Deletion of the Prdm3 Gene Causes a Neuronal Differentiation Deficiency in P19 Cells
Abstract
:1. Introduction
2. Results
2.1. The Neural Differentiation of P19 Cells Was Accompanied by an Increased Expression of Prdm3
2.2. Generation of the Prdm3 Knockout P19 Cells
2.3. The Prdm3 Gene Disruption Interfered with Neurogenesis in the RA-Induced P19 Cells
2.4. GATA Transcription Factors and Retinoic Acid Exerted a Synergistic Effect on the Activity of the Prdm3 Promoter
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Quantitative RT-PCR (RT-qPCR)
4.3. Generation of the Prdm3 Gene-Inactivated P19 Cells
4.4. Western Blotting
4.5. FACS Analysis
4.6. Establishment of the Edited P19 Cells from Single-Cell Clones
4.7. Genomic DNA Isolation, HRM PCR, and Sanger Sequencing
4.8. Plasmid Construction
4.9. Cell Transfection and the Luciferase Assays
4.10. Immunofluorescence
4.11. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
EB | Embryonic body |
Gapdh | Glyceraldehyde-3-phosphate dehydrogenase |
CRISPR | Clustered, regularly interspaced short palindromic repeats |
Cas9 | CRISPR-associated proteins 9 |
tracrRNA | Trans-activating CRISPR RNA |
crRNA | CRISPR RNA |
FACS | Fluorescence-activated cell sorting |
RNP | Ribonucleoprotein |
HRM | High-resolution melting curve |
PCR | Polymerase chain reaction |
MAP2 | Microtubule-associated protein 2 |
Oct4 | Octamer-binding transcription factor 4 |
RARα | Retinoic acid receptor alpha |
RARβ | Retinoic acid receptor beta |
Pax6 | Paired box 6 |
β-III tubulin | Tubulin beta 3 class III |
DAI | Days after induction |
GATA6 | GATA-binding factor 6 |
Prdm3 | (positive regulatory domain I-binding factor 1) and RIZ1 (retinoblastoma protein-interacting zinc finger gene 1) homologous domain containing transcription factor 3 |
RA | Retinoic acid |
RARE | Retinoic acid response element |
References
- Fumasoni, I.; Meani, N.; Rambaldi, D.; Scafetta, G.; Alcalay, M.; Ciccarelli, F.D. Family expansion and gene rearrangements contributed to the functional specialization of PRDM genes in vertebrates. BMC Evol. Boil. 2007, 7, 187. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kinameri, E.; Inoue, T.; Aruga, J.; Imayoshi, I.; Kageyama, R.; Shimogori, T.; Moore, A.W. Prdm proto-oncogene transcription factor family expression and interaction with the Notch-Hes pathway in mouse neurogenesis. PLoS ONE 2008, 3, e3859. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yoshida, M.; Nosaka, K.; Yasunaga, J.; Nishikata, I.; Morishita, K.; Matsuoka, M. Aberrant expression of the MEL1S gene identified in association with hypomethylation in adult T-cell leukemia cells. Blood 2004, 103, 2753–2760. [Google Scholar] [CrossRef] [Green Version]
- Hoyt, P.R.; Bartholomew, C.; Davis, A.J.; Yutzey, K.; Gamer, L.W.; Potter, S.S.; Ihle, J.N.; Mucenski, M.L. The Evi1 proto-oncogene is required at midgestation for neural, heart, and paraxial mesenchyme development. Mech. Dev. 1997, 65, 55–70. [Google Scholar] [CrossRef]
- Morishita, K.; Parganas, E.; Parham, D.M.; Matsugi, T.; Ihle, J.N. The Evi-1 zinc finger myeloid transforming gene is normally expressed in the kidney and in developing oocytes. Oncogene 1990, 5, 1419–1423. [Google Scholar] [PubMed]
- Fears, S.; Mathieu, C.; Zeleznik-Le, N.; Huang, S.; Rowley, J.D.; Nucifora, G. Intergenic splicing of MDS1 and EVI1 occurs in normal tissues as well as in myeloid leukemia and produces a new member of the PR domain family. Proc. Natl. Acad. Sci. USA 1996, 93, 1642–1647. [Google Scholar] [CrossRef] [Green Version]
- Moore, A.W.; Jan, L.Y.; Jan, Y.N. Hamlet, a binary genetic switch between single- and multiple- dendrite neuron morphology. Science 2002, 297, 1355–1358. [Google Scholar] [CrossRef]
- Moore, A.W.; Roegiers, F.; Jan, L.Y.; Jan, Y.N. Conversion of neurons and glia to external-cell fates in the external sensory organs of Drosophila hamlet mutants by a cousin-cousin cell-type respecification. Genes Dev. 2004, 18, 623–628. [Google Scholar] [CrossRef] [Green Version]
- Endo, K.; Karim, M.R.; Taniguchi, H.; Krejci, A.; Kinameri, E.; Siebert, M.; Ito, K.; Bray, S.J.; Moore, A.W. Chromatin modification of Notch targets in olfactory receptor neuron diversification. Nat. Neurosci. 2011, 15, 224–233. [Google Scholar] [CrossRef]
- Garriga, G.; Guenther, C.; Horvitz, H.R. Migrations of the Caenorhabditis elegans HSNs are regulated by egl-43, a gene encoding two zinc finger proteins. Genes Dev. 1993, 7, 2097–2109. [Google Scholar] [CrossRef] [Green Version]
- Kazama, H.; Kodera, T.; Shimizu, S.; Mizoguchi, H.; Morishita, K. Ecotropic viral integration site-1 is activated during, and is sufficient for, neuroectodermal P19 cell differentiation. Cell Growth Differ. Mol. Boil. J. Am. Assoc. Cancer Res. 1999, 10, 565–573. [Google Scholar]
- Hou, Q.; Ruan, H.; Gilbert, J.; Wang, G.; Ma, Q.; Yao, W.D.; Man, H.Y. MicroRNA miR124 is required for the expression of homeostatic synaptic plasticity. Nat. Commun. 2015, 6, 10045. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Harms, M.J.; Ishibashi, J.; Wang, W.; Lim, H.W.; Goyama, S.; Sato, T.; Kurokawa, M.; Won, K.J.; Seale, P. Prdm16 is required for the maintenance of brown adipocyte identity and function in adult mice. Cell Metab. 2014, 19, 593–604. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Okada, Y.; Shimazaki, T.; Sobue, G.; Okano, H. Retinoic-acid-concentration-dependent acquisition of neural cell identity during in vitro differentiation of mouse embryonic stem cells. Dev. Boil. 2004, 275, 124–142. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bonnet, E.; Touyarot, K.; Alfos, S.; Pallet, V.; Higueret, P.; Abrous, D.N. Retinoic acid restores adult hippocampal neurogenesis and reverses spatial memory deficit in vitamin A deprived rats. PLoS ONE 2008, 3, e3487. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yu, S.; Levi, L.; Siegel, R.; Noy, N. Retinoic acid induces neurogenesis by activating both retinoic acid receptors (RARs) and peroxisome proliferator-activated receptor β/δ (PPARβ/δ). J. Boil. Chem. 2012, 287, 42195–42205. [Google Scholar] [CrossRef] [Green Version]
- Haushalter, C.; Asselin, L.; Fraulob, V.; Dollé, P.; Rhinn, M. Retinoic acid controls early neurogenesis in the developing mouse cerebral cortex. Dev. Boil. 2017, 430, 129–141. [Google Scholar] [CrossRef]
- Sandell, L.L.; Sanderson, B.W.; Moiseyev, G.; Johnson, T.; Mushegian, A.; Young, K.; Rey, J.P.; Ma, J.X.; Staehling-Hampton, K.; Trainor, P.A. RDH10 is essential for synthesis of embryonic retinoic acid and is required for limb, craniofacial, and organ development. Genes Dev. 2007, 21, 1113–1124. [Google Scholar] [CrossRef] [Green Version]
- Elkabetz, Y.; Panagiotakos, G.; Al Shamy, G.; Socci, N.D.; Tabar, V.; Studer, L. Human ES cell-derived neural rosettes reveal a functionally distinct early neural stem cell stage. Genes Dev. 2008, 22, 152–165. [Google Scholar] [CrossRef] [Green Version]
- Delile, J.; Rayon, T. Single cell transcriptomics reveals spatial and temporal dynamics of gene expression in the developing mouse spinal cord. Development 2019, 146. [Google Scholar] [CrossRef] [Green Version]
- Tsuzuki, S.; Kitajima, K.; Nakano, T.; Glasow, A.; Zelent, A.; Enver, T. Cross talk between retinoic acid signaling and transcription factor GATA-2. Mol. Cell. Boil. 2004, 24, 6824–6836. [Google Scholar] [CrossRef] [Green Version]
- Engels, M.; Span, P.N.; Mitchell, R.T.; Heuvel, J.; Marijnissen-van Zanten, M.A.; van Herwaarden, A.E.; Hulsbergen-van de Kaa, C.A.; Oosterwijk, E.; Stikkelbroeck, N.M.; Smith, L.B.; et al. GATA transcription factors in testicular adrenal rest tumours. Endocr. Connect. 2017, 6, 866–875. [Google Scholar] [CrossRef] [PubMed]
- Tremblay, M.; Sanchez-Ferras, O.; Bouchard, M. GATA transcription factors in development and disease. Development 2018, 145. [Google Scholar] [CrossRef] [Green Version]
- Haugas, M.; Tikker, L.; Achim, K.; Salminen, M.; Partanen, J. Gata2 and Gata3 regulate the differentiation of serotonergic and glutamatergic neuron subtypes of the dorsal raphe. Development 2016, 143, 4495–4508. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Leszczyński, P.; Śmiech, M.; Teeli, A.S.; Zołocińska, A.; Słysz, A.; Pojda, Z.; Pierzchała, M.; Taniguchi, H. Neurogenesis Using P19 Embryonal Carcinoma Cells. J. Vis. Exp. 2019. [Google Scholar] [CrossRef]
- Jones-Villeneuve, E.M.; McBurney, M.W.; Rogers, K.A.; Kalnins, V.I. Retinoic acid induces embryonal carcinoma cells to differentiate into neurons and glial cells. J. Cell Boil. 1982, 94, 253–262. [Google Scholar] [CrossRef]
- Kobayashi, T.; Komori, R.; Ishida, K.; Kino, K.; Tanuma, S.; Miyazawa, H. Tal2 expression is induced by all-trans retinoic acid in P19 cells prior to acquisition of neural fate. Sci. Rep. 2014, 4, 4935. [Google Scholar] [CrossRef]
- Liu, X.; Chen, M.; Li, L.; Gong, L.; Zhou, H.; Gao, D. Extracellular Signal-regulated Kinases (ERKs) Phosphorylate Lin28a Protein to Modulate P19 Cell Proliferation and Differentiation. J. Boil. Chem. 2017, 292, 3970–3976. [Google Scholar] [CrossRef] [Green Version]
- Ankö, M.L.; Morales, L.; Henry, I.; Beyer, A.; Neugebauer, K.M. Global analysis reveals SRp20- and SRp75-specific mRNPs in cycling and neural cells. Nat. Struct. Mol. Boil. 2010, 17, 962–970. [Google Scholar] [CrossRef]
- Goyama, S.; Yamamoto, G.; Shimabe, M.; Sato, T.; Ichikawa, M.; Ogawa, S.; Chiba, S.; Kurokawa, M. Evi-1 is a critical regulator for hematopoietic stem cells and transformed leukemic cells. Cell Stem Cell 2008, 3, 207–220. [Google Scholar] [CrossRef] [Green Version]
- Sansom, S.N.; Griffiths, D.S.; Faedo, A.; Kleinjan, D.J.; Ruan, Y.; Smith, J.; van Heyningen, V.; Rubenstein, J.L.; Livesey, F.J. The level of the transcription factor Pax6 is essential for controlling the balance between neural stem cell self-renewal and neurogenesis. PLoS Genet. 2009, 5, e1000511. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Osumi, N.; Shinohara, H.; Numayama-Tsuruta, K.; Maekawa, M. Concise review: Pax6 transcription factor contributes to both embryonic and adult neurogenesis as a multifunctional regulator. Stem Cells 2008, 26, 1663–1672. [Google Scholar] [CrossRef] [PubMed]
- Lyu, J.; Costantini, F.; Jho, E.H.; Joo, C.K. Ectopic expression of Axin blocks neuronal differentiation of embryonic carcinoma P19 cells. J. Boil. Chem. 2003, 278, 13487–13495. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Matus, A.; Bernhardt, R.; Hugh-Jones, T. High molecular weight microtubule-associated proteins are preferentially associated with dendritic microtubules in brain. Proc. Natl. Acad. Sci. USA 1981, 78, 3010–3014. [Google Scholar] [CrossRef] [Green Version]
- Database, E.P. Eukaryotic Promoter Database. Available online: https://epd.epfl.ch//index.php (accessed on 10 October 2018).
- Tremblay, J.J.; Robert, N.M.; Viger, R.S. Modulation of endogenous GATA-4 activity reveals its dual contribution to Müllerian inhibiting substance gene transcription in Sertoli cells. Mol. Endocrinol. 2001, 15, 1636–1650. [Google Scholar] [CrossRef]
- Viger, R.S.; Guittot, S.M.; Anttonen, M.; Wilson, D.B.; Heikinheimo, M. Role of the GATA family of transcription factors in endocrine development, function, and disease. Mol. Endocrinol. 2008, 22, 781–798. [Google Scholar] [CrossRef] [Green Version]
- Pozzi, S.; Rossetti, S.; Bistulfi, G.; Sacchi, N. RAR-mediated epigenetic control of the cytochrome P450 Cyp26a1 in embryocarcinoma cells. Oncogene 2006, 25, 1400–1407. [Google Scholar] [CrossRef] [Green Version]
- Jonk, L.J.; de Jonge, M.E.; Kruyt, F.A.; Mummery, C.L.; van der Saag, P.T.; Kruijer, W. Aggregation and cell cycle dependent retinoic acid receptor mRNA expression in P19 embryonal carcinoma cells. Mech. Dev. 1992, 36, 165–172. [Google Scholar] [CrossRef]
- Pratt, M.A.; Crippen, C.A.; Ménard, M. Spontaneous retinoic acid receptor beta 2 expression during mesoderm differentiation of P19 murine embryonal carcinoma cells. Differ. Res. Biol. Divers. 2000, 65, 271–279. [Google Scholar] [CrossRef]
- Bastien, J.; Rochette-Egly, C. Nuclear retinoid receptors and the transcription of retinoid-target genes. Gene 2004, 328, 1–16. [Google Scholar] [CrossRef]
- McGlynn, K.A.; Sun, R.; Vonica, A.; Rudzinskas, S.; Zhang, Y.; Perkins, A.S. Prdm3 and Prdm16 cooperatively maintain hematopoiesis and clonogenic potential. Exp. Hematol. 2020. [Google Scholar] [CrossRef] [PubMed]
- Inoue, M.; Iwai, R.; Tabata, H.; Konno, D.; Komabayashi-Suzuki, M.; Watanabe, C.; Iwanari, H.; Mochizuki, Y.; Hamakubo, T.; Matsuzaki, F.; et al. Prdm16 is crucial for progression of the multipolar phase during neural differentiation of the developing neocortex. Development 2017, 144, 385–399. [Google Scholar] [CrossRef] [Green Version]
- Shimada, I.S.; Acar, M.; Burgess, R.J.; Zhao, Z.; Morrison, S.J. Prdm16 is required for the maintenance of neural stem cells in the postnatal forebrain and their differentiation into ependymal cells. Genes Dev. 2017, 31, 1134–1146. [Google Scholar] [CrossRef] [PubMed]
- Baizabal, J.M.; Mistry, M.; García, M.T.; Gómez, N.; Olukoya, O.; Tran, D.; Johnson, M.B.; Walsh, C.A.; Harwell, C.C. The Epigenetic State of PRDM16-Regulated Enhancers in Radial Glia Controls Cortical Neuron Position. Neuron 2018, 98, 945–962.e948. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Su, L.; Lei, X.; Ma, H.; Feng, C.; Jiang, J.; Jiao, J. PRDM16 orchestrates angiogenesis via neural differentiation in the developing brain. Cell Death Differ. 2020. [Google Scholar] [CrossRef] [PubMed]
- Sun, X.J.; Xu, P.F.; Zhou, T.; Hu, M.; Fu, C.T.; Zhang, Y.; Jin, Y.; Chen, Y.; Chen, S.J.; Huang, Q.H.; et al. Genome-wide survey and developmental expression mapping of zebrafish SET domain-containing genes. PLoS ONE 2008, 3, e1499. [Google Scholar] [CrossRef] [PubMed]
- Perkins, A.S.; Mercer, J.A.; Jenkins, N.A.; Copeland, N.G. Patterns of Evi-1 expression in embryonic and adult tissues suggest that Evi-1 plays an important regulatory role in mouse development. Development 1991, 111, 479–487. [Google Scholar]
- Verhagen, H.J.; Smit, M.A.; Rutten, A.; Denkers, F.; Poddighe, P.J.; Merle, P.A.; Ossenkoppele, G.J.; Smit, L. Primary acute myeloid leukemia cells with overexpression of EVI-1 are sensitive to all-trans retinoic acid. Blood 2016, 127, 458–463. [Google Scholar] [CrossRef] [Green Version]
- Bingemann, S.C.; Konrad, T.A.; Wieser, R. Zinc finger transcription factor ecotropic viral integration site 1 is induced by all-trans retinoic acid (ATRA) and acts as a dual modulator of the ATRA response. FEBS J. 2009, 276, 6810–6822. [Google Scholar] [CrossRef] [Green Version]
- Mishra, S.; Kelly, K.K.; Rumian, N.L.; Siegenthaler, J.A. Retinoic Acid Is Required for Neural Stem and Progenitor Cell Proliferation in the Adult Hippocampus. Stem Cell Rep. 2018, 10, 1705–1720. [Google Scholar] [CrossRef] [Green Version]
- Lee, K.; Skromne, I. Retinoic acid regulates size, pattern and alignment of tissues at the head-trunk transition. Development 2014, 141, 4375–4384. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Purton, L.E.; Bernstein, I.D.; Collins, S.J. All-trans retinoic acid enhances the long-term repopulating activity of cultured hematopoietic stem cells. Blood 2000, 95, 470–477. [Google Scholar] [CrossRef] [PubMed]
- Purton, L.E.; Dworkin, S.; Olsen, G.H.; Walkley, C.R.; Fabb, S.A.; Collins, S.J.; Chambon, P. RARgamma is critical for maintaining a balance between hematopoietic stem cell self-renewal and differentiation. J. Exp. Med. 2006, 203, 1283–1293. [Google Scholar] [CrossRef] [PubMed]
- Cabezas-Wallscheid, N.; Buettner, F.; Sommerkamp, P.; Klimmeck, D.; Ladel, L.; Thalheimer, F.B.; Pastor-Flores, D.; Roma, L.P.; Renders, S.; Zeisberger, P.; et al. Vitamin A-Retinoic Acid Signaling Regulates Hematopoietic Stem Cell Dormancy. Cell 2017, 169, 807–823.e819. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Janesick, A.; Wu, S.C.; Blumberg, B. Retinoic acid signaling and neuronal differentiation. Cell. Mol. Life Sci. 2015, 72, 1559–1576. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kamnasaran, D.; Guha, A. Expression of GATA6 in the human and mouse central nervous system. Dev. Brain Res. 2005, 160, 90–95. [Google Scholar] [CrossRef] [PubMed]
- CHOPCHOPv2. CHOPCHOPv2. Available online: https://chopchop.cbu.uib.no/ (accessed on 22 October 2018).
- Tremblay, J.J.; Viger, R.S. GATA factors differentially activate multiple gonadal promoters through conserved GATA regulatory elements. Endocrinology 2001, 142, 977–986. [Google Scholar] [CrossRef]
Gene Name | Primer Sequence | Product Size (bp) |
---|---|---|
Gapdh | F: TGACCTCAACTACATGGTCTACA R: CTTCCCATTCTCGGCCTTG | 85 |
β-III tubulin | F: CCCAGCGGCAACTATGTAGG R: CCAGACCGAACACTGTCCA | 144 |
Oct4 | F: GGCGTTCTCTTTGGAAAGGTGTTC R: CTCGAACCACATCCTTCTCT | 313 |
Pax6 | F: TAGCCCAGTATAAACGGGAGTG R: CCAGGTTGCGAAGAACTCTG | 131 |
Prdm3 | F: TTGTTTCACCCGCAATTC R: CGTGTTAGGTTCGCAGACC | 235 |
Gata3 | F: CCCCATTACCACCTATCCGC R: CCTCGACTTACATCCGAACCC | 106 |
Gata4 | F: CTCTGGAGGCGAGATGGGAC R: CGCATTGCAAGAGGCCTGGG | 254 |
Gata6 | F: TTGCTCCGGTAACAGCAGTG R: GTGGTCGCTTGTGTAGAAGGA | 105 |
Primer Name | Primer Sequence | Product Size (bp) |
---|---|---|
E4A_HRM_PCR | F: TCTCCGAGAGATCCATGGCA R: TCTTCCCCCGAGCAAACTTG | 149 |
E4A_PCR | F: GGACTTTTGGATCCCACCTT R: GGCCAGTTGTTTTGAAGCTC | 375 |
Primer Name | Primer Sequence | Product Size (bp) |
---|---|---|
Gibson_PCR | F: TTTCTCTATCGATAGGTACCGCCACCAAAATGAATTAGTCACC R: CCGGAATGCCAAGCTTAGCTCCAGGGGCAAGACC | 1700 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Leszczyński, P.; Śmiech, M.; Salam Teeli, A.; Haque, E.; Viger, R.; Ogawa, H.; Pierzchała, M.; Taniguchi, H. Deletion of the Prdm3 Gene Causes a Neuronal Differentiation Deficiency in P19 Cells. Int. J. Mol. Sci. 2020, 21, 7192. https://doi.org/10.3390/ijms21197192
Leszczyński P, Śmiech M, Salam Teeli A, Haque E, Viger R, Ogawa H, Pierzchała M, Taniguchi H. Deletion of the Prdm3 Gene Causes a Neuronal Differentiation Deficiency in P19 Cells. International Journal of Molecular Sciences. 2020; 21(19):7192. https://doi.org/10.3390/ijms21197192
Chicago/Turabian StyleLeszczyński, Paweł, Magdalena Śmiech, Aamir Salam Teeli, Effi Haque, Robert Viger, Hidesato Ogawa, Mariusz Pierzchała, and Hiroaki Taniguchi. 2020. "Deletion of the Prdm3 Gene Causes a Neuronal Differentiation Deficiency in P19 Cells" International Journal of Molecular Sciences 21, no. 19: 7192. https://doi.org/10.3390/ijms21197192