Next Article in Journal
Proteomic Studies Reveal Disrupted in Schizophrenia 1 as a Player in Both Neurodevelopment and Synaptic Function
Next Article in Special Issue
Inducible Loss of the Aryl Hydrocarbon Receptor Activates Perigonadal White Fat Respiration and Brown Fat Thermogenesis via Fibroblast Growth Factor 21
Previous Article in Journal
Beyond a Measure of Liver Function—Bilirubin Acts as a Potential Cardiovascular Protector in Chronic Kidney Disease Patients
Previous Article in Special Issue
The Aryl Hydrocarbon Receptor and the Maintenance of Lung Health
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Communication

NAP Family CG5017 Chaperone Pleiotropically Regulates Human AHR Target Genes Expression in Drosophila Testis

by
Angelina A. Akishina
,
Julia E. Vorontsova
,
Roman O. Cherezov
,
Mikhail S. Slezinger
,
Olga B. Simonova
* and
Boris A. Kuzin
Koltzov Institute of Developmental Biology, Russian Academy of Sciences, Vavilova str. 26, Moscow 119991, Russia
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2019, 20(1), 118; https://doi.org/10.3390/ijms20010118
Submission received: 31 October 2018 / Revised: 11 December 2018 / Accepted: 13 December 2018 / Published: 29 December 2018
(This article belongs to the Special Issue Aryl Hydrocarbon Receptor in Biology and Toxicology)

Abstract

To study the regulatory mechanism of the Aryl hydrocarbon receptor (AHR), target genes of transcription are necessary for understanding the normal developmental and pathological processes. Here, we examined the effects of human AHR ligands on male fecundity. To induce ectopic human AhR gene expression, we used Drosophila melanogaster transformed with human AhR under the control of a yeast UAS promoter element capable of activation in the two-component UAS-GAL4 system. We found that exogenous AHR ligands decrease the number of Drosophila gonadal Tj-positive cells. We also found both an increase and decrease of AHR target gene expression, including in genes that control homeostasis and testis development. This suggests that gonadal AHR activation may affect the expression of gene networks that control sperm production and could be critical for fertility not just in Drosophila but also in humans. Finally, we found that the activation of the expression for some AHR target genes depends on the expression of testis-specific chaperone CG5017 in gonadal cells. Since CG5017 belongs to the nucleosome assembly protein (NAP) family and may participate in epigenetic regulation, we propose that this nucleotropic chaperone is essential to provide the human AHR with access to only the defined set of its target genes during spermatogenesis.

1. Introduction

There is evidence that the Aryl hydrocarbon receptor (AHR) plays an important role in normal development and cancerogenesis [1,2,3,4,5,6,7,8,9,10,11,12,13,14]. A proper concentration of activated AHR is important for cell survival and organism functioning [15,16,17,18,19]. Ligand binding is critical for AHR activation, because after the binding it moves to the nucleus, dimerizes with the Aryl hydrocarbon receptor nuclear translocator (ARNT), and starts functioning as a transcriptional factor which binds to specific DNA sequences known as the xenobiotic response elements (XRE), driving expression of its target genes [20,21]. An increased risk of cancer and the inability to protect cells against the toxic effects of xenobiotics are the most dramatic consequences of the decreased AHR expression [22,23]. Activation of AHR in inappropriate tissues and organs causes abnormal development, including disorders in the immune, nervous, endocrine, cardiovascular, and generative systems. Among AHR target genes, there are many genes that encode proteins responsible for homeostasis, and maintaining these is necessary for successful adaptation in new ecological niches [21,24]. Human and mammal AHRs are activated by different endogenous and exogenous ligands (xenobiotics), while in invertebrates, AHR is activated only by endogenous ligands [3,24,25,26,27,28,29]. There is a wide range of affinities of xenobiotic ligands to AHR [30]. It is believed that the ligand binding affinities can modulate AHR’s ability to trigger the expression of its target genes [31]. The growth of the chemical and pharmaceutical industries has created conditions under which every person has a risk of exposure to xenobiotics. This may result in a variety of activations of ectopic AHR target genes in different tissues and at different stages of development.
Cell culture experiments do not provide a full understanding of the effects induced by AHR ectopic expression on the development of living organisms. For a better understanding of the function of human AHR in vivo, we created “humanized” Drosophila transgenic flies, which carry transgenes with the controlled expression of the human AhR gene guided by the yeast upstream activation sequence (UAS) [32]. This transgenic construct permits the induction of human AHR expression in certain Drosophila organs and cells with the help of tissue-specific GAL4-driver lines expressing a yeast GAL4 activator capable of recognizing UAS sequences and driving the transcription of downstream genes [33]. As most human AHR exogenous ligands are not capable of activating the Drosophila AHR homolog, this allows us to estimate the specificity of their action when adding them into the Drosophila food medium. It was shown that mouse AHR and Drosophila ARNT homolog (Tango) could form a functional transcriptional complex capable of inducing the dioxin-mediated activation of AHR target gene expressions in Drosophila [28].
We decided to use Drosophila as a verified model system to investigate the in vivo effects of human AHR ligands (xenobiotics) during development. In previous experiments using UAS-AhR/GAL4-driver flies, we have demonstrated that AHR activation could both increase and decrease transcription of AHR target genes in different tissues, and found that this effect depends on the developmental stage of the animal [32]. It is important to note that the effect of xenobiotics on the levels of AHR target gene activity was more clearly manifested in organs with a high number of proliferating cells. In adult organs, in which cell proliferation is complete, the actions of ligands on AHR target gene transcription levels were not detected. We found that the ligand’s effect on AHR target gene expression is mediated by the polycomb group (PcG) epigenetic chromatin regulators [32]. A similar xenobiotic effect may be expected in humans. In other words, we may expect the absence of the xenobiotic’s action on differentiated cells in humans. However, in adult humans, like in Drosophila imagoes, there are organs in which cells are continuously dividing. Some of these organs are testes. It is expected that ectopic AHR expression induced by xenobiotics may be the cause of various disturbances of spermatogenesis in humans.
In this paper, we apply Drosophila transformed with human AhR to estimate a possible negative effect induced by xenobiotics on human spermatogenesis. We demonstrated that the ectopic activation of human AHR in Drosophila testis cells caused a decrease in male fecundity, a decrease in the number of testis Tj-positive cells, and a change in the level of AHR target gene transcriptions. We concluded that exposure to AHR ligands could potentially lead to the risk of male infertility. Notably, we also found that the activation in the expression of some AHR target genes depends on the expression of testis-specific chaperone CG5017 in gonadal cells. Since CG5017 belongs to the nucleosome assembly protein (NAP) family [34] and may participate in epigenetic regulation, we proposed that this nucleotropic chaperone is essential to provide human AHR access to a defined set (but not all) of its target genes in soma during spermatogenesis.

2. Results and Discussion

2.1. The Effect of AHR Exogenous Ligands on Male Fecundity

We have previously demonstrated that Drosophila may serve as a valid model organism to investigate the complex effects of xenobiotics on human AHR functioning in vivo [32]. In order to investigate the effects of xenobiotics on male fecundity, we used Drosophila males carrying inducible human AhR (the UAS-AhR construct is described in Reference [32]) and Tj-GAL4 drivers. In Drosophila testes, the Tj-GAL4 driver activates UAS-constructs in cells which are in connection with generative cells. We refused to use the Nos-GAL4 driver, which activates the UAS-constructs in germ-line cells since the fertility of UAS-AhR/Nos-GAL4 males was low even without exposure to exogenous ligands (about 50% according to our unpublished data, n = 46). This indicates the presence of endogenous AHR ligands capable of activating human AHR in Drosophila Nos-positive cells that could potentially falsify experimental results. The fertility of UAS-AhR/Tj-GAL4 males raised on standard nutrient medium or fed with xenobiotic was not disturbed (100%, n = 50). It allowed us to study the effect of xenobiotic-mediated AHR activation on male fecundity using Tj-Gal4 driver.
The fecundity of UAS-AhR/Tj-GAL4 males fed with xenobiotics and of control UAS-AhR/Tj-GAL4 males (without exposure to xenobiotic) was measured by mating them to wild-type Oregon R females and counting the number of undeveloped eggs produced per female over a four-day period. The replacement of fertilized females with virgins was performed daily. The effects of exogenous ligands on UAS-AhR/Tj-GAL4 males resulted in an increase in the proportion of undeveloped eggs in the first two days after ligand action (Figure 1). Most of the effect is caused by indirubin and beta-Naphthoflavone in the first two days after ligand exposure. Remarkably, these effects are completely reversible; when flies fed with the xenobiotic are shifted back to a standard diet, male fecundity is rapidly restored. The mechanism by which it is restored is not clear yet.
Most likely, the decline in male fecundity was caused by the disturbances in testes cells involved in the formation of the functional spermatozoa. In the Drosophila testis, germ-line stem cells and progenitor somatic stem cells reside at the tip of the testis, known as the apical hub [35]. Tj positive cells are important for the differentiation of the germ-line [35]. As we used a Tj-Gal4 driver to generate AHR misexpression, we proposed that the reason for the decrease in fecundity of Tj-GAL4/UAS-AhR males in response to exogenous ligands might be due to the disruptions in division of Tj-positive cells.
To test our hypothesis, we estimated the number of Tj-positive cells in testes of UAS-AhR/Tj-GAL4 flies fed with AHR exogenous ligands for two days, also using control UAS-AhR/Tj-GAL4 flies developed on a standard medium. We found that the testes of flies fed with xenobiotics were thinner (Figure 2), and a decrease in the average number of Tj-positive cells per testis was observed in flies fed with xenobiotics for 3 days (indirubin 75.8 ± 6.19; n = 18, beta-Naphthoflavone: 86 ± 9.7; n = 13, indinol: 79.8 ± 8.1; n = 14) when compared to testes from males raised on the standard medium (106.3 ± 8.25; n = 24) (Figure 2E). No remarkable differences between testis of Tj-GAL4/+ flies fed with xenobiotic and testis of flies with the same genotype developed on standard medium were detected (Appendix A Figure A1). Thinner testes were typical for only UAS-AhR/Tj-GAL4 flies fed with xenobiotic so we attributed this effect to the ectopic AHR activation.
In Drosophila testis, the absence of Tj-positive cells blocks normal spermatogenesis [36]. Thus, the decrease in the number of Tj-positive cells in response to human AHR activation by exogenous ligands in testes of UAS-AhR/Tj-GAL4 flies could be the reason of a reduced production of spermatozoa and decreased male fecundity.
We believe that the cause of the detected functional and morphological differences between the control and experimental males should be due to the activities of the AHR targeted genes that regulate homeostasis and cell division.

2.2. The Effects of Exogenous Ligands and Testis-Specific Chaperone CG5017 on the Expression of AHR Target Genes in Drosophila Testes

To assess the ability of xenobiotics to influence the expression of human AHR target genes in Drosophila testes, we first identified potential human AHR target genes in Drosophila (described in Reference [32]). We selected several putative Drosophila homologs of human AHR targets genes containing XRE-elements in their regulatory regions: Mannosyl (α-1,3-)-glycoprotein β-1,2-N-acetylglucosaminyltransferase 1 (Mgat1), which participates in the determination of adult lifespan relating to mushroom body development; Glutathione S transferase T4 (GstT4), which is involved in oxidation-reduction processes and catalyzes reactions of biotransformation; Cytochrome P450 6g1 (Cyp6g1), which is involved in the oxidation-reduction process, response to DDT, and the insecticide catabolic process; N-acetylneuraminic acid synthase (Nans), which participates in the carbohydrate biosynthetic process; Relish (Rel), which encodes the NF-κB subunit; p53, which is a transcriptional factor required for adaptive responses to genotoxic stresses, including cell death, compensatory proliferation and DNA repair; Myc, a transcription factor related to proto-oncogenes, which contributes to cell growth, cell competition, and regenerative proliferation; dаcapo (dap), which encodes the Cyclin-dependent kinase inhibitor; the Retinoblastoma-family protein (Rbf), which provides negative regulation of the G1/S transition of mitotic cell cycles; Jun-related antigen (Jra), which is involved in positive regulation of the metabolic process, humoral immune response, aging, and RNA polymerase II transcription factor activity; and Dcdc42 (Cdc42), which is a key regulator of the actin cytoskeleton, playing a central role in actin cytoskeleton organization, morphogenesis, hemocyte migration, cell polarity, and wound repair.
To investigate the effects of exogenous ligands in vivo, we analyzed the expression of AHR target genes by RT-PCR in testes of UAS-AhR/Tj-GAL4 flies fed with xenobiotics for two days. To activate human AHR, we used exogenous ligands known to act as agonists of this receptor. This means that these molecules only cause an increase in the transcription levels of AHR target genes [20,37]. We found that induced human AHR had pleiotropic effects on its target genes, depending on the nature of the exogenous ligand. In other words, the xenobiotic-mediated effect of human AHR activity in testes of UAS-AhR/Tj-GAL4 flies resulted in three different ways: Some experienced a decrease in the gene expression, some an increase in gene expression, and several genes had no response to AHR activity (Figure 3). For example, the activation of human AHR by indirubin resulted in the activation of almost all genes tested except Mgat1, Cyp6g1, and Myc. The activation of human AHR by beta-Naphthoflavone resulted in the activation of Cyp6g, Rel, and Myc, and the suppression of Mgat1 and dap genes. The activation of the human AHR by indinol resulted in the suppression of Cyp6g and the weak activation of Mgat1, GstT4, Csas, Rel, p53, Myc, and Jra genes.
In our previous study, a similar effect was found [32]. We attributed this effect to the epigenetic repressive state of chromatin, which limits the ability of a human AHR to access XREs and control its target gene expression in the Drosophila genome. This hypothesis was confirmed in our experiments, through which we demonstrated that the effects of exogenous ligands on AHR target genes are mediated by the polycomb group (PcG) epigenetic chromatin regulators [32].
The formation of the epigenetic state of genes involved not only Pc and Trx complexes, but also NAP family nucleotropic chaperones which control the activity of H2A-H2B histones [34,37,38,39,40]. It was previously shown that NAP family CG5017 and spineless (ss, D. melanogaster homologue of mammalian AhR) act synergistically, controlling morphogenesis, memory, and detoxification [41,42]. The synergy in the genetic interactions between hypomorphic mutations of ss and CG5017 may reflect the involvement of NAP family chaperones in the regulation of AHR-signaling in D. melanogaster. We decided to study the effect of CG5017 on human AHR target gene transcription in somatic cells of Drosophila testis. To test this, we performed experiments using UAS-AhR/Tj-GAL4 flies carrying a mutant hypomorphic allele of CG5017-ssaSc [43,44]. To activate human AHR in UAS-AhR/Tj-GAL4; ssaSc flies we added indirubin, beta-Naphthoflavone, and indinol into the nutrient medium. The mRNA levels of AHR target genes were measured by RT-PCR in testes of UAS-AhR/Tj-GAL4; ssaSc flies fed with exogenous ligands for 2 days. Flies of the same genotype developed on the standard nutrient medium were used as a control. A remarkable increase in the transcription of some AHR target genes was observed (Figure 4).
Activation of AHR by xenobiotics on the background of a mutant allele of CG5017 omitted the silencing of AHR target genes involved in maintaining cell homeostasis (Table 1). For example, the activation of human AHR by indirubin resulted in strong activation of Cyp6g1 (up to 22 times). The activation of human AHR by beta-Naphthoflavone de-repressed Mgat1 (up to 3–5 times), and omitted the silencing of GstT4, Csas and Nans. The activation of human AHR by indinol is not very pronounced and resulted in de-repression of Cyp6g1. On the other hand, the transcription levels of genes regulating cell proliferation and differentiation were either not affected or were decreased (Figure 4, Table 1).
The regulatory mechanism of AHR target gene expression by CG5017 is not clear. Since CG5017 belongs to the nucleosome assembly protein (NAP) family [34] and may participate in epigenetic regulation, we proposed that this nucleotropic chaperone could be essential to enable human AHR to access only a defined set of its target genes in soma during spermatogenesis.
Our results indicate a complex, multi-step regulatory mechanism of proper AHR target gene transcription which can be disrupted by exogenous ligands, which may be the cause of many diseases [45]. We hope that further study of the exogenous ligands’ action mechanisms will help in the development of strategies for limiting xenobiotic effects and reducing pathology.

3. Materials and Methods

3.1. Fly Stocks, Rearing Conditions, Reagents and Crosses

UAS-AhR strain with inducible human AhR gene expression in D. melanogaster genome was generated early [32]. Wild type Oregon R and Tj-GAL4/Cy strains were obtained from Bloomington Drosophila stock center. Also, we used ssaSc strain with hypomorphic mutations of CG5017 and spineless genes [43,44].
Flies were reared on nutrient Formula 4-24 Instant Drosophila Medium (Carolina Biological Supply, Burlington, NC, USA). Following ligands were used: 2′Z-Indirubin (Sigma-Aldrich, St. Louis, MO, USA), beta-Naphthoflavone (Thermo Fisher Scientific, Waltham, MA, USA), Indole-3-Carbinol (Mirax Biopharma, Moscow, Russia). Ligand solutions were prepared as described in [32]. Final concentrations of beta-Naphthoflavone, indirubin and indole-3-carbinol were 200 µg/g medium, 25 µg/g medium, 10 µg/g medium correspondently.
Ligands were fed to imago F1 offspring after the crossing of Tj-GAL4 males with UAS-AhR females. Parents were kept on standard Formula 4-24 medium. After hatching flies of first day old were selected for feeding experiments. Flies were kept at room temperature (25 °C).
To obtain flies of UAS-AhR/Tj-GAL4; ssaSc genotype we crossed UAS-AhR/Cy; ssaSc/D females with Tj-GAL4/Cy; ssaSc/D males and flies without balancer chromosomes were further selected in the F1 offspring. Flies were kept at room temperature (22 °C).

3.2. Calculation of Undeveloped Eggs Frequency

Reproductive output was measured at 25 °C. Imago males Tj-GAL4/UAS-AhR (n = 7) were fed with ligands solutions for 2 days whereupon males were crossed with Oregon R virgin females (n = 7) in fresh medium vials. During four days we replaced fertilized Oregon R females with virgin ones after 24 hr and counted the total number of eggs laid. We considered unfertilized eggs that did not develop within 24-25 hr. The experiment was performed three times. The proportion of daily undeveloped eggs per female was calculated using the following formula: [(Number of undeveloped eggs/Total number of eggs) × 100%]/[Number of females tested].

3.3. Real-Time Reverse-Transcription PCR Analysis

Experiments have been done in triplicate as described previously [32]. Primers and TaqMan® probes used for RT-qPCR experiments are available in Appendix A Table A1.

3.4. Immunohistochemistry

Experiments have been done as described previously [32]. Primary antibody used in our work is guinea-pig polyclonal anti-Tj (1:5000) [46]. Secondary antibodies (1:200) were conjugated to Alexa Fluor–488 (Molecular Probes, Waltham, MA, USA). DNA was stained with SytoxGreen (1:500, Thermo Fisher Scientific, Waltham, MA, USA).

3.5. Microscopic Analysis

The resulting immunostaining preparations were examined using Leica TCS SP5 confocal microscope using a multichannel mode with a 40 × immersion oil lens. The images were recorded with a z-resolution of 0.7–0.8 μm.

3.6. Image Analysis

The resulting images were imported into Imaris® 5.0.1 (Bitplane AG, Belfast, UK) for further processing. Estimation of somatic cells on the confocal images was carried out by measuring number of Tj-stained cells. Student’s t-tests were used confirmation of statistical significance. The threshold of statistical significance was p ≤ 0.01 for beta-Naphthoflavone and p ≤ 0.001 for indirubin and indinol.

Author Contributions

Conceptualization, O.B.S. and B.A.K.; Data curation, J.E.V., R.O.C., O.B.S. and B.A.K.; Formal analysis, A.A.A., J.E.V., R.O.C. and M.S.S.; Funding acquisition, J.E.V. and O.B.S.; Investigation, A.A.A., J.E.V., R.O.C. and M.S.S.; Methodology, A.A.A., J.E.V., R.O.C. and M.S.S.; Project administration, O.B.S. and B.A.K.; Resources, J.E.V., R.O.C., M.S.S., O.B.S. and B.A.K.; Software, A.A.A., J.E.V. and R.O.C.; Supervision, B.A.K.; Validation, A.A.A., J.E.V. and R.O.C.; Visualization, A.A.A. and J.E.V.; Writing–original draft, A.A.A., J.E.V., R.O.C., O.B.S. and B.A.K.; Writing–review&editing, O.B.S. and B.A.K.

Funding

This research was funded by RFBR (project No. 16-04-00829-a, 18-34-00162 mol-a) and was partly conducted in the frame of IDB RAS government program of basic research No. 0108-2019-0001.

Acknowledgments

The authors thank Bloomington Drosophila stock center for the providing Drosophila stocks. We are grateful to Dr. Dorothea Godt for the providing of anti-TJ antibodies. We are grateful to Dr. Lyudmila Olenina for the help in calculation of Tj-positive cells.

Conflicts of Interest

The authors declare no conflict of interest.

Abbreviations

AHRAryl Hydrocarbon Receptor
NAPNucleosome Assembly Protein
TJTraffic jam
UASUpstream Activating Sequence

Appendix A

Table A1. Sequences of primer pairs and TaqMan® probes used in this study. FAM fluorescent dye (6-carboxy fluorescein) was used for labeling oligonucleotides. BHQ1 (Black Hole Quencher-1) is used as a dark quencher.
Table A1. Sequences of primer pairs and TaqMan® probes used in this study. FAM fluorescent dye (6-carboxy fluorescein) was used for labeling oligonucleotides. BHQ1 (Black Hole Quencher-1) is used as a dark quencher.
Gene symbolTitleSequences (5′–3′)
CsasCSASt1GAAATTGGTGGCTCATCGCT
CSASt2GGAACTCCGAAATGGCATGA
CSASTAQFAM-CGTCTCTGGCGAATTTCTCAGGCCG-BHQ1
NansNANSt1TGCCCTGCCGAAATAAACTG
NANSt2TCCAAGAAATCCTCCGCTGT
NANSTAQFAM-AGTCAGTGAACCCAGCGGCCT-BHQ1
Mgat1mgat1fTGATTTCAAGAGCGGTGTTC
mgat1rGGCGGTACTCTGTCCTTAGC
mgataqFAM-TACAACAAACGGCGCGTGCA-BHQ1
GstT4cg1681fTTCGCACCCACTCTAGTCAC
cg1681rGCTCGATTGGTTCAGGAAAT
cg1681taqFAM- TCAACGAGATGTCGCAGCCACTC- BHQ1
Cyp6g1Cyp6g1fGCGATCCATTGGGCTATAAT
Cyp6g1rCCAATCTCCTGCATAAGGGT
Cyp6g1taqFAM- TCGCACCAAGCTGACTCCCG-BHQ1
RelRelfGAAAGTAGCGATGCTGGTCA
RelrTGTTGTCCATTTCGGTGTCT
ReltaqFAM-TCCAACTCCACGGAATCCTCGTC-BHQ1
p53p53fGTACTCGATTCCGCTGAACA
p53rCACGCAAATTAAGTGGTTGG
p53taqFAM-CTGAACGTCCACGTTGAAGGCC-BHQ1
MycdmfCCGCGCTACAATAACTTCAA
dmrGCAGTTCTGATACGGTGTGC
dmtaqFAM-TCGGTGGCCAACTCGCGTTA-BHQ1
dapdacfCAGAGATGTACACCCTAA
dacrGGAGTCGTAACAAGATTC
dactaqFAM-TTATCCGTGTTCGACTCTAGCG-BHQ1
JrajrafTTCACACTAACTCCCAGGCA
jrarCTCGGTCATGTTGGTGTAGG
jrataqFAM-CAACTGCGGCAGCCATGACA-BHQ1
RbfRbfCTGGCGAAGAGGTAATAGCC
RbrGGACTTCGCTAGTTGGAAGC
RbtaqFAM-CTTCGCCTCCGTTGACGGGT-BHQ1
Cdc42cdc42fCGAGATTACACACCATTGCC
cdc42rATGGGCTTCTGCTTGTTCTT
cdc42taqFAM-TGCTGTTCTCGTCGCGCAAA-BHQ1
Rpl32Rpl32dirCCAGCATACAGGCCCAAGATC
Rpl32revACGCACTCTGTTGTCGATACC
Rpl32probeFAM-CGCACCAAGCACTTCATCCGCCAC-BHQ1
Figure A1. Merged confocal immunofluorescence images of apical tips of testis stained with SytoxGreen to highlight DNA (green) and anti-Tj to visualize Tj-positive cells (red). Testes are from Tj-Gal4/+ males: (left) raised on standard medium; (right) fed for 3 days with indirubin. A number of Tj-positive cells in testis of flies developed on standard medium or fed with xenobiotic was the same (100.1 ± 5.2; n = 22 and 104.8 ± 7.7; n = 19 correspondently). Scale bars, 30 µm.
Figure A1. Merged confocal immunofluorescence images of apical tips of testis stained with SytoxGreen to highlight DNA (green) and anti-Tj to visualize Tj-positive cells (red). Testes are from Tj-Gal4/+ males: (left) raised on standard medium; (right) fed for 3 days with indirubin. A number of Tj-positive cells in testis of flies developed on standard medium or fed with xenobiotic was the same (100.1 ± 5.2; n = 22 and 104.8 ± 7.7; n = 19 correspondently). Scale bars, 30 µm.
Ijms 20 00118 g0a1

References

  1. Israel, D.I.; Whitlock, J.P. Regulation of cytochrome P1–450 gene transcription by 2,3,7,8-tetrachlorodibenzo-p-dioxin in wild type and variant mouse hepatoma cells. J. Biol. Chem. 1984, 259, 5400–5402. [Google Scholar]
  2. Ko, H.P.; Okino, S.T.; Ma, Q.; Whitlock, J.P. Dioxin-induced CYP1A1 transcription in vivo: the aromatic hydrocarbon receptor mediates transactivation, enhancer-promoter communication, and changes in chromatin structure. Mol. Cell. Biol. 1996, 16, 430–436. [Google Scholar] [CrossRef] [Scilit]
  3. Duncan, D.M.; Burgess, E.A.; Duncan, I. Control of distal antennal identity and tarsal development in Drosophila by spineless-aristapedia, a homolog of the mammalian dioxin receptor. Genes Dev. 1998, 12, 1290–1303. [Google Scholar] [CrossRef] [Scilit]
  4. Nebert, D.W.; Roe, A.L.; Dieter, M.Z.; Solis, W.A.; Yang, Y.; Dalton, T.P. Role of the aromatic hydrocarbon receptor and (Ah) gene battery in the oxidative stress response, cell cycle control, and apoptosis. Biochem. Pharmacol. 2000, 59, 65–85. [Google Scholar] [CrossRef] [Scilit]
  5. Emmons, R.B.; Duncan, D.; Estes, P.A.; Kiefel, P.; Mosher, J.T.; Sonnenfeld, M.; Ward, M.P.; Duncan, I.; Crews, S.T. The spineless-aristapedia and tango bHLH-PAS proteins interact to control antennal and tarsal development in Drosophila. Development 1999, 126, 3937–3945. [Google Scholar]
  6. Tijet, N.; Boutros, P.C.; Moffat, I.D.; Okey, A.B.; Tuomisto, J.; Pohjanvirta, R. Aryl hydrocarbon receptor regulates distinct dioxin-dependent and dioxin-independent gene batteries. Mol. Pharmacol. 2006, 69, 140–153. [Google Scholar] [CrossRef] [Scilit]
  7. Gasiewicz, T.A.; Singh, K.P.; Casado, F.L. The aryl hydrocarbon receptor has an important role in the regulation of hematopoiesis: implications for benzene-induced hematopoietic toxicity. Chem. Biol. Interact. 2010, 184, 246–251. [Google Scholar] [CrossRef] [Scilit]
  8. Kiss, E.A.; Vonarbourg, C.; Kopfmann, S.; Hobeika, E.; Finke, D.; Esser, C.; Diefenbach, A. Natural aryl hydrocarbon receptor ligands control organogenesis of intestinal lymphoid follicles. Science 2011, 334, 1561–1565. [Google Scholar] [CrossRef] [Scilit]
  9. Li, Y.; Innocentin, S.; Withers, D.R.; Roberts, N.A.; Gallagher, A.R.; Grigorieva, E.F.; Wilhelm, C.; Veldhoen, M. Exogenous stimuli maintain intraepithelial lymphocytes via aryl hydrocarbon receptor activation. Cell 2011, 147, 629–640. [Google Scholar] [CrossRef] [Scilit]
  10. Quintana, F.J.; Basso, A.S.; Iglesias, A.H.; Korn, T.; Farez, M.F.; Bettelli, E.; Caccamo, M.; Oukka, M.; Weiner, H.L. Control of T(reg) and T(H)17 cell differentiation by the aryl hydrocarbon receptor. Nature 2008, 453, 65–71. [Google Scholar] [CrossRef] [Scilit]
  11. Akahoshi, E.; Yoshimura, S.; Ishihara-Sugano, M. Over-expression of AhR (aryl hydrocarbon receptor) induces neural differentiation of Neuro2a cells: neurotoxicology study. Environ Health 2006, 5, 24. [Google Scholar] [CrossRef] [Scilit]
  12. Walisser, J.A.; Glover, E.; Pande, K.; Liss, A.L.; Bradfield, C.A. Aryl hydrocarbon receptor-dependent liver development and hepatotoxicity are mediated by different cell types. Proc. Natl. Acad. Sci. USA 2005, 102, 17858–17863. [Google Scholar] [CrossRef] [Scilit]
  13. Boitano, A.E.; Wang, J.; Romeo, R.; Bouchez, L.C.; Parker, A.E.; Sutton, S.E.; Walker, J.R.; Flaveny, C.A.; Perdew, G.H.; Denison, M.S.; et al. Aryl Hydrocarbon Receptor Antagonists Promote the Expansion of Human Hematopoietic Stem Cells. Science 2010, 329, 1345–1348. [Google Scholar] [CrossRef] [Scilit]
  14. Narasimhan, S.; Stanford Zulick, E.; Novikov, O.; Parks, A.J.; Schlezinger, J.J.; Wang, Z.; Laroche, F.; Feng, H.; Mulas, F.; Monti, S.; et al. Towards Resolving the Pro- and Anti-Tumor Effects of the Aryl Hydrocarbon Receptor. Int. J. Mol. Sci. 2018, 19, 1388. [Google Scholar] [CrossRef] [Scilit]
  15. Butler, R.A.; Kelley, M.L.; Powell, W.H.; Hahn, M.E.; Van Beneden, R.J. An aryl hydrocarbon receptor (AHR) homologue from the soft-shell clam, Mya arenaria: evidence that invertebrate AHR homologues lack 2,3,7,8-tetrachlorodibenzo-p-dioxin and beta-naphthoflavone binding. Gene 2001, 278, 223–234. [Google Scholar] [CrossRef] [Scilit]
  16. Schmidt, J.V.; Su, G.H.; Reddy, J.K.; Simon, M.C.; Bradfield, C.A. Characterization of a murine Ahr null allele: involvement of the Ah receptor in hepatic growth and development. Proc. Natl. Acad. Sci. USA 1996, 93, 6731–6736. [Google Scholar] [CrossRef] [Scilit]
  17. Fernandez-Salguero, P.; Pineau, T.; Hilbert, D.M.; McPhail, T.; Lee, S.S.; Kimura, S.; Nebert, D.W.; Rudikoff, S.; Ward, J.M.; Gonzalez, F.J. Immune system impairment and hepatic fibrosis in mice lacking the dioxin-binding Ah receptor. Science 1995, 268, 722–726. [Google Scholar] [CrossRef] [Scilit]
  18. Mimura, J.; Yamashita, K.; Nakamura, K.; Morita, M.; Takagi, T.N.; Nakao, K.; Ema, M.; Sogawa, K.; Yasuda, M.; Katsuki, M.; et al. Loss of teratogenic response to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in mice lacking the Ah (dioxin) receptor. Genes Cells 1997, 2, 645–654. [Google Scholar] [CrossRef] [Scilit]
  19. Benedict, J.C.; Lin, T.M.; Loeffler, I.K.; Peterson, R.E.; Flaws, J.A. Physiological role of the aryl hydrocarbon receptor in mouse ovary development. Toxicol. Sci. 2000, 56, 382–388. [Google Scholar] [CrossRef] [Scilit]
  20. Busbee, P.B.; Rouse, M.; Nagarkatti, M.; Nagarkatti, P.S. Use of natural AhR ligands as potential therapeutic modalities against inflammatory disorders. Nutr. Rev. 2013, 71, 353–369. [Google Scholar] [CrossRef] [Scilit]
  21. Lo, R.; Celius, T.; Forgacs, A.L.; Dere, E.; MacPherson, L.; Harper, P.; Zacharewski, T.; Matthews, J. Identification of aryl hydrocarbon receptor binding targets in mouse hepatic tissue treated with 2,3,7,8-tetrachlorodibenzo-p-dioxin. Toxicol. Appl. Pharmacol. 2011, 257, 38–47. [Google Scholar] [CrossRef] [Scilit]
  22. Nebert, D.W. The Ah locus: genetic differences in toxicity, cancer, mutation, and birth defects. Crit. Rev. Toxicol. 1989, 20, 153–174. [Google Scholar] [CrossRef] [Scilit]
  23. Singh, K.P.; Wyman, A.; Casado, F.L.; Garrett, R.W.; Gasiewicz, T.A. Treatment of mice with the Ah receptor agonist and human carcinogen dioxin results in altered numbers and function of hematopoietic stem cells. Carcinogenesis 2009, 30, 11–19. [Google Scholar] [CrossRef] [Scilit]
  24. Stegeman, J.J. and Hahn, M.E. Biochemistry and molecular biology of monooxygenases: current perspectives on forms, functions, and regulation of cytochrome P450 in aquatic species. In Aquatic toxicology, molecular, biochemical and cellular perspectives; Malins, D.C., Ostrander, G.K., Eds.; CRC Press: Boca Raton, FL, USA, 1994; pp. 87–206. [Google Scholar]
  25. Hahn, M.E.; Poland, A.; Glover, E.; Stegeman, J.J. Photoaffinity Labeling of the Ah Receptor: Phylogenetic Survey of Diverse Vertebrate and Invertebrate Species. Arch. Biochem. Biophys. 1994, 310, 218–228. [Google Scholar] [CrossRef] [Scilit]
  26. Hahn, M.E. The aryl hydrocarbon receptor: a comparative perspective. Comp. Biochem. Physiol. C Pharmacol. Toxicol. Endocrinol. 1998, 121, 23–53. [Google Scholar] [CrossRef] [Scilit]
  27. Hahn, M.E. Aryl hydrocarbon receptors: diversity and evolution. Chem. Biol. Interact. 2002, 141, 131–160. [Google Scholar] [CrossRef] [Scilit]
  28. Céspedes, M.A.; Galindo, M.I.; Couso, J.P. Dioxin toxicity in vivo results from an increase in the dioxin-independent transcriptional activity of the aryl hydrocarbon receptor. PLoS ONE 2010, 5, e15382. [Google Scholar] [CrossRef] [Scilit]
  29. Jaronen, M.; Quintana, F.J. Immunological Relevance of the Coevolution of IDO1 and AHR. Frontiers in Immunology 2014, 5. [Google Scholar] [CrossRef] [Scilit]
  30. Jin, U.-H.; Lee, S.; Safe, S. Aryl hydrocarbon receptor (AHR)-active pharmaceuticals are selective AHR modulators in MDA-MB-468 and BT474 breast cancer cells. J. Pharmacol. Exp. Ther. 2012, 343, 333–341. [Google Scholar] [CrossRef] [Scilit]
  31. Murray, I.A.; Morales, J.L.; Flaveny, C.A.; Dinatale, B.C.; Chiaro, C.; Gowdahalli, K.; Amin, S.; Perdew, G.H. Evidence for ligand-mediated selective modulation of aryl hydrocarbon receptor activity. Mol. Pharmacol. 2010, 77, 247–254. [Google Scholar] [CrossRef] [Scilit]
  32. Akishina, A.A.; Vorontsova, J.E.; Cherezov, R.O.; Mertsalov, I.B.; Zatsepina, O.G.; Slezinger, M.S.; Panin, V.M.; Petruk, S.; Enikolopov, G.N.; Mazo, A.; et al. Xenobiotic-induced activation of human aryl hydrocarbon receptor target genes in Drosophila is mediated by the epigenetic chromatin modifiers. Oncotarget 2017, 8. [Google Scholar] [CrossRef] [Scilit]
  33. Brand, A.H.; Perrimon, N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 1993, 118, 401–415. [Google Scholar]
  34. Kimura, S. The Nap family proteins, CG5017/Hanabi and Nap1, are essential for Drosophila spermiogenesis. FEBS Lett. 2013, 587, 922–929. [Google Scholar] [CrossRef] [Scilit]
  35. Davies, E.L.; Fuller, M.T. Regulation of self-renewal and differentiation in adult stem cell lineages: lessons from the Drosophila male germ line. Cold Spring Harb. Symp. Quant. Biol. 2008, 73, 137–145. [Google Scholar] [CrossRef] [Scilit]
  36. Li, M.A.; Alls, J.D.; Avancini, R.M.; Koo, K.; Godt, D. The large Maf factor Traffic Jam controls gonad morphogenesis in Drosophila. Nature Cell Biology 2003, 5, 994–1000. [Google Scholar] [CrossRef] [Scilit]
  37. Andrews, A.J.; Chen, X.; Zevin, A.; Stargell, L.A.; Luger, K. The histone chaperone Nap1 promotes nucleosome assembly by eliminating nonnucleosomal histone DNA interactions. Mol. Cell 2010, 37, 834–842. [Google Scholar] [CrossRef] [Scilit]
  38. Chen, X.; D’Arcy, S.; Radebaugh, C.A.; Krzizike, D.D.; Giebler, H.A.; Huang, L.; Nyborg, J.K.; Luger, K.; Stargell, L.A. Histone Chaperone Nap1 Is a Major Regulator of Histone H2A-H2B Dynamics at the Inducible GAL Locus. Mol. Cell. Biol. 2016, 36, 1287–1296. [Google Scholar] [CrossRef] [Scilit]
  39. Doyen, C.M.; Chalkley, G.E.; Voets, O.; Bezstarosti, K.; Demmers, J.A.; Moshkin, Y.M.; Verrijzer, C.P. A Testis-Specific Chaperone and the Chromatin Remodeler ISWI Mediate Repackaging of the Paternal Genome. Cell Rep. 2015, 13, 1310–1318. [Google Scholar] [CrossRef] [Scilit]
  40. Aguilar-Gurrieri, C.; Larabi, A.; Vinayachandran, V.; Patel, N.A.; Yen, K.; Reja, R.; Ebong, I.; Schoehn, G.; Robinson, C.V.; Pugh, B.F.; et al. Structural evidence for Nap1-dependent H2A–H2B deposition and nucleosome assembly. The EMBO Journal 2016, 35, 1465–1482. [Google Scholar] [CrossRef] [Scilit]
  41. Dubnau, J.; Chiang, A.-S.; Grady, L.; Barditch, J.; Gossweiler, S.; McNeil, J.; Smith, P.; Buldoc, F.; Scott, R.; Certa, U.; et al. The staufen/pumilio pathway is involved in Drosophila long-term memory. Curr. Biol. 2003, 13, 286–296. [Google Scholar] [CrossRef] [Scilit]
  42. Kuzin, B.A.; Nikitina, E.A.; Cherezov, R.O.; Vorontsova, J.E.; Slezinger, M.S.; Zatsepina, O.G.; Simonova, O.B.; Enikolopov, G.N.; Savvateeva-Popova, E.V. Combination of hypomorphic mutations of the Drosophila homologues of aryl hydrocarbon receptor and nucleosome assembly protein family genes disrupts morphogenesis, memory and detoxification. PLoS ONE 2014, 9, e94975. [Google Scholar] [CrossRef] [Scilit]
  43. Kuzin, B.A.; Doszhanov, K.T.; Simonova, O.B.; Gerasimova, T.I.; Guliaev, D.V. A new allele variant of ssa and its participation in regulating the proliferation of the stem elements of the leg and antenna imaginal disks in Drosophila melanogaster. Ontogenez 1991, 22, 212–216. [Google Scholar]
  44. Kuzin, B.A.; Modestova, E.A.; Vorontsova, I.E.; Zatsepina, O.G.; Mikaelian, A.S.; Slezinger, M.V.; Simonova, O.B. Interaction of the ss and CG5017 genes in the regulation of morphogensis of limbs in Drosophila melanogaster. Ontogenez 2010, 41, 364–369. [Google Scholar] [CrossRef] [Scilit]
  45. Hsu, C.-N.; Lin, Y.-J.; Lu, P.-C.; Tain, Y.-L. Maternal Resveratrol Therapy Protects Male Rat Offspring against Programmed Hypertension Induced by TCDD and Dexamethasone Exposures: Is It Relevant to Aryl Hydrocarbon Receptor? Int. J. Mol. Sci. 2018, 19, 2459. [Google Scholar] [CrossRef] [Scilit]
  46. Gunawan, F.; Arandjelovic, M.; Godt, D. The Maf factor Traffic jam both enables and inhibits collective cell migration in Drosophila oogenesis. Development 2013, 140, 2808–2817. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Daily effect of exogenous ligands on the proportion of undeveloped eggs from wild-type female after crossing with UAS-AhR/Tj-GAL4 male without exposure to ligands (control, orange), exposed to indirubin (blue), beta-Naphthoflavone (azure), indinol (green). Data correspond to the mean ± SD of three independent experiments. Asterisks mean the significant difference compared to the control group. Statistical analysis was performed using Student’s t-test (* p ≤ 0.05).
Figure 1. Daily effect of exogenous ligands on the proportion of undeveloped eggs from wild-type female after crossing with UAS-AhR/Tj-GAL4 male without exposure to ligands (control, orange), exposed to indirubin (blue), beta-Naphthoflavone (azure), indinol (green). Data correspond to the mean ± SD of three independent experiments. Asterisks mean the significant difference compared to the control group. Statistical analysis was performed using Student’s t-test (* p ≤ 0.05).
Ijms 20 00118 g001
Figure 2. Xenobiotic-mediated activation of human AHR in cells of Drosophila testis causes a decrease in number of Tj-positive cells. (AD) Confocal immunofluorescence sections of the apical tip of testes stained with SytoxGreen to highlight DNA (green) and anti-Tj to visualize Tj-positive cells (red). The third column represents merged images. (A) Testes are from flies raised on standard medium or fed for 3 days with (B) indirubin, (C) beta-Naphthoflavone, (D) indinol. All tested males were of the same UAS-AhR/Tj-Gal4 genotype. Note that apical tips of males fed with xenobiotics are smaller than apical tip of male fed with standard medium. Scale bars, 30 µm. (E) Quantification of Tj-positive cells in testes of UAS-AhR/Tj-GAL4 flies raised on standard medium (No ligand) and on medium with indirubin, beta-Naphthoflavone and indinol for 3 days counted at the 4th day after feeding. Error bars represent 90% confidence interval of the mean. Asterisks indicate statistically significant difference using Student’s t-test (* p ≤ 0.01; ** p ≤ 0.001).
Figure 2. Xenobiotic-mediated activation of human AHR in cells of Drosophila testis causes a decrease in number of Tj-positive cells. (AD) Confocal immunofluorescence sections of the apical tip of testes stained with SytoxGreen to highlight DNA (green) and anti-Tj to visualize Tj-positive cells (red). The third column represents merged images. (A) Testes are from flies raised on standard medium or fed for 3 days with (B) indirubin, (C) beta-Naphthoflavone, (D) indinol. All tested males were of the same UAS-AhR/Tj-Gal4 genotype. Note that apical tips of males fed with xenobiotics are smaller than apical tip of male fed with standard medium. Scale bars, 30 µm. (E) Quantification of Tj-positive cells in testes of UAS-AhR/Tj-GAL4 flies raised on standard medium (No ligand) and on medium with indirubin, beta-Naphthoflavone and indinol for 3 days counted at the 4th day after feeding. Error bars represent 90% confidence interval of the mean. Asterisks indicate statistically significant difference using Student’s t-test (* p ≤ 0.01; ** p ≤ 0.001).
Ijms 20 00118 g002
Figure 3. Different effects of human AHR exogenous ligands on AHR target gene mRNA levels in testes of UAS-AhR/Tj-GAL4 flies. Relative mRNA levels were analyzed by real-time PCR in testes dissected from UAS-AhR/Tj-GAL4 flies fed with indirubin, beta-Naphthoflavone or indinol for 2 days. UAS-AhR/Tj-GAL4 flies developed on standard medium were used as a control. Transcript levels are represented as means ± SD (error bars). * p < 0.05, compared to the control. Statistical analysis was performed using Student’s t-test.
Figure 3. Different effects of human AHR exogenous ligands on AHR target gene mRNA levels in testes of UAS-AhR/Tj-GAL4 flies. Relative mRNA levels were analyzed by real-time PCR in testes dissected from UAS-AhR/Tj-GAL4 flies fed with indirubin, beta-Naphthoflavone or indinol for 2 days. UAS-AhR/Tj-GAL4 flies developed on standard medium were used as a control. Transcript levels are represented as means ± SD (error bars). * p < 0.05, compared to the control. Statistical analysis was performed using Student’s t-test.
Ijms 20 00118 g003
Figure 4. Decreased expression of CG5017 nucleotropic chaperone leads to ligand dependent activation in transcription of some AHR target genes. Relative mRNA levels were analyzed by real-time PCR in testes dissected from UAS-AhR/Tj-GAL4; ssaSc flies fed with indirubin, beta-Naphthoflavone or indinol for 2 days. UAS-AhR/Tj-GAL4; ssaSc flies developed on standard medium were used as a control. Transcript levels are represented as means ± SD (error bars). * p < 0.05, compared to the control. Statistical analysis was performed using Student’s t-test.
Figure 4. Decreased expression of CG5017 nucleotropic chaperone leads to ligand dependent activation in transcription of some AHR target genes. Relative mRNA levels were analyzed by real-time PCR in testes dissected from UAS-AhR/Tj-GAL4; ssaSc flies fed with indirubin, beta-Naphthoflavone or indinol for 2 days. UAS-AhR/Tj-GAL4; ssaSc flies developed on standard medium were used as a control. Transcript levels are represented as means ± SD (error bars). * p < 0.05, compared to the control. Statistical analysis was performed using Student’s t-test.
Ijms 20 00118 g004
Table 1. The decreased expression of nucleotropic chaperone CG5017 activates ligand-dependent transcription of some AHR target genes. Summarized results of real-time PCR experiments shown on Figure 3 and Figure 4. «+/+» and «ssaSc» columns represent results shown on Figure 3 and Figure 4 respectively. «+», «−» and «0» mean the increasing expression, the decreasing expression and no effect, respectively. Red pluses mean the remarkable increasing in transcription on the background of mutant CG5017.
Table 1. The decreased expression of nucleotropic chaperone CG5017 activates ligand-dependent transcription of some AHR target genes. Summarized results of real-time PCR experiments shown on Figure 3 and Figure 4. «+/+» and «ssaSc» columns represent results shown on Figure 3 and Figure 4 respectively. «+», «−» and «0» mean the increasing expression, the decreasing expression and no effect, respectively. Red pluses mean the remarkable increasing in transcription on the background of mutant CG5017.
Gene Symbol Ligand
Indirubinbeta-NaphthoflavoneIndinol
Allele of CG5017
+/+ssaSc+/+ssaSc+/+ssaSc
Mgat10+++
GstT4+00+++
Cyp6g10++++
Csas+00++0
Nans+00+00
Rel+0+++0
p53+00+
Myc0+++
dap+00
Rbf+000
Jra+000+
Cdc42++00

Share and Cite

MDPI and ACS Style

Akishina, A.A.; Vorontsova, J.E.; Cherezov, R.O.; Slezinger, M.S.; Simonova, O.B.; Kuzin, B.A. NAP Family CG5017 Chaperone Pleiotropically Regulates Human AHR Target Genes Expression in Drosophila Testis. Int. J. Mol. Sci. 2019, 20, 118. https://doi.org/10.3390/ijms20010118

AMA Style

Akishina AA, Vorontsova JE, Cherezov RO, Slezinger MS, Simonova OB, Kuzin BA. NAP Family CG5017 Chaperone Pleiotropically Regulates Human AHR Target Genes Expression in Drosophila Testis. International Journal of Molecular Sciences. 2019; 20(1):118. https://doi.org/10.3390/ijms20010118

Chicago/Turabian Style

Akishina, Angelina A., Julia E. Vorontsova, Roman O. Cherezov, Mikhail S. Slezinger, Olga B. Simonova, and Boris A. Kuzin. 2019. "NAP Family CG5017 Chaperone Pleiotropically Regulates Human AHR Target Genes Expression in Drosophila Testis" International Journal of Molecular Sciences 20, no. 1: 118. https://doi.org/10.3390/ijms20010118

APA Style

Akishina, A. A., Vorontsova, J. E., Cherezov, R. O., Slezinger, M. S., Simonova, O. B., & Kuzin, B. A. (2019). NAP Family CG5017 Chaperone Pleiotropically Regulates Human AHR Target Genes Expression in Drosophila Testis. International Journal of Molecular Sciences, 20(1), 118. https://doi.org/10.3390/ijms20010118

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop