abstract
1. Introduction
2. Results
2.1. Transcriptome Sequencing and Identification of Differentially Expressed Genes
2.2. Gene Ontology Term Enrichment in Lists of Differentially Expressed Genes
2.3. Changes in Phytohormone Signaling Pathway-Related Gene Expression in High RH Conditions
2.4. Quantitative Reverse-Transcription PCR Verification of Gene Expression
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Isolation of Total RNA
4.3. RNA Library Preparation
4.4. RNA-Seq Data Analysis
4.5. Quantitative Reverse-Transcription PCR (qRT-PCR)
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Timko, M.P.; Ehlers, J.D.; Roberts, P.A. Cowpea. In Genome Mapping and Molecular Breeding in Plants. Pulses, Sugar and Tuber Crops; Kole, C., Ed.; Springer: Berlin/Heidelberg, Germany, 2007; Volume 3, pp. 49–67. [Google Scholar]
- Gerrano, A.S.; Adebola, P.O.; van Rensburg, W.S.J.; Venter, S.L. Genetic Variability and Heritability Estimates of Nutritional Composition in the Leaves of Selected Cowpea Genotypes [Vigna unguiculata (L.) Walp]. HortScience 2015, 50, 1435–1440. [Google Scholar] [CrossRef]
- Gerrano, A.S.; van Rensburg, W.S.J.; Venter, S.L.; Shargie, N.G.; Amelework, B.A.; Shimelis, H.A.; Labuschagne, M.T. Selection of Cowpea Genotypes Based on Grain Mineral and Total Protein Content. Acta Agric. Scand. Sect. B Soil Plant Sci. 2019, 69, 155–166. [Google Scholar] [CrossRef]
- Gerrano, A.S.; van Rensburg, W.S.J.; Adebola, P.O. Nutritional Composition of Immature Pods in Selected Cowpea [Vigna unguiculata (L.) Walp.] Genotypes in South Africa. Aust. J. Crop Sci. 2017, 11, 134–141. [Google Scholar] [CrossRef]
- Perchuk, I.; Shelenga, T.; Gurkina, M.; Miroshnichenko, E.; Burlyaeva, M. Composition of Primary and Secondary Metabolite Compounds in Seeds and Pods of Asparagus Bean (Vigna unguiculata (L.) Walp.) from China. Molecules 2020, 25, 3778. [Google Scholar] [CrossRef]
- Carvalho, M.; Carnide, V.; Sobreira, C.; Castro, I.; Coutinho, J.; Barros, A.; Rosa, E. Cowpea Immature Pods and Grains Evaluation: An Opportunity for Different Food Sources. Plants 2022, 11, 2079. [Google Scholar] [CrossRef]
- van Zonneveld, M.; Rakha, M.; Tan, S.; Chou, Y.-Y.; Chang, C.-H.; Yen, J.-Y.; Schafleitner, R.; Nair, R.; Naito, K.; Solberg, S.Ø. Mapping patterns of abiotic and biotic stress resilience uncovers conservation gaps and breeding potential of Vigna wild relatives. Sci. Rep. 2020, 10, 2111. [Google Scholar] [CrossRef]
- Fatokun, C.A.; Boukar, O.; Muranaka, S. Evaluation of cowpea (Vigna unguiculata (L.) Walp.) germplasm lines for tolerance to drought. Plant Genet. Resour. 2012, 10, 171–176. [Google Scholar] [CrossRef]
- Burlyaeva, M.O.; Gurkina, M.V.; Chebukin, P.A.; Perchuk, I.N.; Miroshnichenko, E.V. New varieties of vegetable cowpea (Vigna unguiculata subsp. sesquipedalis (L.) Verdc.) and prospects of their cultivation in southern Russia. Veg. Crops Russ. 2019, 5, 33–37. (In Russian) [Google Scholar] [CrossRef]
- Burlyaeva, M.O.; Gurkina, M.V.; Miroshnichenko, E.V. Application of multivariate analysis to identify relationships among useful agronomic characters of cowpea and differentiation of cultivars for vegetable and grain uses. Proc. Appl. Bota Ny Genet. Breed. 2021, 182, 36–47. (In Russian) [Google Scholar] [CrossRef]
- Chebukin, P.A.; Burlyaeva, M.O. Vigna Savi—A promising new vegetable crop cultivation in the Far Eastern Federal District. Current state and prospects for the innovative development of vegetable and potato growing. In Proceedings of the International Scientific-Practical Conferences, Artem, Russia, 12–13 August 2013; pp. 123–129. [Google Scholar]
- Krylova, E.A.; Chunikhina, O.A.; Boyko, A.P.; Miroshnichenko, E.V.; Khlestkina, E.K.; Burlyaeva, M.O. Variability of morphological and phenological traits in Vigna unguiculata (L.) Walp. accessions contrasting by growth type in different ecological and geographical conditions. Plant Biotechnol. Breed. 2024, 7, 16–30. (In Russian) [Google Scholar] [CrossRef]
- Beagley, C.J.; Weller, J.L. Genetic control of stem elongation in legume crops and its potential relevance. Crop Sci. 2024, 64, 1971–1986. [Google Scholar] [CrossRef]
- Krylova, E.A.; Khlestkina, E.K.; Burlyaeva, M.O.; Vishnyakova, M.A. Determinate growth habit of grain legumes: Role in domestication and selection, genetic control. Ecol. Genet. 2020, 18, 43–58. (In Russian) [Google Scholar] [CrossRef]
- Pungulani, L.L.M.; Miller, J.P.; Williams, W.M. Screening cowpea (Vigna unguiculata) germplasm for canopy maintenance under water stress. Agron. N. Z. 2012, 42, 23–32. [Google Scholar]
- Hall, A.E. Breeding for adaptation to drought and heat in cowpea. Eur. J. Agron. 2004, 21, 447–454. [Google Scholar] [CrossRef]
- Olorunwa, O.J.; Adhikari, B.; Shi, A.; Barickman, T.C. Screening of cowpea (Vigna unguiculata (L.) Walp.) genotypes for waterlogging tolerance using morpho-physiological traits at early growth stage. Plant Sci. 2022, 315, 111136. [Google Scholar] [CrossRef] [PubMed]
- Vavilov, N.I. Geographical variability of plants. Nauchnoe Slovo 1928, 1, 23–33. (In Russian) [Google Scholar]
- Fortunatova, O.K. The dependence of plant height on geographical factors of growth. Proc. Appl. Bot. Genet. Breed. 1928, 19, 385–466. (In Russian) [Google Scholar]
- Krylova, E.A.; Khlestkina, E.K.; Burlyaeva, M.O. Influence of air humidity on variability of morphological features of Vigna unguiculata (L.) Walp. in artificial conditions. Ecol. Genet. 2022, 20, 215–229. (In Russian) [Google Scholar] [CrossRef]
- Wong, S.C. Interaction between elevated atmospheric concentration of CO2 and humidity on plant growth: Comparison between cotton and radish. Vegetatio 1993, 104, 211–221. [Google Scholar] [CrossRef]
- Gislerød, H.R.; Nelson, P.V. The interaction of the relative air humidity and carbon dioxide enrichment on the growth of Chrysanthemum × morifolium Ramat. Sci. Hortic. 1989, 38, 305–313. [Google Scholar] [CrossRef]
- Mortensen, L.M. Effects of air humidity on growth, flowering, keeping quality and water relations of four short-day greenhouse species. Sci. Hortic. 2000, 86, 299–310. [Google Scholar] [CrossRef]
- Chia, Y.; Lim, M.W. A critical review on the influence of humidity for plant growth forecasting. IOP Conf. Ser. Mater. Sci. Eng. 2022, 1257, 012001. [Google Scholar] [CrossRef]
- Giday, H.; Kjaer, K.H.; Fanourakis, D.; Ottosen, C.O. Smaller stomata require less severe leaf drying to close: A case study in Rosa hydrida. J. Plant Physiol. 2013, 170, 1309–1316. [Google Scholar] [CrossRef]
- Fanourakis, D.; Giday, H.; Hyldgaard, B.; Bouranis, D.; Körner, O.; Ottosen, C.O. Low air humidity during growth promotes stomatal closure ability in roses. Eur. J. Hortic. Sci. 2019, 84, 245–252. [Google Scholar] [CrossRef]
- Fanourakis, D.; Aliniaeifard, S.; Sellin, A.; Giday, H.; Körner, O.; Nejad, A.R.; Delis, C.; Bouranis, D.; Koubouris, G.; Kambourakis, E.; et al. Stomatal behavior following mid- or long-term exposure to high relative air humidity: A review. Plant Physiol. Biochem. 2020, 153, 92–105. [Google Scholar] [CrossRef]
- Nejad, A.R.; Meeteren, U. Stomatal response characteristics of Tradescantia virginiana grown at high relative air humidity. Physiol. Plant 2005, 125, 324–332. [Google Scholar] [CrossRef]
- Driesen, E.; Van den Ende, W.; De Proft, M.; Saeys, W. Influence of Environmental Factors Light, CO2, Temperature, and Relative Humidity on Stomatal Opening and Development: A Review. Agronomy 2020, 10, 1975. [Google Scholar] [CrossRef]
- Innes, S.N.; Solhaug, K.A.; Torre, S.; Dodd, I.C. Different abscisic acid-deficient mutants show unique morphological and hydraulic responses to high air humidity. Physiol. Plant. 2021, 172, 1795–1807. [Google Scholar] [CrossRef]
- Okamoto, M.; Tanaka, Y.; Abrams, S.R.; Kamiya, Y.; Seki, M.; Nambara, E. High humidity induces abscisic acid 8′-hydroxylase in stomata and vasculature to regulate local and systemic abscisic acid responses in Arabidopsis. Plant Physiol. 2009, 149, 825–834. [Google Scholar] [CrossRef] [PubMed]
- Giday, H.; Fanourakis, D.; Kjaer, K.H.; Fomsgaard, I.S.; Ottosen, C.O. Foliar abscisic acid content underlies genotypic variation in stomatal responsiveness after growth at high relative air humidity. Ann. Bot. 2013, 112, 1857–1867. [Google Scholar] [CrossRef]
- Arve, L.E.; Torre, S. Ethylene is involved in high air humidity promoted stomatal opening of tomato (Lycopersicon esculentum) leaves. Funct. Plant Biol. 2015, 42, 376–386. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Zhang, P.; Liu, J.; Wang, H.; Liu, J.; Li, H.; Xie, H.; Wang, Q.; Li, L.; Zhang, S.; et al. Integrated Metabolomic and Transcriptomic Analysis of the Quinoa Seedling Response to High Relative Humidity Stress. Biomolecules 2023, 13, 1352. [Google Scholar] [CrossRef] [PubMed]
- Caarls, L.; Elberse, Y.; Awwanah, M.; Ludwig, N.R.; de Vries, M.; Zeilmaker, T.; Van Wees, S.C.M.; Schuurink, R.C.; Van den Ackerveken, G. Arabidopsis JASMONATE-INDUCED OXYGENASES down-regulate plant immunity by hydroxylation and inactivation of the hormone jasmonic acid. Proc. Natl. Acad. Sci. USA 2017, 114, 6388–6393. [Google Scholar] [CrossRef]
- Wang, J.; Song, L.; Gong, X.; Xu, J.; Li, M. Functions of Jasmonic Acid in Plant Regulation and Response to Abiotic Stress. Int. J. Mol. Sci. 2020, 21, 1446. [Google Scholar] [CrossRef]
- Sohn, S.-I.; Pandian, S.; Rakkammal, K.; Largia, M.J.V.; Thamilarasan, S.K.; Balaji, S.; Zoclanclounon, Y.A.B.; Shilpha, J.; Ramesh, M. Jasmonates in plant growth and development and elicitation of secondary metabolites: An updated overview. Front. Plant Sci. 2022, 13, 942789. [Google Scholar] [CrossRef] [PubMed]
- Zhai, Q.; Zhang, X.; Wu, F.; Feng, H.; Deng, L.; Xu, L.; Zhang, M.; Wang, Q.; Li, C. Transcriptional mechanism of Jasmonate receptor COI1-mediated delay of flowering time in Arabidopsis. Plant Cell 2015, 27, 2814–2828. [Google Scholar] [CrossRef]
- Guan, Y.; Ding, L.; Jiang, J.; Shentu, Y.; Zhao, W.; Zhao, K.; Zhang, X.; Song, A.; Chen, S.; Chen, F. Overexpression of the CmJAZ1-like gene delays flowering in Chrysanthemum morifolium. Hortic. Res. 2021, 8, 87. [Google Scholar] [CrossRef]
- Heinrich, M.; Hettenhausen, C.; Lange, T.; Wunsche, H.; Fang, J.; Baldwin, I.T.; Wu, J. High levels of jasmonic acid antagonize the biosynthesis of gibberellins and inhibit the growth of Nicotiana attenuata stems. Plant J. 2013, 73, 591–606. [Google Scholar] [CrossRef]
- Burlyaeva, M.O.; Gurkina, M.V.; Chebukin, P.A. Skrining obraztsov sparzhevoi vigny (Vigna unguiculata subsp. sesquipedalis (L.) Verdc.) iz kollektsii VIR na ustoichivost’ k abioticheskim i bioticheskim stressoram. Sel. I Semenovod. Ovoshchnykh Kul’tur 2014, 45, 131–141. (In Russian) [Google Scholar]
- Andrews, S. FASTQC: A quality control tool for high throughput sequence data. In Transcriptomics in Entomological Research; Babraham Institute: Cambridge, UK, 2015. [Google Scholar]
- Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef]
- Ewels, P.; Magnusson, M.; Lundin, S.; Käller, M. MultiQC: Summarize analysis results for multiple tools and samples in a single report. Bioinformatics 2016, 32, 3047–3048. [Google Scholar] [CrossRef] [PubMed]
- Dobin, A.; Davis, C.A.; Schlesinger, F.; Drenkow, J.; Zaleski, C.; Jha, S.; Batut, P.; Chaisson, M.; Gingeras, T.R. STAR: Ultrafast universal RNA-seq aligner. Bioinformatics 2013, 29, 15–21. [Google Scholar] [CrossRef] [PubMed]
- Liao, Y.; Smyth, G.K.; Shi, W. featureCounts: An efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 2014, 30, 923–930. [Google Scholar] [CrossRef] [PubMed]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
- Blighe, K.; Rana, S.; Lewis, M. EnhancedVolcano: Publication-Ready Volcano Plots with Enhanced Colouring and Labeling. R Package Version 1.10.0. Available online: https://github.com/kevinblighe/EnhancedVolcano (accessed on 19 June 2021).
- Amorim, L.L.B.; Ferreira-Neto, J.R.C.; Bezerra-Neto, J.P.; Pandolfi, V.; de Araújo, F.T.; da Silva Matos, M.K.; Santos, M.G.; Kido, E.A.; Benko-Iseppon, A.M. Cowpea and abiotic stresses: Identification of reference genes for transcriptional profiling by qPCR. Plant Methods 2018, 14, 88. [Google Scholar] [CrossRef]
Gene | log2 (FC) | p-Value (RNA-Seq) |
---|---|---|
Vigun01g020000 | 9.40 | 3.27 × 10−92 |
Vigun02g200300 | −6.08 | 1.61 × 10−13 |
Vigun04g129200 | 8.26 | 1.89 × 10−36 |
Vigun05g198900 | 8.18 | 4.61 × 10−73 |
Vigun07g270500 | −7.32 | 3.02 × 10−74 |
Vigun08g151600 | 9.42 | 1.59 × 10−125 |
Vigun08g216300 | 7.16 | 6.73 × 10−24 |
Vigun11g007900 | 7.88 | 1.13 × 10−62 |
Vigun11g015600 | 7.02 | 7.05 × 10−73 |
Gene ID | Primer | Sequence (5′-3′) | Amplicon Length |
---|---|---|---|
Vigun01g020000 | Forward | ACTCAGGTTCAAAGGATTTCCC | 149 |
Reverse | CTGTCCAATGACCATCTCAAG | ||
Vigun02g200300 | Forward | GAGCAAAGGAGAAGTGGGTG | 136 |
Reverse | AAGAAAGCTCAACTCTGGACC | ||
Vigun04g129200 | Forward | CACTGACCCAATCTACCCG | 150 |
Reverse | GTGACAATGGCTTGAACGAAG | ||
Vigun05g198900 | Forward | TGGGACACTGCTGGTTTATCTG | 141 |
Reverse | GTCCACTCTCAACCACTTCTC | ||
Vigun07g270500 | Forward | GACCACTCCTGACAAACCAA | 139 |
Reverse | TCTGCCTCCGTCAATTATCAC | ||
Vigun08g151600 | Forward | CGGTTGTGGATTCGCTATTGC | 136 |
Reverse | TTCAGTTGGAAGAGGGAAAGG | ||
Vigun08g216300 | Forward | TCAATGAGTTCGTCCGCAAG | 131 |
Reverse | CTCAGAGAATGGACCCAAGTAC | ||
Vigun11g007900 | Forward | AGGACGTAGAAAAGCAAGGTG | 148 |
Reverse | TCTTTGGAAGACCACAACTCAG | ||
Vigun11g015600 | Forward | TCTTGGACCCTTTTGAGCAG | 143 |
Reverse | AAACAGGGCATCTCGGAAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Krylova, E.A.; Burlyaeva, M.O.; Tvorogova, V.E.; Khlestkina, E.K. Contrast Relative Humidity Response of Diverse Cowpea (Vigna unguiculata (L.) Walp.) Genotypes: Deep Study Using RNAseq Approach. Int. J. Mol. Sci. 2024, 25, 11056. https://doi.org/10.3390/ijms252011056
Krylova EA, Burlyaeva MO, Tvorogova VE, Khlestkina EK. Contrast Relative Humidity Response of Diverse Cowpea (Vigna unguiculata (L.) Walp.) Genotypes: Deep Study Using RNAseq Approach. International Journal of Molecular Sciences. 2024; 25(20):11056. https://doi.org/10.3390/ijms252011056
Chicago/Turabian StyleKrylova, Ekaterina A., Marina O. Burlyaeva, Varvara E. Tvorogova, and Elena K. Khlestkina. 2024. "Contrast Relative Humidity Response of Diverse Cowpea (Vigna unguiculata (L.) Walp.) Genotypes: Deep Study Using RNAseq Approach" International Journal of Molecular Sciences 25, no. 20: 11056. https://doi.org/10.3390/ijms252011056
APA StyleKrylova, E. A., Burlyaeva, M. O., Tvorogova, V. E., & Khlestkina, E. K. (2024). Contrast Relative Humidity Response of Diverse Cowpea (Vigna unguiculata (L.) Walp.) Genotypes: Deep Study Using RNAseq Approach. International Journal of Molecular Sciences, 25(20), 11056. https://doi.org/10.3390/ijms252011056