Oxidative Stress-Induced Pentraxin 3 Expression Human Retinal Pigment Epithelial Cells Is Involved in the Pathogenesis of Age-Related Macular Degeneration
Abstract
:1. Introduction
2. Results
2.1. NaIO3 Treatment Increases mRNA and Protein Levels of PTX3 in Human Retinal Pigment Epithelial Cells
2.2. NaIO3-Activated ROS, Akt, and ERK Signaling Pathway Were Regulations of PTX3 Expression in Human Retinal Pigment Epithelial Cells
2.3. NaIO3-Induced mRNA Levels of Antioxidant Enzymes Were Downregulated in PTX3 shRNA Expressing Retinal Pigment Epithelial Cells
2.4. NaIO3-Induced Cell Death and the AMD-Associated Gene Expression Were Diminished in PTX3 shRNA Expressing Retinal Pigment Epithelial Cells
3. Discussion
4. Materials and Methods
4.1. Reagents
4.2. Human Retinal Pigment Epithelial (RPE) Cell Culture
4.3. Quantitative Real-Time Reverse Transcription-Polymerase Chain Reaction (qRT-PCR)
4.4. Enzyme-Linked Immunosorbent Assay (ELISA)
4.5. Western Blot Analysis
4.6. Construction of hPTX3 shRNA Expressing ARPE-19 Cells
4.7. Cell Viability Assay
4.8. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Simó, R.; Villarroel, M.; Corraliza, L.; Hernández, C.; Garcia-Ramírez, M. The retinal pigment epithelium: Something more than a constituent of the blood-retinal barrier--implications for the pathogenesis of diabetic retinopathy. J. Biomed. Biotechnol 2010, 2010, 190724. [Google Scholar] [CrossRef]
- Bhutto, I.; Lutty, G. Understanding age-related macular degeneration (AMD): Relationships between the photoreceptor/retinal pigment epithelium/Bruch’s membrane/choriocapillaris complex. Mol. Aspects Med. 2012, 4, 295–317. [Google Scholar] [CrossRef]
- Woo, J.M.; Kwon, M.Y.; Shin, D.Y.; Kang, Y.H.; Hwang, N.; Chung, S.W. Human retinal pigment epithelial cells express the long pentraxin PTX3. Mol. Vis. 2013, 19, 303–310. [Google Scholar] [PubMed]
- Liu, X.; Xavier, C.; Jann, J.; Wu, H. Salvianolic Acid B (Sal B) Protects Retinal Pigment Epithelial Cells from Oxidative Stress-Induced Cell Death by Activating Glutaredoxin 1 (Grx1). Int. J. Mol. Sci. 2016, 17, 1835. [Google Scholar] [CrossRef]
- Inana, G.; Murat, C.; An, W.; Yao, X.; Harris, I.R.; Cao, J. RPE phagocytic function declines in age-related macular degeneration and is rescued by human umbilical tissue derived cells. J. Transl. Med. 2018, 16, 63. [Google Scholar] [CrossRef]
- Nita, M.; Grzybowski, A. The Role of the Reactive Oxygen Species and Oxidative Stress in the Pathomechanism of the Age-Related Ocular Diseases and Other Pathologies of the Anterior and Posterior Eye Segments in Adults. Oxid. Med. Cell. Longev. 2016, 2016, 3164734. [Google Scholar] [CrossRef] [PubMed]
- Moalli, F.; Jaillon, S.; Inforzato, A.; Sironi, M.; Bottazzi, B.; Mantovani, A.; Garlanda, C. Pathogen recognition by the long pentraxin PTX3. J. Biomed. Biotechnol. 2011, 2011, 830421. [Google Scholar] [CrossRef] [PubMed]
- Presta, M.; Camozzi, M.; Salvatori, G.; Rusnati, M. Role of the soluble pattern recognition receptor PTX3 in vascular biology. J. Cell. Mol. Med. 2007, 11, 723–738. [Google Scholar] [CrossRef]
- Kunes, P.; Holubcova, Z.; Kolackova, M.; Krejsek, J. Pentraxin 3 (PTX 3): An endogenous modulator of the inflammatory response. Mediat. Inflamm. 2012, 2012, 920517. [Google Scholar] [CrossRef]
- Min, J.K.; Kim, J.; Woo, J.M. Elevated Plasma Pentraxin3 Levels and Its Association with Neovascular Age-related Macular Degeneration. Ocul. Immunol. Inflamm. 2015, 23, 205–211. [Google Scholar] [CrossRef]
- Datta, S.; Cano, M.; Ebrahimi, K.; Wang, L.; Handa, J.T. The impact of oxidative stress and inflammation on RPE degeneration in non-neovascular AMD. Prog. Retin. Eye Res. 2017, 60, 201–218. [Google Scholar] [CrossRef] [PubMed]
- Sachdeva, M.M.; Cano, M.; Handa, J.T. Nrf2 signaling is impaired in the aging RPE given an oxidative insult. Exp. Eye Res. 2014, 119, 111–114. [Google Scholar] [CrossRef] [PubMed]
- Kersten, E.; Paun, C.C.; Schellevis, R.L.; Hoyng, C.B.; Delcourt, C.; Lengyel, I.; Peto, T.; Ueffing, M.; Klaver, C.C.W.; Dammeier, S.; et al. Systemic and ocular fluid compounds as potential biomarkers in age-related macular degeneration. Surv. Ophthalmol. 2018, 63, 9–39. [Google Scholar] [CrossRef] [PubMed]
- Cheng, S.C.; Huang, W.C.; S Pang, S.J.H.; Wu, Y.H.; Cheng, C.Y. Quercetin Inhibits the Production of IL-1β-Induced Inflammatory Cytokines and Chemokines in ARPE-19 Cells via the MAPK and NF-κB Signaling Pathways. Int. J. Mol. Sci. 2019, 20, 2957. [Google Scholar] [CrossRef]
- Samuel, W.; Kutty, R.K.; Sekhar, S.; Vijayasarathy, C.; Wiggert, B.; Redmond, T.M. Mitogen-activated protein kinase pathway mediates N-(4-hydroxyphenyl) retinamide-induced neuronal differentiation in the ARPE-19 human retinal pigment epithelial cell line. J. Neurochem. 2008, 106, 591–602. [Google Scholar] [CrossRef]
- Yang, I.H.; Wong, J.H.; Chang, C.M.; Chen, B.K.; Tsai, Y.T.; Chen, W.C.; Wang, E.T.; Hsu, W.L.; Chang, W.C. Involvement of intracellular calcium mobilization in IL-8 activation in human retinal pigment epithelial cells. Invest. Ophthalmol. Vis. Sci. 2015, 56, 761–769. [Google Scholar] [CrossRef]
- Cao, G.; Chen, M.; Song, Q.; Liu, Y.; Xie, L.; Han, Y.; Liu, Z.; Ji, Y.; Jiang, Q. EGCG protects against UVB-induced apoptosis via oxidative stress and the JNK1/c-Jun pathway in ARPE19 cells. Mol. Med. Rep. 2012, 5, 54–59. [Google Scholar]
- Hanus, J.; Anderson, C.; Wang, S. RPE necroptosis in response to oxidative stress and in AMD. Ageing Res. Rev. 2015, 24, 286–298. [Google Scholar] [CrossRef]
- Hanus, J.; Zhang, H.; Wang, Z.; Liu, Q.; Zhou, Q.; Wang, S. Induction of necrotic cell death by oxidative stress in retinal pigment epithelial cells. Cell Death Dis. 2013, 4, e965. [Google Scholar] [CrossRef]
- Girmens, J.F.; Sahel, J.A.; Marazova, K. Dry age-related macular degeneration: A currently unmet clinical need. Intractable Rare Dis. Res. 2012, 1, 103–114. [Google Scholar] [CrossRef]
- Gehrs, K.M.; Anderson, D.H.; Johnson, L.V.; Hageman, G.S. Age-related macular degeneration--emerging pathogenetic and therapeutic concepts. Ann. Med. 2006, 38, 450–471. [Google Scholar] [CrossRef] [PubMed]
- Bellezza, I. Oxidative Stress in Age-Related Macular Degeneration: Nrf2 as Therapeutic Target. Front. Pharmacol. 2018, 9, 1280. [Google Scholar] [CrossRef] [PubMed]
- Hwang, N.; Kwon, M.Y.; Cha, J.B.; Chung, S.W.; Woo, J.M. Tunicamycin-induced Endoplasmic Reticulum Stress Upregulates the Expression of Pentraxin 3 in Human Retinal Pigment Epithelial Cells. Korean J. Ophthalmol. 2016, 30, 468–478. [Google Scholar] [CrossRef] [PubMed]
- Juel, H.B.; Faber, C.; Munthe-Fog, L.; Bastrup-Birk, S.; Reese-Petersen, A.L.; Falk, M.K.; Singh, A.; Sørensen, T.L.; Garred, P.; Nissen, M.H. Systemic and Ocular Long Pentraxin 3 in Patients with Age-Related Macular Degeneration. PLoS ONE 2015, 10, e0132800. [Google Scholar] [CrossRef]
- Wang, L.; Cano, M.; Datta, S.; Wei, H.; Ebrahimi, K.B.; Gorashi, Y.; Garlanda, C.; Handa, J.T. Pentraxin 3 recruits complement factor H to protect against oxidative stress-induced complement and inflammasome overactivation. J. Pathol. 2016, 240, 495–506. [Google Scholar] [CrossRef]
- Chan, C.M.; Huang, D.Y.; Sekar, P.; Hsu, S.H.; Lin, W.W. Correction to: Reactive oxygen species-dependent mitochondrial dynamics and autophagy confer protective effects in retinal pigment epithelial cells against sodium iodate-induced cell death. J. Biomed. Sci. 2019, 26, 40. [Google Scholar] [CrossRef]






| Human Gene | Forward Primer Sequence 5′ to 3′ | Reverse Primer Sequence 5′ to 3′ |
|---|---|---|
| PTX3 | AATGCATCTCCTTGCGATTC | TGAAGTGCTTGTCCCATTCC |
| G6PDH | TGAGCCAGATAGGCTGGAA | TAACGCAGGCGATGTTGTC |
| GSR | TCACCAAGTCCCATATAGAAATC | GTGTAGGACTAGCGGTGT |
| GPX1 | CCAAGCTCATCACCTGGTCT | TCGATGTCAATGGTCTGGAA |
| SOD1 | GAAGGTGTGGGGAAGCATTA | ACATTGCCCAAGTCTCCAAC |
| SOD2 | CGTGACTTTGGTTCCTTTGAC | AGTGTCCCCGTTCCTTATTGA |
| CAT | CGTGCTGAATGAGGAACAGA | AGTCAGGGTGGACCTCAGTG |
| CFH | TACTGGCTGGATACCTGCTC | CCTGACGGAGTCTCAAAATG |
| CFI | GGTGAGGTGGACTGCATTACA | CCTCCCACAATTCGTTTCCTTC |
| APOE | AACTGGCACTGGGTCGCTTT | GCCTTCAACTCCTTCATGGTCTCGT |
| TLR4 | ACTTGGACCTTTCCAGCAAC | TTTAAATGCACCTGGTTGGA |
| β-actin | ATCGTGCGTGACATTAAGGAGAAG | AGGAAGGAAGGCTGGAAGAGTG |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hwang, N.; Kwon, M.-Y.; Woo, J.M.; Chung, S.W. Oxidative Stress-Induced Pentraxin 3 Expression Human Retinal Pigment Epithelial Cells Is Involved in the Pathogenesis of Age-Related Macular Degeneration. Int. J. Mol. Sci. 2019, 20, 6028. https://doi.org/10.3390/ijms20236028
Hwang N, Kwon M-Y, Woo JM, Chung SW. Oxidative Stress-Induced Pentraxin 3 Expression Human Retinal Pigment Epithelial Cells Is Involved in the Pathogenesis of Age-Related Macular Degeneration. International Journal of Molecular Sciences. 2019; 20(23):6028. https://doi.org/10.3390/ijms20236028
Chicago/Turabian StyleHwang, Narae, Min-Young Kwon, Je Moon Woo, and Su Wol Chung. 2019. "Oxidative Stress-Induced Pentraxin 3 Expression Human Retinal Pigment Epithelial Cells Is Involved in the Pathogenesis of Age-Related Macular Degeneration" International Journal of Molecular Sciences 20, no. 23: 6028. https://doi.org/10.3390/ijms20236028
APA StyleHwang, N., Kwon, M.-Y., Woo, J. M., & Chung, S. W. (2019). Oxidative Stress-Induced Pentraxin 3 Expression Human Retinal Pigment Epithelial Cells Is Involved in the Pathogenesis of Age-Related Macular Degeneration. International Journal of Molecular Sciences, 20(23), 6028. https://doi.org/10.3390/ijms20236028
