A Swedish Familial Genome-Wide Haplotype Analysis Identified Five Novel Breast Cancer Susceptibility Loci on 9p24.3, 11q22.3, 15q11.2, 16q24.1 and Xq21.31
Abstract
1. Introduction
2. Results
2.1. Locus 9p24.3
2.2. Locus 10q26.13
2.3. Locus 11q13.3
2.4. Locus 11q22.3
2.5. Locus 15q11.2
2.6. Locus 16q12.1
2.7. Locus 16q24.1
2.8. Locus Xq21.31
3. Discussion
4. Materials and Methods
4.1. Study Population
4.2. Genotyping and Quality Control
4.3. Statistics
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Lukasiewicz, S.; Czeczelewski, M.; Forma, A.; Baj, J.; Sitarz, R.; Stanislawek, A. Breast Cancer-Epidemiology, Risk Factors, Classification, Prognostic Markers, and Current Treatment Strategies-An Updated Review. Cancers 2021, 13, 4287. [Google Scholar] [CrossRef]
- Pharoah, P.D.; Day, N.E.; Duffy, S.; Easton, D.F.; Ponder, B.A. Family history and the risk of breast cancer: A systematic review and meta-analysis. Int. J. Cancer 1997, 71, 800–809. [Google Scholar] [CrossRef]
- Lichtenstein, P.; Holm, N.V.; Verkasalo, P.K.; Iliadou, A.; Kaprio, J.; Koskenvuo, M.; Pukkala, E.; Skytthe, A.; Hemminki, K. Environmental and heritable factors in the causation of cancer—Analyses of cohorts of twins from Sweden, Denmark, and Finland. N. Engl. J. Med. 2000, 343, 78–85. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Y.; Wu, J.; Zhang, C.; Sun, S.; Zhang, J.; Liu, W.; Huang, J.; Zhang, Z. BRCA mutations and survival in breast cancer: An updated systematic review and meta-analysis. Oncotarget 2016, 7, 70113–70127. [Google Scholar] [CrossRef] [PubMed]
- Melchor, L.; Benitez, J. The complex genetic landscape of familial breast cancer. Hum. Genet. 2013, 132, 845–863. [Google Scholar] [CrossRef]
- Michailidou, K.; Hall, P.; Gonzalez-Neira, A.; Ghoussaini, M.; Dennis, J.; Milne, R.L.; Schmidt, M.K.; Chang-Claude, J.; Bojesen, S.E.; Bolla, M.K.; et al. Large-scale genotyping identifies 41 new loci associated with breast cancer risk. Nat. Genet. 2013, 45, 353–361. [Google Scholar] [CrossRef]
- Michailidou, K.; Beesley, J.; Lindstrom, S.; Canisius, S.; Dennis, J.; Lush, M.J.; Maranian, M.J.; Bolla, M.K.; Wang, Q.; Shah, M.; et al. Genome-wide association analysis of more than 120,000 individuals identifies 15 new susceptibility loci for breast cancer. Nat. Genet. 2015, 47, 373–380. [Google Scholar] [CrossRef] [PubMed]
- Michailidou, K.; Lindström, S.; Dennis, J.; Beesley, J.; Hui, S.; Kar, S.; Lemaçon, A.; Soucy, P.; Glubb, D.; Rostamianfar, A.; et al. Association analysis identifies 65 new breast cancer risk loci. Nature 2017, 551, 92–94. [Google Scholar] [CrossRef]
- Liu, W.; Jiao, X.; Thutkawkorapin, J.; Mahdessian, H.; Lindblom, A. Cancer risk susceptibility loci in a Swedish population. Oncotarget 2017, 8, 110300–110310. [Google Scholar] [CrossRef]
- Liu, W.; Mahdessian, H.; Helgadottir, H.; Zhou, X.; Thutkawkorapin, J.; Jiao, X.; The Swedish Low-risk Colorectal Cancer Study Group; Wolk, A.; Lindblom, A. Colorectal cancer risk susceptibility loci in a Swedish population. Mol. Carcinog. 2021, 61, 288–300. [Google Scholar] [CrossRef]
- Barnekow, E.; Liu, W.; Helgadottir, H.T.; Michailidou, K.; Dennis, J.; Bryant, P.; Thutkawkorapin, J.; Wendt, C.; Czene, K.; Hall, P.; et al. A Swedish Genome-Wide Haplotype Association Analysis Identifies a Novel Breast Cancer Susceptibility Locus in 8p21.2 and Characterizes Three Loci on Chromosomes 10, 11 and 16. Cancers 2022, 14, 1206. [Google Scholar] [CrossRef]
- Ferla, R.; Calo, V.; Cascio, S.; Rinaldi, G.; Badalamenti, G.; Carreca, I.; Surmacz, E.; Colucci, G.; Bazan, V.; Russo, A. Founder mutations in BRCA1 and BRCA2 genes. Ann. Oncol. 2007, 18 (Suppl. 6), vi93–vi98. [Google Scholar] [CrossRef] [PubMed]
- Bergman, A.; Einbeigi, Z.; Olofsson, U.; Taib, Z.; Wallgren, A.; Karlsson, P.; Wahlstrom, J.; Martinsson, T.; Nordling, M. The western Swedish BRCA1 founder mutation 3171ins5; a 3.7 cM conserved haplotype of today is a reminiscence of a 1500-year-old mutation. Eur. J. Hum. Genet. 2001, 9, 787–793. [Google Scholar] [CrossRef]
- Kremeyer, B.; Soller, M.; Lagerstedt, K.; Maguire, P.; Mazoyer, S.; Nordling, M.; Wahlstrom, J.; Lindblom, A. The BRCA1 exon 13 duplication in the Swedish population. Fam. Cancer 2005, 4, 191–194. [Google Scholar] [CrossRef]
- Mavaddat, N.; Michailidou, K.; Dennis, J.; Lush, M.; Fachal, L.; Lee, A.; Tyrer, J.P.; Chen, T.H.; Wang, Q.; Bolla, M.K.; et al. Polygenic Risk Scores for Prediction of Breast Cancer and Breast Cancer Subtypes. Am. J. Hum. Genet. 2019, 104, 21–34. [Google Scholar] [CrossRef] [PubMed]
- Sud, A.; Turnbull, C.; Houlston, R. Will polygenic risk scores for cancer ever be clinically useful? NPJ Precis. Oncol. 2021, 5, 40. [Google Scholar] [CrossRef] [PubMed]
- Hurson, A.N.; Pal Choudhury, P.; Gao, C.; Husing, A.; Eriksson, M.; Shi, M.; Jones, M.E.; Evans, D.G.R.; Milne, R.L.; Gaudet, M.M.; et al. Prospective evaluation of a breast-cancer risk model integrating classical risk factors and polygenic risk in 15 cohorts from six countries. Int. J. Epidemiol. 2022, 50, 1897–1911. [Google Scholar] [CrossRef] [PubMed]
- Bettler, B.; Fakler, B. Ionotropic AMPA-type glutamate and metabotropic GABA(B) receptors: Determining cellular physiology by proteomes. Curr. Opin. Neurobiol. 2017, 45, 16–23. [Google Scholar] [CrossRef]
- Martin, S.; Chamberlin, A.; Shinde, D.N.; Hempel, M.; Strom, T.M.; Schreiber, A.; Johannsen, J.; Ousager, L.B.; Larsen, M.J.; Hansen, L.K.; et al. De Novo Variants in GRIA4 Lead to Intellectual Disability with or without Seizures and Gait Abnormalities. Am. J. Hum. Genet. 2017, 101, 1013–1020. [Google Scholar] [CrossRef]
- Prickett, T.D.; Samuels, Y. Molecular pathways: Dysregulated glutamatergic signaling pathways in cancer. Clin. Cancer Res. 2012, 18, 4240–4246. [Google Scholar] [CrossRef]
- Vega-Benedetti, A.F.; Loi, E.; Moi, L.; Restivo, A.; Cabras, F.; Deidda, S.; Pretta, A.; Ziranu, P.; Orru, S.; Scartozzi, M.; et al. Colorectal cancer promoter methylation alteration affects the expression of glutamate ionotropic receptor AMPA type subunit 4 alternative isoforms potentially relevant in colon tissue. Hum. Cell 2022, 35, 310–319. [Google Scholar] [CrossRef] [PubMed]
- Kostareli, E.; Holzinger, D.; Bogatyrova, O.; Hielscher, T.; Wichmann, G.; Keck, M.; Lahrmann, B.; Grabe, N.; Flechtenmacher, C.; Schmidt, C.R.; et al. HPV-related methylation signature predicts survival in oropharyngeal squamous cell carcinomas. J. Clin. Investig. 2013, 123, 2488–2501. [Google Scholar] [CrossRef]
- Euskirchen, G.; Auerbach, R.K.; Snyder, M. SWI/SNF chromatin-remodeling factors: Multiscale analyses and diverse functions. J. Biol. Chem. 2012, 287, 30897–30905. [Google Scholar] [CrossRef] [PubMed]
- Reisman, D.; Glaros, S.; Thompson, E.A. The SWI/SNF complex and cancer. Oncogene 2009, 28, 1653–1668. [Google Scholar] [CrossRef] [PubMed]
- Damiano, L.; Stewart, K.M.; Cohet, N.; Mouw, J.K.; Lakins, J.N.; Debnath, J.; Reisman, D.; Nickerson, J.A.; Imbalzano, A.N.; Weaver, V.M. Oncogenic targeting of BRM drives malignancy through C/EBPβ-dependent induction of α5 integrin. Oncogene 2014, 33, 2441–2453. [Google Scholar] [CrossRef]
- Wu, Q.; Madany, P.; Akech, J.; Dobson, J.R.; Douthwright, S.; Browne, G.; Colby, J.L.; Winter, G.E.; Bradner, J.E.; Pratap, J.; et al. The SWI/SNF ATPases Are Required for Triple Negative Breast Cancer Cell Proliferation. J. Cell Physiol. 2015, 230, 2683–2694. [Google Scholar] [CrossRef] [PubMed]
- Ettahar, A.; Ferrigno, O.; Zhang, M.-Z.; Ohnishi, M.; Ferrand, N.; Prunier, C.; Levy, L.; Bourgeade, M.-F.; Bieche, I.; Romero, D.G.; et al. Identification of PHRF1 as a Tumor Suppressor that Promotes the TGF-β Cytostatic Program through Selective Release of TGIF-Driven PML Inactivation. Cell Rep. 2013, 4, 530–541. [Google Scholar] [CrossRef]
- Akbari, A.; Agah, S.; Heidari, M.; Mobini, G.R.; Faghihloo, E.; Sarveazad, A.; Mirzaei, A. Homeodomain Protein Transforming Growth Factor Beta-Induced Factor 2 Like, X-Linked Function in Colon Adenocarcinoma Cells. Asian Pac. J. Cancer Prev. 2017, 18, 2101–2108. [Google Scholar] [CrossRef]
- Escala-Garcia, M.; Guo, Q.; Dörk, T.; Canisius, S.; Keeman, R.; Dennis, J.; Beesley, J.; Lecarpentier, J.; Bolla, M.K.; Wang, Q.; et al. Genome-wide association study of germline variants and breast cancer-specific mortality. Br. J. Cancer 2019, 120, 647–657. [Google Scholar] [CrossRef]
- Fachal, L.; Aschard, H.; Beesley, J.; Barnes, D.R.; Allen, J.; Kar, S.; Pooley, K.A.; Dennis, J.; Michailidou, K.; Turman, C.; et al. Fine-mapping of 150 breast cancer risk regions identifies 191 likely target genes. Nat. Genet. 2020, 52, 56–73. [Google Scholar] [CrossRef]
- Gabrielson, M.; Eriksson, M.; Hammarström, M.; Borgquist, S.; Leifland, K.; Czene, K.; Hall, P. Cohort Profile: The Karolinska Mammography Project for Risk Prediction of Breast Cancer (KARMA). Int. J. Epidemiol. 2017, 46, 1740g–1741g. [Google Scholar] [CrossRef]
- Margolin, S.; Werelius, B.; Fornander, T.; Lindblom, A. BRCA1 mutations in a population-based study of breast cancer in Stockholm County. Genet. Test 2004, 8, 127–132. [Google Scholar] [CrossRef] [PubMed]
- Milne, R.L.; Kuchenbaecker, K.B.; Michailidou, K.; Beesley, J.; Kar, S.; Lindström, S.; Hui, S.; Lemaçon, A.; Soucy, P.; Dennis, J.; et al. Identification of ten variants associated with risk of estrogen-receptor-negative breast cancer. Nat. Genet. 2017, 49, 1767–1778. [Google Scholar] [CrossRef] [PubMed]
- Wendt, C.; Lindblom, A.; Arver, B.; von Wachenfeldt, A.; Margolin, S. Tumour spectrum in non-BRCA hereditary breast cancer families in Sweden. Hered. Cancer Clin. Pract. 2015, 13, 15. [Google Scholar] [CrossRef] [PubMed]
- Amos, C.I.; Dennis, J.; Wang, Z.; Byun, J.; Schumacher, F.R.; Gayther, S.A.; Casey, G.; Hunter, D.J.; Sellers, T.A.; Gruber, S.B.; et al. The OncoArray Consortium: A Network for Understanding the Genetic Architecture of Common Cancers. Cancer Epidemiol. Biomark. Prev. 2017, 26, 126–135. [Google Scholar] [CrossRef]
- Purcell, S.; Neale, B.; Todd-Brown, K.; Thomas, L.; Ferreira, M.A.; Bender, D.; Maller, J.; Sklar, P.; de Bakker, P.I.; Daly, M.J.; et al. PLINK: A tool set for whole-genome association and population-based linkage analyses. Am. J. Hum. Genet. 2007, 81, 559–575. [Google Scholar] [CrossRef] [PubMed]
- Dudbridge, F.; Gusnanto, A. Estimation of significance thresholds for genomewide association scans. Genet. Epidemiol. 2008, 32, 227–234. [Google Scholar] [CrossRef] [PubMed]
Locus | Gene | Haplotype | SNP1-SNP2 | Size (kb) | F | OR | p-Value |
---|---|---|---|---|---|---|---|
9P24.3 | SMARCA2 | GAAAAGAGCCAGG | rs10122055-rs10119055 | 99 | 0.02 | 3.4 | 4.9 × 10−11 |
10Q26.13 * | FGFR2 | GGG | rs4237533-rs10736303 | 2 | 0.42 | 1.5 | 8.5 × 10−13 |
11Q22.3 | GRIA4 | AAAAACAACAAGGCGGGAGCGAA | rs1373925-rs7116745 | 266 | 0.03 | 2.4 | 5.2 × 10−9 |
11Q13.3 * | GAAAAGGGA | rs7940177-rs614367 | 11 | 0.11 | 1.7 | 2.4 × 10−9 | |
15Q11.2 | ACGGGGAGGGAGGAAAGGAA | rs8037816-rs12906805 | 65 | 0.01 | 3.6 | 2.3 × 10−8 | |
16Q12.1 * | TOX3 | AG | chr16_52560213_A_G-chr16_52562811_A_G | 3 | 0.23 | 1.5 | 4.0 × 10−10 |
16Q24.1 | AGGAGCCAAGC | rs4843437-rs2059287 | 57 | 0.01 | 3 | 3.0 × 10−8 | |
XQ21.31 | TGIF2LX | CCGAAAGAAGGACGGAGAAAAAC | rs2051591-rs5941428 | 909 | 0.01 | 3.3 | 1.7 × 10−8 |
Familial BC | Unselected BC | |||
---|---|---|---|---|
Locus | OR | p-Value | OR | p-Value |
8p21.2 * | 2.3 | 7.0 × 10−5 | 2.1 | 3.9 × 10−8 |
9p24.3 | 3.4 | 4.9 × 10−11 | 1.6 | 9 × 10−4 |
10q26.13 * | 1.5 | 8.5 × 10−13 | 1.4 | 8.8 × 10−21 |
11q22.3 | 2.4 | 5.2 × 10−9 | 1.5 | 1.8 × 10−5 |
11q13.3 * | 1.7 | 2.4 × 10−9 | 1.4 | 6.4 × 10−13 |
15q11.2 | 3.6 | 2.3 × 10−8 | 1.8 | 5.7 × 10−4 |
16q12.1 * | 1.5 | 4.0 × 10−10 | 1.4 | 1.7 × 10−18 |
16q24.1 | 3 | 3.0 × 10−8 | 1.4 | 0.0094 |
Xq21.31 | 3.3 | 1.7 × 10−8 | 1.7 | 5.8 × 10−4 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Barnekow, E.; Hasslow, J.; Liu, W.; Bryant, P.; Thutkawkorapin, J.; Wendt, C.; Czene, K.; Hall, P.; Margolin, S.; Lindblom, A. A Swedish Familial Genome-Wide Haplotype Analysis Identified Five Novel Breast Cancer Susceptibility Loci on 9p24.3, 11q22.3, 15q11.2, 16q24.1 and Xq21.31. Int. J. Mol. Sci. 2023, 24, 4468. https://doi.org/10.3390/ijms24054468
Barnekow E, Hasslow J, Liu W, Bryant P, Thutkawkorapin J, Wendt C, Czene K, Hall P, Margolin S, Lindblom A. A Swedish Familial Genome-Wide Haplotype Analysis Identified Five Novel Breast Cancer Susceptibility Loci on 9p24.3, 11q22.3, 15q11.2, 16q24.1 and Xq21.31. International Journal of Molecular Sciences. 2023; 24(5):4468. https://doi.org/10.3390/ijms24054468
Chicago/Turabian StyleBarnekow, Elin, Johan Hasslow, Wen Liu, Patrick Bryant, Jessada Thutkawkorapin, Camilla Wendt, Kamila Czene, Per Hall, Sara Margolin, and Annika Lindblom. 2023. "A Swedish Familial Genome-Wide Haplotype Analysis Identified Five Novel Breast Cancer Susceptibility Loci on 9p24.3, 11q22.3, 15q11.2, 16q24.1 and Xq21.31" International Journal of Molecular Sciences 24, no. 5: 4468. https://doi.org/10.3390/ijms24054468
APA StyleBarnekow, E., Hasslow, J., Liu, W., Bryant, P., Thutkawkorapin, J., Wendt, C., Czene, K., Hall, P., Margolin, S., & Lindblom, A. (2023). A Swedish Familial Genome-Wide Haplotype Analysis Identified Five Novel Breast Cancer Susceptibility Loci on 9p24.3, 11q22.3, 15q11.2, 16q24.1 and Xq21.31. International Journal of Molecular Sciences, 24(5), 4468. https://doi.org/10.3390/ijms24054468