Acute Colon Inflammation Triggers Primary Motor Cortex Glial Activation, Neuroinflammation, Neuronal Hyperexcitability, and Motor Coordination Deficits
Abstract
:1. Introduction
2. Results
2.1. DSS Treatment and Colon Inflammation
2.2. Colon Inflammation Induces Neuroinflammation in Primary Motor Cortex
2.3. Colon Inflammation and Microglial and Astrocyte Activation in Primary Motor Cortex
2.4. Colon Inflammation Depolarizes Membrane Potential and Increases Membrane Resistance of Motor Neurons
2.5. Colon Inflammation Induces Hyperexcitability in Motor Neurons
2.6. Colon Inflammation Causes Locomotion and Motor Coordination Deficits
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Animals
4.3. Induction and Assessment of Experimental Colitis
4.4. Biological Preparations
4.5. Relative Quantification of Real-Time PCR
4.6. Immunofluorescence Staining
4.7. Microglial and Astrocyte Activation
4.8. Whole-Cell Patch-Clamp Recordings and Analysis
4.9. Current- and Voltage-Clamp Recordings
4.10. Locomotor Activity and Motor Coordination Assessment
4.11. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Glass, C.K.; Saijo, K.; Winner, B.; Marchetto, M.C.; Gage, F.H. Mechanisms Underlying Inflammation in Neurodegeneration. Cell 2010, 140, 918–934. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Butovsky, O.; Weiner, H.L. Microglial signatures and their role in health and disease. Nat. Rev. Neurosci. 2018, 19, 622–635. [Google Scholar] [CrossRef] [PubMed]
- Tricoire, L.; Vitalis, T. Neuronal nitric oxide synthase expressing neurons: A journey from birth to neuronal circuits. Front. Neural Circuits 2012, 6, 82. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kempuraj, D.; Thangavel, R.; Selvakumar, G.P.; Zaheer, S.; Ahmed, M.E.; Raikwar, S.P.; Zahoor, H.; Saeed, D.; Natteru, P.A.; Iyer, S.; et al. Brain and peripheral atypical inflammatory mediators potentiate neuroinflammation and neurodegeneration. Front. Cell. Neurosci. 2017, 11, 216. [Google Scholar] [CrossRef] [PubMed]
- Neuendorf, R.; Harding, A.; Stello, N.; Hanes, D.; Wahbeh, H. Depression and anxiety in patients with Inflammatory Bowel Disease: A systematic review. J. Psychosom. Res. 2016, 87, 70–80. [Google Scholar] [CrossRef] [PubMed]
- Petruo, V.A.; Zeißig, S.; Schmelz, R.; Hampe, J.; Beste, C. Specific neurophysiological mechanisms underlie cognitive inflexibility in inflammatory bowel disease. Sci. Rep. 2017, 7, 13943. [Google Scholar] [CrossRef] [Green Version]
- Herrera, A.; Espinosa-Oliva, A.; Oliva-Martin, M.; Carrillo-Jimenez, A.; Venero, J.; de Pablos, R. Collateral Damage: Contribution of Peripheral Inflammation to Neurodegenerative Diseases. Curr. Top. Med. Chem. 2015, 15, 2193–2210. [Google Scholar] [CrossRef]
- Pellegrini, C.; Antonioli, L.; Colucci, R.; Blandizzi, C.; Fornai, M. Interplay among gut microbiota, intestinal mucosal barrier and enteric neuro-immune system: A common path to neurodegenerative diseases? Acta Neuropathol. 2018, 136, 345–361. [Google Scholar] [CrossRef]
- Rao, M.; Gershon, M.D. The bowel and beyond: The enteric nervous system in neurological disorders. Nat. Rev. Gastroenterol. Hepatol. 2016, 13, 517–528. [Google Scholar] [CrossRef] [Green Version]
- Abautret-Daly, Á.; Dempsey, E.; Parra-Blanco, A.; Medina, C.; Harkin, A. Gut-brain actions underlying comorbid anxiety and depression associated with inflammatory bowel disease. Acta Neuropsychiatr. 2018, 30, 275–296. [Google Scholar] [CrossRef] [Green Version]
- Dempsey, E.; Abautret-Daly, Á.; Docherty, N.G.; Medina, C.; Harkin, A. Persistent central inflammation and region specific cellular activation accompany depression- and anxiety-like behaviours during the resolution phase of experimental colitis. Brain. Behav. Immun. 2019, 80, 616–632. [Google Scholar] [CrossRef] [PubMed]
- Riazi, K.; Galic, M.A.; Kuzmiski, J.B.; Ho, W.; Sharkey, K.A.; Pittman, Q.J. Microglial activation and TNFα production mediate altered CNS excitability following peripheral inflammation. Proc. Natl. Acad. Sci. USA 2008, 105, 17151–17156. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zonis, S.; Pechnick, R.N.; Ljubimov, V.A.; Mahgerefteh, M.; Wawrowsky, K.; Michelsen, K.S.; Chesnokova, V. Chronic intestinal inflammation alters hippocampal neurogenesis. J. Neuroinflamm. 2015, 12, 65. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Han, Y.; Zhao, T.; Cheng, X.; Zhao, M.; Gong, S.-H.; Zhao, Y.-Q.; Wu, H.-T.; Fan, M.; Zhu, L.-L. Cortical Inflammation is Increased in a DSS-Induced Colitis Mouse Model. Neurosci. Bull. 2018, 34, 1058–1066. [Google Scholar] [CrossRef] [PubMed]
- Villarán, R.F.; Espinosa-Oliva, A.M.; Sarmiento, M.; De Pablos, R.M.; Argüelles, S.; Delgado-Cortés, M.J.; Sobrino, V.; Van Rooijen, N.; Venero, J.L.; Herrera, A.J.; et al. Ulcerative colitis exacerbates lipopolysaccharide-induced damage to the nigral dopaminergic system: Potential risk factor in Parkinson’s disease. J. Neurochem. 2010, 114, 1687–1700. [Google Scholar] [CrossRef]
- Espinosa-Oliva, A.M.; García-Miranda, P.; Alonso-Bellido, I.M.; Carvajal, A.E.; González-Rodríguez, M.; Carrillo-Jiménez, A.; Temblador, A.J.; Felices-Navarro, M.; García-Domínguez, I.; Roca-Ceballos, M.A.; et al. Galectin-3 Deletion Reduces LPS and Acute Colitis-Induced Pro-Inflammatory Microglial Activation in the Ventral Mesencephalon. Front. Pharmacol. 2021, 12, 706439. [Google Scholar] [CrossRef]
- Riazi, K.; Galic, M.A.; Kentner, A.C.; Reid, A.Y.; Sharkey, K.A.; Pittman, Q.J. Microglia-dependent alteration of glutamatergic synaptic transmission and plasticity in the hippocampus during peripheral inflammation. J. Neurosci. 2015, 35, 4942–4952. [Google Scholar] [CrossRef] [Green Version]
- Chen, J.; Winston, J.H.; Fu, Y.; Guptarak, J.; Jensen, K.L.; Shi, X.Z.; Green, T.A.; Sarna, S.K. Genesis of anxiety, depression, and ongoing abdominal discomfort in ulcerative colitis-like colon inflammation. Am. J. Physiol.-Regul. Integr. Comp. Physiol. 2015, 308, R18–R27. [Google Scholar] [CrossRef]
- Hassan, A.M.; Jain, P.; Reichmann, F.; Mayerhofer, R.; Farzi, A.; Schuligoi, R.; Holzer, P. Repeated predictable stress causes resilience against colitis-induced behavioral changes in mice. Front. Behav. Neurosci. 2014, 8, 386. [Google Scholar] [CrossRef] [Green Version]
- Nyuyki, K.D.; Cluny, N.L.; Swain, M.G.; Sharkey, K.A.; Pittman, Q.J. Altered brain excitability and increased anxiety in mice with experimental colitis: Consideration of hyperalgesia and sex differences. Front. Behav. Neurosci. 2018, 12, 58. [Google Scholar] [CrossRef]
- Mochizuki, Y.; Mizutani, T.; Shimizu, T.; Kawata, A. Proportional neuronal loss between the primary motor and sensory cortex in amyotrophic lateral sclerosis. Neurosci. Lett. 2011, 503, 73–75. [Google Scholar] [CrossRef] [PubMed]
- Brites, D.; Vaz, A.R. Microglia centered pathogenesis in ALS: Insights in cell interconnectivity. Front. Cell. Neurosci. 2014, 8, 117. [Google Scholar] [CrossRef] [PubMed]
- Yamanaka, K.; Komine, O. The multi-dimensional roles of astrocytes in ALS. Neurosci. Res. 2018, 126, 31–38. [Google Scholar] [CrossRef] [PubMed]
- Pradhan, J.; Bellingham, M.C. Neurophysiological mechanisms underlying cortical hyper-excitability in amyotrophic lateral sclerosis: A review. Brain Sci. 2021, 11, 549. [Google Scholar] [CrossRef] [PubMed]
- Ferraro, G.; Sardo, P. Nitric oxide and brain hyperexcitability. In Vivo 2004, 18, 357–366. [Google Scholar]
- Brown, G.C. Mechanisms of inflammatory neurodegeneration: INOS and NADPH oxidase. Biochem. Soc. Trans. 2007, 35, 1119–1121. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vezzani, A.; Viviani, B. Neuromodulatory properties of inflammatory cytokines and their impact on neuronal excitability. Neuropharmacology 2015, 96, 70–82. [Google Scholar] [CrossRef]
- Kempuraj, D.; Thangavel, R.; Natteru, P.A.; Selvakumar, G.P.; Saeed, D.; Zahoor, H.; Zaheer, S.; Iyer, S.S.; Zaheer, A. Neuroinflammation Induces Neurodegeneration. J. Neurol. Neurosurg. Spine 2016, 1, 1003. [Google Scholar]
- Thonhoff, J.R.; Jordan, P.M.; Karam, J.R.; Bassett, B.L.; Wu, P. Identification of early disease progression in an ALS rat model. Neurosci. Lett. 2007, 415, 264–268. [Google Scholar] [CrossRef] [Green Version]
- Hayworth, C.R.; Gonzalez-Lima, F. Pre-symptomatic detection of chronic motor deficits and genotype prediction in congenic B6.SOD1G93A ALS mouse model. Neuroscience 2009, 164, 975–985. [Google Scholar] [CrossRef] [Green Version]
- Sahara Khademullah, C.; Aqrabawi, A.J.; Place, K.M.; Dargaei, Z.; Liang, X.; Pressey, J.C.; Bedard, S.; Yang, J.W.; Garand, D.; Keramidis, I.; et al. Cortical interneuron-mediated inhibition delays the onset of amyotrophic lateral sclerosis. Brain 2020, 143, 800–810. [Google Scholar] [CrossRef] [PubMed]
- Do, J.; Woo, J. From Gut to Brain: Alteration in Inflammation Markers in the Brain of Dextran Sodium Sulfate-induced Colitis Model Mice. Clin. Psychopharmacol. Neurosci. 2018, 16, 422–433. [Google Scholar] [CrossRef] [PubMed]
- Agostini, A.; Filippini, N.; Cevolani, D.; Agati, R.; Leoni, C.; Tambasco, R.; Calabrese, C.; Rizzello, F.; Gionchetti, P.; Ercolani, M.; et al. Brain functional changes in patients with ulcerative colitis: A functional magnetic resonance imaging study on emotional processing. Inflamm. Bowel Dis. 2011, 17, 1769–1777. [Google Scholar] [CrossRef]
- Fan, W.; Zhang, S.; Hu, J.; Liu, B.; Wen, L.; Gong, M.; Wang, G.; Yang, L.; Chen, Y.; Chen, H.; et al. Aberrant brain function in active-stage ulcerative colitis patients: A resting-state functional MRI study. Front. Hum. Neurosci. 2019, 13, 107. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bao, C.H.; Liu, P.; Liu, H.R.; Wu, L.Y.; Shi, Y.; Chen, W.F.; Qin, W.; Lu, Y.; Zhang, J.Y.; Jin, X.M.; et al. Alterations in brain grey matter structures in patients with Crohn’s disease and their correlation with psychological distress. J. Crohn’s Colitis 2015, 9, 532–540. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pardillo-Díaz, R.; Carrascal, L.; Ayala, A.; Nunez-Abades, P. Oxidative stress induced by cumene hydroperoxide evokes changes in neuronal excitability of rat motor cortex neurons. Neuroscience 2015, 289, 85–98. [Google Scholar] [CrossRef]
- Carrascal, L.; Gorton, E.; Pardillo-Díaz, R.; Perez-García, P.; Gómez-Oliva, R.; Castro, C.; Nunez-Abades, P. Age-dependent vulnerability to oxidative stress of postnatal rat pyramidal motor cortex neurons. Antioxidants 2020, 9, 1307. [Google Scholar] [CrossRef]
- LoRusso, E.; Hickman, J.J.; Guo, X. Ion channel dysfunction and altered motoneuron excitability in ALS. Neurol. Disord. Epilepsy J. 2019, 3, 124. [Google Scholar]
- Pardillo-Diaz, R.; Carrascal, L.; Barrionuevo, G.; Nunez-Abades, P. Oxidative stress induced by cumene hydroperoxide produces synaptic depression and transient hyperexcitability in rat primary motor cortex neurons. Mol. Cell. Neurosci. 2017, 82, 204–217. [Google Scholar] [CrossRef]
- Torres-Torrelo, J.; Rodríguez-Rosell, D.; Nunez-Abades, P.; Carrascal, L.; Torres, B. Glutamate modulates the firing rate in oculomotor nucleus motoneurons as a function of the recruitment threshold current. J. Physiol. 2012, 590, 3113–3127. [Google Scholar] [CrossRef]
- Torres-Torrelo, J.; Torres, B.; Carrascal, L. Modulation of the input-output function by GABAA receptor-mediated currents in rat oculomotor nucleus motoneurons. J. Physiol. 2014, 592, 5047–5064. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- King, A.E.; Woodhouse, A.; Kirkcaldie, M.T.K.; Vickers, J.C. Excitotoxicity in ALS: Overstimulation, or overreaction? Exp. Neurol. 2016, 275, 162–171. [Google Scholar] [CrossRef] [PubMed]
- Takeuchi, H.; Jin, S.; Wang, J.; Zhang, G.; Kawanokuchi, J.; Kuno, R.; Sonobe, Y.; Mizuno, T.; Suzumura, A. Tumor necrosis factor-α induces neurotoxicity via glutamate release from hemichannels of activated microglia in an autocrine manner. J. Biol. Chem. 2006, 281, 21362–21368. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Garthwaite, J. Concepts of neural nitric oxide-mediated transmission. Eur. J. Neurosci. 2008, 27, 2783–2802. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shimizu, S.; Takahashi, N.; Mori, Y. TRPs as chemosensors (ROS, RNS, RCS, gasotransmitters). Handb. Exp. Pharmacol. 2014, 223, 767–794. [Google Scholar] [CrossRef]
- Zaltman, C.; Braulio, V.B.; Outeiral, R.; Nunes, T.; de Castro, C.L.N. Lower extremity mobility limitation and impaired muscle function in women with ulcerative colitis. J. Crohn’s Colitis 2014, 8, 529–535. [Google Scholar] [CrossRef] [Green Version]
- Valentini, L.; Schaper, L.; Buning, C.; Hengstermann, S.; Koernicke, T.; Tillinger, W.; Guglielmi, F.W.; Norman, K.; Buhner, S.; Ockenga, J.; et al. Malnutrition and impaired muscle strength in patients with Crohn’s disease and ulcerative colitis in remission. Nutrition 2008, 24, 694–702. [Google Scholar] [CrossRef]
- Werkstetter, K.J.; Ullrich, J.; Schatz, S.B.; Prell, C.; Koletzko, B.; Koletzko, S. Lean body mass, physical activity and quality of life in paediatric patients with inflammatory bowel disease and in healthy controls. J. Crohn’s Colitis 2012, 6, 665–673. [Google Scholar] [CrossRef] [Green Version]
- Mohammadi, B.; Kollewe, K.; Cole, D.M.; Fellbrich, A.; Heldmann, M.; Samii, A.; Dengler, R.; Petri, S.; Münte, T.F.; Krämer, U.M. Amyotrophic lateral sclerosis affects cortical and subcortical activity underlying motor inhibition and action monitoring. Hum. Brain Mapp. 2015, 36, 2878–2889. [Google Scholar] [CrossRef]
- Eisen, A.; Braak, H.; Del Tredici, K.; Lemon, R.; Ludolph, A.C.; Kiernan, M.C. Cortical influences drive amyotrophic lateral sclerosis. J. Neurol. Neurosurg. Psychiatry 2017, 88, 917–924. [Google Scholar] [CrossRef]
- Menon, P.; Kiernan, M.C.; Vucic, S. Cortical hyperexcitability precedes lower motor neuron dysfunction in ALS. Clin. Neurophysiol. 2015, 126, 803–809. [Google Scholar] [CrossRef] [PubMed]
- Carvajal, A.E.; Vázquez-Carretero, M.D.; García-Miranda, P.; Peral, M.J.; Calonge, M.L.; Ilundain, A.A. Reelin expression is up-regulated in mice colon in response to acute colitis and provides resistance against colitis. Biochim. Biophys. Acta-Mol. Basis Dis. 2017, 1863, 462–473. [Google Scholar] [CrossRef] [PubMed]
- Sofroniew, M.V. Molecular dissection of reactive astrogliosis and glial scar formation. Trends Neurosci. 2009, 32, 638–647. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hovens, I.; Nyakas, C.; Schoemaker, R. A novel method for evaluating microglial activation using ionized calcium-binding adaptor protein-1 staining: Cell body to cell size ratio. Neuroimmunol. Neuroinflamm. 2014, 1, 82–88. [Google Scholar] [CrossRef] [Green Version]
- Chhor, V.; Le Charpentier, T.; Lebon, S.; Oré, M.V.; Celador, I.L.; Josserand, J.; Degos, V.; Jacotot, E.; Hagberg, H.; Sävman, K.; et al. Characterization of phenotype markers and neuronotoxic potential of polarised primary microglia in vitro. Brain. Behav. Immun. 2013, 32, 70–85. [Google Scholar] [CrossRef]
- Pardillo-Díaz, R.; Carrascal, L.; Muñoz, M.F.; Ayala, A.; Nunez-Abades, P. Time and dose dependent effects of oxidative stress induced by cumene hydroperoxide in neuronal excitability of rat motor cortex neurons. Neurotoxicology 2016, 53, 201–214. [Google Scholar] [CrossRef]
- Segev, D.; Korngreen, A. Kinetics of two voltage-gated K+ conductances in substantia nigra dopaminergic neurons. Brain Res. 2007, 1173, 27–35. [Google Scholar] [CrossRef]
- Belujon, P.; Bezard, E.; Taupignon, A.; Bioulac, B.; Benazzouz, A. Noradrenergic modulation of subthalamic nucleus activity: Behavioral and electrophysiological evidence in intact and 6-hydroxydopamine-lesioned rats. J. Neurosci. 2007, 27, 9595–9606. [Google Scholar] [CrossRef] [Green Version]
- Carter, R.J.; Morton, J.; Dunnett, S.B. Motor Coordination and Balance in Rodents. Curr. Protoc. Neurosci. 2001, 15, 8.12.1–8.12.14. [Google Scholar] [CrossRef]
Membrane Properties | Control | DSS |
---|---|---|
Membrane resting potential (mV) | −73.66 ± 1.06 | −62.65 ± 1.52 *** |
Input resistance (MΩ) | 158.49 ± 14.35 | 212.6 ± 27.14 * |
Rheobase (pA) | 222.5 ± 4.94 | 97.08 ± 16.19 ** |
Voltage depolarization (mV) | 31.16 ± 2.50 | 20.60 ± 2.22 ** |
Voltage threshold (mV) | −39.42 ± 2.54 | −39.71 ± 1.48 |
Action potential amplitude (mV) | 120.38 ± 4.34 | 112.95 ± 3.21 |
Action potential duration (ms) | 1.69 ± 0.07 | 1.57 ± 0.08 |
Frequency gain (AP·s−1/nA) | 30.21 ± 7.89 | 57.93 ± 7.89 ** |
Maximum frequency (AP·s−1) | 29.08 ± 3.17 | 29.10 ± 2.56 |
Cancellation current (pA) | 902.16 ± 48.5 | 640. 00 ± 50.57 ** |
Motor Behaviors | Control | DSS |
---|---|---|
Total horizontal activity (beam break counts) | 1672.2 ± 157.0 | 664.5 ± 134.4 *** |
Total distance travelled (m) | 24.73 ± 1.9 | 9.76 ± 1.8 *** |
Locomotion (beam break counts) | ||
Periphery | 1309.9 ± 106.5 | 524.3 ± 102.9 *** |
Center | 259.5 ± 80.5 | 105.7 ± 39.7 * |
Percentage of time spent (%) | ||
Periphery | 91.6 ± 2.1 | 95.4 ± 1.3 |
Center | 12.2 ± 3.4 | 4.5 ± 1.3 |
Stereotyped movements (number) | 102.7 ± 9.9 | 46.4 ± 8.1 *** |
Total vertical activity (number of rearings) | 56.0 ± 4.9 | 18.1 ± 4.2 *** |
Maximum speed (cm/s) | 33.9 ± 0.8 | 1.6 ± 0.3 ** |
Percentage of time (%) | ||
Resting | 46.9 ± 2.9 | 73.1 ± 4.6 *** |
Slow locomotion | 22.3 ± 1.8 | 15.4 ± 2.5 * |
Fast locomotion | 30.7 ± 2.5 | 11.4 ± 2.4 *** |
Latency to fall (s) | ||
Trial 1 | 79.6 ± 11.9 | 38.7 ± 4.8 ** |
Trial 2 | 113.1 ± 18.14 | 58.8 ± 10.6 * |
Maximum speed in rotarod test (rpm) | ||
Trial 1 | 13.1 ± 1.4 | 8.2 ± 0.6 ** |
Trial 2 | 16.7 ± 2.0 | 10.4 ± 1.2 * |
Gene Symbol | Accession No. | Sense (5′-3′) | Antisense (5′-3′) |
---|---|---|---|
IL-1β | NM_031512.2 | CTTTCGACAGTGAGGAGAATGAC | CCACAGCCACAATGAGTGAC |
IL-6 | NM_012589.2 | ACAAGTCGGAGGCTTAATTACA | GAAAAGAGTTGTGCAATGGCAA |
iNOS | NM_012611.3 | GATGTTGAACTACGTCCTATCTCC | GTCTTG GTG AAAGCGGTGTTC |
nNOS | NM_052799.1 | CCTTTGAATACCAGCCTGATCC | TTGTGATTTGCCTGTCTCTGTG |
TNF-α | NM_012675 | CTCACACTCAGATCATCTTCTC | TGGTATGAAATGGCAAATCGG |
β-actin | NM_007393 | ACCCACACTGTGCCCATCTA | CGGAACCGCTCATTGCC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Carrascal, L.; Vázquez-Carretero, M.D.; García-Miranda, P.; Fontán-Lozano, Á.; Calonge, M.L.; Ilundáin, A.A.; Castro, C.; Nunez-Abades, P.; Peral, M.J. Acute Colon Inflammation Triggers Primary Motor Cortex Glial Activation, Neuroinflammation, Neuronal Hyperexcitability, and Motor Coordination Deficits. Int. J. Mol. Sci. 2022, 23, 5347. https://doi.org/10.3390/ijms23105347
Carrascal L, Vázquez-Carretero MD, García-Miranda P, Fontán-Lozano Á, Calonge ML, Ilundáin AA, Castro C, Nunez-Abades P, Peral MJ. Acute Colon Inflammation Triggers Primary Motor Cortex Glial Activation, Neuroinflammation, Neuronal Hyperexcitability, and Motor Coordination Deficits. International Journal of Molecular Sciences. 2022; 23(10):5347. https://doi.org/10.3390/ijms23105347
Chicago/Turabian StyleCarrascal, Livia, María D. Vázquez-Carretero, Pablo García-Miranda, Ángela Fontán-Lozano, María L. Calonge, Anunciación A. Ilundáin, Carmen Castro, Pedro Nunez-Abades, and María J. Peral. 2022. "Acute Colon Inflammation Triggers Primary Motor Cortex Glial Activation, Neuroinflammation, Neuronal Hyperexcitability, and Motor Coordination Deficits" International Journal of Molecular Sciences 23, no. 10: 5347. https://doi.org/10.3390/ijms23105347
APA StyleCarrascal, L., Vázquez-Carretero, M. D., García-Miranda, P., Fontán-Lozano, Á., Calonge, M. L., Ilundáin, A. A., Castro, C., Nunez-Abades, P., & Peral, M. J. (2022). Acute Colon Inflammation Triggers Primary Motor Cortex Glial Activation, Neuroinflammation, Neuronal Hyperexcitability, and Motor Coordination Deficits. International Journal of Molecular Sciences, 23(10), 5347. https://doi.org/10.3390/ijms23105347