Alteration of Transcripts of Stress-Protective Genes and Transcriptional Factors by γ-Aminobutyric Acid (GABA) Associated with Improved Heat and Drought Tolerance in Creeping Bentgrass (Agrostis stolonifera)
Abstract
1. Introduction
2. Results
2.1. Physiological Effects of GABA under Heat and Drought Stress
2.2. Genes Associated with Signaling Transduction and Transcription Factors Affected by GABA
2.3. Genes Associated with Antioxidant Enzymes Affected by GABA
2.4. Genes Associated with Stress-Related Proteins Affected by GABA
3. Discussion
4. Materials and Methods
4.1. Plant Materials and Growth Conditions
4.2. GABA and Stress Treatments
4.3. Physiological Analysis
4.4. Total RNA Extraction and qRT-PCR Analysis
4.5. Statistical Analysis
5. Conclusions
Author Contributions
Acknowledgments
Conflicts of Interest
References
- Wahid, A.; Gelani, S.; Ashraf, M.; Foolad, M.R. Heat tolerance in plants: An overview. Environ. Exp. Bot. 2007, 61, 199–223. [Google Scholar] [CrossRef] [Scilit]
- Jaleel, C.A.; Manivannan, P.; Wahid, A.; Farooq, M.; Al-Juburi, H.J.; Somasundaram, R.; Panneerselvam, R. Drought stress in plants: A review on morphological characteristics and pigments composition. Int. J. Agric. Biol. 2009, 11, 100–105. [Google Scholar]
- Sgobba, A.; Paradiso, A.; Dipierro, S.; De Gara, L.; de Pinto, M.C. Changes in antioxidants are critical in determining cell responses to short- and long-term heat stress. Physiol. Plant. 2015, 153, 68–78. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rivero, R.M.; Kojima, M.; Gepstein, A.; Sakakibara, H.; Mittler, R.; Gepstein, S.; Blumwald, E. Delayed leaf senescence induces extreme drought tolerance in a flowering plant. Proc. Natl. Acad. Sci. USA 2007, 104, 19631–19636. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rejeb, I.B.; Pastor, V.; Mauch-Mani, B. Plant responses to simultaneous biotic and abiotic stress: Molecular mechanisms. Plants 2014, 3, 458–475. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kotak, S.; Larkindale, J.; Lee, U.; von Koskull-Döring, P.; Vierling, E.; Scharf, K.D. Complexity of the heat stress response in plants. Curr. Opin. Plant Biol. 2007, 10, 310–316. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lopez, C.G.; Banowetz, G.M.; Peterson, C.J.; Kronstad, W.E. Dehydrin expression and drought tolerance in seven wheat cultivars. Crop Sci. 2003, 43, 577–582. [Google Scholar] [CrossRef] [Scilit]
- Jiang, Y.; Huang, B. Drought and heat stress injury to two cool-season turfgrasses in relation to antioxidant metabolism and lipid peroxidation. Crop Sci. 2001, 41, 436–442. [Google Scholar] [CrossRef] [Scilit]
- Li, Z.; Zhang, Y.; Zhang, X.; Peng, Y.; Merewitz, E.; Ma, X.; Huang, L.; Yan, Y. The alterations of endogenous polyamines and phytohormones induced by exogenous application of spermidine regulate antioxidant metabolism, metallothionein and relevant genes conferring drought tolerance in white clover. Environ. Exp. Bot. 2016, 124, 22–38. [Google Scholar] [CrossRef] [Scilit]
- Singh, K.B.; Foley, R.C.; Oñate-Sánchez, L. Transcription factors in plant defense and stress responses. Curr. Opin. Plant Biol. 2002, 5, 430–436. [Google Scholar] [CrossRef] [Scilit]
- Zhang, J.; Jia, W.; Yang, J.; Ismail, A.M. Role of ABA in integrating plant responses to drought and salt stresses. Field Crops Res. 2006, 97, 111–119. [Google Scholar] [CrossRef] [Scilit]
- Larkindale, J.; Huang, B. Thermotolerance and antioxidant systems in Agrostis stolonifera: Involvement of salicylic acid, abscisic acid, calcium, hydrogen peroxide, and ethylene. J. Plant Physiol. 2004, 161, 405–413. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kinnersley, A.M.; Turano, F.J. Gamma aminobutyric acid (GABA) and plant responses to stress. Crit. Rev. Plant Sci. 2000, 19, 479–509. [Google Scholar] [CrossRef]
- Du, H.; Wang, Z.; Yu, W.; Liu, Y.; Huang, B. Differential metabolic responses of perennial grass Cynodon transvaalensis × Cynodon dactylon (C4) and Poa Pratensis (C3) to heat stress. Physiol. Plant 2011, 141, 251–264. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shi, S.Q.; Shi, Z.; Jiang, Z.P.; Qi, L.W.; Sun, X.M.; Li, C.X.; Liu, J.F.; Xiao, W.F.; Zhang, S.G. Effects of exogenous GABA on gene expression of Caragana intermedia roots under NaCl stress: Regulatory roles for H2O2 and ethylene production. Plant Cell Environ. 2010, 33, 149–162. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Charlton, A.J.; Donarski, J.A.; Harrison, M.; Jones, S.A.; Godward, J.; Oehlschlager, S.; Arques, J.L.; Ambrose, M.; Chinoy, C.; Mullineaux, P.M. Responses of the pea (Pisum sativum L.) leaf metabolome to drought stress assessed by nuclear magnetic resonance spectroscopy. Metabolomics 2008, 4, 312–327. [Google Scholar]
- Nayyar, H.; Kaur, R.; Kaur, S.; Singh, R. γ-Aminobutyric acid (GABA) imparts partial protection from heat stress injury to rice seedlings by improving leaf turgor and upregulating osmoprotectants and antioxidants. J. Plant Growth Regul. 2014, 33, 408–419. [Google Scholar] [CrossRef] [Scilit]
- Vijayakumari, K.; Puthur, J.T. γ-Aminobutyric acid (GABA) priming enhances the osmotic stress tolerance in Piper nigrum Linn. plants subjected to PEG-induced stress. Plant Growth Regul. 2016, 78, 1–11. [Google Scholar] [CrossRef] [Scilit]
- Mekonnen, D.W.; Flügge, U.I.; Ludewig, F. Gamma-aminobutyric acid depletion affects stomata closure and drought tolerance of Arabidopsis thaliana. Plant Sci. 2016, 245, 25–34. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Signorelli, S.; Dans, P.D.; Coitiño, E.L.; Borsani, O.; Monza, J. Connecting proline and γ-aminobutyric acid in stressed plants through non-enzymatic reactions. PLoS ONE 2015, 10, e0115349. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shelp, B.J.; Bozzo, G.G.; Trobacher, C.P.; Zarei, A.; Deyman, K.L.; Brikis, C.J. Hypothesis/review: Contribution of putrescine to 4-aminobutyrate (GABA) production in response to abiotic stress. Plant Sci. 2012, 193, 130–135. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barbosa, J.M.; Singh, N.K.; Cherry, J.H.; Locy, R.D. Nitrate uptake and utilization is modulated by exogenous γ-aminobutyric acid in Arabidopsis thaliana seedlings. Plant Physiol. Biochem. 2010, 48, 443–450. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Beuve, N.; Rispail, N.; Laine, P.; Cliquet, J.B.; Ourry, A.; Le Deunff, E. Putative role of γ-aminobutyric acid (GABA) as a long-distance signal in up-regulation of nitrate uptake in Brassica napus L. Plant Cell Environ. 2004, 27, 1035–1046. [Google Scholar] [CrossRef] [Scilit]
- Renault, H.; El Amrani, A.; Palanivelu, R.; Updegraff, E.P.; Yu, A.; Renou, J.P.; Preuss, D.; Bouchereau, A.; Deleu, C. GABA accumulation causes cell elongation defects and a decrease in expression of genes encoding secreted and cell wall-related proteins in Arabidopsis thaliana. Plant Cell Physiol. 2011, 52, 894–908. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Z.; Zhang, Y.; Peng, D.; Wang, X.; Peng, Y.; He, X.; Zhang, X.; Ma, X.; Huang, L.; Yan, Y. Polyamine regulates tolerance to water stress in leaves of white clover associated with antioxidant defense and dehydrin genes via involvement in calcium messenger system and hydrogen peroxide signaling. Front. Physiol. 2015, 6, 280. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fry, J.; Huang, B.R. Applied Turfgrass Science and Physiology; John Wiley & Sons: Hoboken, NJ, USA, 2004. [Google Scholar]
- Warnke, S. Creeping Bentgrass (Agrostis stolonifera L.). Turfgrass Biology, Genetics, and Breeding; John Wiley & Sons: Hoboken, NJ, USA, 2003; pp. 175–185. [Google Scholar]
- Bouche, N.; Fromm, H. GABA in plants: Just a metabolite? Trends Plant Sci. 2004, 9, 110–115. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Krishnan, S.; Laskowski, K.; Shukla, V.; Merewitz, E.B. Mitigation of drought stress damage by exogenous application of a non-protein amino acid γ–aminobutyric acid on perennial ryegrass. J. Am. Soc. Hort. Sci. 2013, 138, 358–366. [Google Scholar]
- Lanteri, M.L.; Pagnussat, G.C.; Lamattina, L. Calcium and calcium-dependent protein kinases are involved in nitric oxide-and auxin-induced adventitious root formation in cucumber. J. Exp. Bot. 2006, 57, 1341–1351. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shinozaki, K.; Yamaguchi-Shinozaki, K. Gene expression and signal transduction in water-stress response. Plant Physiol. 1997, 115, 327–334. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Boudsocq, M.; Sheen, J. CDPKs in immune and stress signaling. Trends Plant Sci. 2013, 18, 30–40. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ludwig, A.A.; Saitoh, H.; Felix, G.; Freymark, G.; Miersch, O.; Wasternack, C.; Boller, T.; Jones, J.D.; Romeis, T. Ethylene-mediated cross-talk between calcium-dependent protein kinase and MAPK signaling controls stress responses in plants. Proc. Natl. Acad. Sci. USA 2005, 102, 10736–10741. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xiong, L.; Schumaker, K.S.; Zhu, J.K. Cell signaling during cold, drought, and salt stress. Plant Cell 2002, 14, S165–S183. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Comparot, S.; Lingiah, G.; Martin, T. Function and specificity of 14-3-3 proteins in the regulation of carbohydrate and nitrogen metabolism. J. Exp. Bot. 2003, 54, 595–604. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Camoni, L.; Harper, J.F.; Palmgren, M.G. 14-3-3 proteins activate a plant calcium-dependent protein kinase (CDPK). FEBS Lett. 1998, 430, 381–384. [Google Scholar] [CrossRef] [Scilit]
- Roberts, M.R.; Salinas, J.; Collinge, D.B. 14-3-3 proteins and the response to abiotic and biotic stress. Plant Mol. Biol. 2002, 50, 1031–1039. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yan, J.; He, C.; Wang, J.; Mao, Z.; Holaday, S.A.; Allen, R.D.; Zhang, H. Overexpression of the Arabidopsis 14-3-3 protein GF14λ in cotton leads to a “stay-green” phenotype and improves stress tolerance under moderate drought conditions. Plant Cell Physiol. 2004, 45, 1007–1014. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, W.F.; Shi, W.M. Mechanisms of salt tolerance in transgenic Arabidopsis thaliana constitutively overexpressing the tomato 14-3-3 protein TFT7. Plant Soil 2007, 301, 17–28. [Google Scholar] [CrossRef] [Scilit]
- Banerjee, A.; Roychoudhury, A. Abscisic-acid-dependent basic leucine zipper (bZIP) transcription factors in plant abiotic stress. Protoplasma 2015, 254, 1–14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, X.; Shiroto, Y.; Kishitani, S.; Ito, Y.; Toriyama, K. Enhanced heat and drought tolerance in transgenic rice seedlings overexpressing OsWRKY11 under the control of HSP101 promoter. Plant Cell Rep. 2009, 28, 21–30. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, S.; Kang, J.; Cho, D.I.; Park, J.H.; Kim, S.Y. ABF2, an ABRE-binding bZIP factor, is an essential component of glucose signaling and its overexpression affects multiple stress tolerance. Plant J. 2004, 40, 75–87. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, X.; Wollenweber, B.; Jiang, D.; Liu, F.; Zhao, J. Water deficits and heat shock effects on photosynthesis of a transgenic Arabidopsis thaliana constitutively expressing ABP9, a bZIP transcription factor. J. Exp. Bot. 2008, 59, 839–848. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oh, S.J.; Song, S.I.; Kim, Y.S.; Jang, H.J.; Kim, S.Y.; Kim, M.; Kim, Y.K.; Nahm, B.H.; Kim, J.K. Arabidopsis CBF3/DREB1A and ABF3 in transgenic rice increased tolerance to abiotic stress without stunting growth. Plant Physiol. 2005, 138, 341–351. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, L.; Deng, X.; Shan, L. The response mechanism of active oxygen species removing system to drought stress. Acta Bot. Boreali-Occident. Sin. 2004, 25, 413–418. [Google Scholar]
- Sharma, P.; Jha, A.B.; Dubey, R.S.; Pessarakli, M. Reactive oxygen species, oxidative damage, and antioxidative defense mechanism in plants under stressful conditions. J. Bot. 2012, 2012, 1–26. [Google Scholar] [CrossRef] [Scilit]
- Blokhina, O.; Virolainen, E.; Fagerstedt, K.V. Antioxidants, oxidative damage and oxygen deprivation stress: A review. Ann. Bot. 2003, 91, 179–194. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Anjum, N.A.; Umar, S.; Chan, M.T. Ascorbate-Glutathione Pathway and Stress Tolerance in Plants; Springer: Dordrecht, The Netherlands, 2010. [Google Scholar]
- Yang, A.; Cao, S.; Yang, Z.; Cai, Y.; Zheng, Y. γ-Aminobutyric acid treatment reduces chilling injury and activates the defence response of peach fruit. Food Chem. 2011, 129, 1619–1622. [Google Scholar] [CrossRef] [Scilit]
- Li, Z.; Yu, J.; Peng, Y.; Huang, B. Metabolic pathways regulated by γ-aminobutyric acid (GABA) contributing to heat tolerance in creeping bentgrass (Agrostis stolonifera). Sci. Rep. 2016, 6, 30338. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sabehat, A.; Weiss, D.; Lurie, S. Heat-shock proteins and cross-tolerance in plants. Physiol. Plant 1998, 103, 437–441. [Google Scholar] [CrossRef] [Scilit]
- Hanin, M.; Brini, F.; Ebel, C.; Toda, Y.; Takeda, S.; Masmoudi, K. Plant dehydrins and stress tolerance: Versatile proteins for complex mechanisms. Plant Signal. Behav. 2011, 6, 1503–1509. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cho, S.H.; Hoang, Q.T.; Kim, Y.Y.; Shin, H.Y.; Ok, S.H.; Bae, J.M.; Shin, J.S. Proteome analysis of gametophores identified a metallothionein involved in various abiotic stress responses in Physcomitrella patens. Plant Cell Rep. 2006, 25, 475–488. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, W.; Vinocur, B.; Shoseyov, O.; Altman, A. Role of plant heat-shock proteins and molecular chaperones in the abiotic stress response. Trends Plant Sci. 2004, 9, 244–252. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, Y.; Zhan, C.; Huang, B. Heat shock proteins in association with heat tolerance in grasses. Int. J. Proteom. 2011, 2011, 529648. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Murakami, T.; Matsuba, S.; Funatsuki, H.; Kawaguchi, K.; Saruyama, H.; Tanida, M.; Sato, Y. Over-expression of a small heat shock protein, sHSP17.7, confers both heat tolerance and UV-B resistance to rice plants. Mol. Breed. 2004, 13, 165–175. [Google Scholar] [CrossRef] [Scilit]
- Ristic, Z.; Yang, G.; Martin, B.; Fullerton, S. Evidence of association between specific heat-shock protein (s) and the drought and heat tolerance phenotype in maize. J. Plant Physiol. 1998, 153, 497–505. [Google Scholar] [CrossRef] [Scilit]
- Close, T.J. Dehydrins: A commonalty in the response of plants to dehydration and low temperature. Physiol. Plant 1997, 100, 291–296. [Google Scholar] [CrossRef] [Scilit]
- Li, Z.; Jing, W.; Peng, Y.; Zhang, X.Q.; Ma, X.; Huang, L.K.; Yan, Y. Spermine alleviates drought Stress in white clover with different resistance by influencing carbohydrate metabolism and dehydrins synthesis. PLoS ONE 2015, 10, e0120708. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wahid, A.; Close, T. Expression of dehydrins under heat stress and their relationship with water relations of sugarcane leaves. Biol. Plant 2007, 51, 104–109. [Google Scholar] [CrossRef] [Scilit]
- Galani, S.; Wahid, A.; Arshad, M. Tissue-specific expression and functional role of dehydrins in heat tolerance of sugarcane (Saccharum officinarum). Protoplasma 2013, 250, 577–583. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ruttkay-Nedecky, B.; Nejdl, L.; Gumulec, J.; Zitka, O.; Masarik, M.; Eckschlager, T.; Stiborova, M.; Adam, V.; Kizek, R. The role of metallothionein in oxidative stress. Int. J. Mol. Sci. 2013, 14, 6044–6066. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Akashi, K.; Nishimura, N.; Ishida, Y.; Yokota, A. Potent hydroxyl radical-scavenging activity of drought-induced type-2 metallothionein in wild watermelon. Biochem. Biophys. Res. Commun. 2004, 323, 72–78. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, Z.; Wu, Y.; Li, Y.; Ling, H.Q.; Chu, C. OsMT1a, a type 1 metallothionein, plays the pivotal role in zinc homeostasis and drought tolerance in rice. Plant Mol. Biol. 2009, 70, 219–229. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hoagland, C.R.; Arnon, D.I. The water-culture method for growing plants without soil. Calif. Agric. Exp. Circ. 1950, 347, 1–32. [Google Scholar]
- Beard, J.B. Turf Management for Golf Courses, 2nd ed.; Ann Arbor Press: Chelsea, UK, 2001. [Google Scholar]
- Barrs, H.; Weatherley, P. A re-examination of the relative turgidity technique for estimating water deficits in leaves. Aust. J. Biol. Sci. 1962, 15, 413–428. [Google Scholar] [CrossRef] [Scilit]
- Blum, A.; Ebercon, A. Cell membrane stability as a measure of drought and heat tolerance in wheat. Crop Sci. 1981, 21, 43–47. [Google Scholar] [CrossRef] [Scilit]
- Arnon, D. Copper enzymes in isolated chloroplasts. Polyphenoloxidase in Beta vulgaris. Plant Physiol. 1949, 24, 1–13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Elstner, E.F.; Heupel, A. Inhibition of nitrite formation from hydroxylammoniumchloride: A simple assay for superoxide dismutase. Anal. Biochem. 1976, 70, 616–620. [Google Scholar] [CrossRef] [Scilit]
- Velikova, V.; Yordanov, I.; Edreva, A. Oxidative stress and some antioxidant systems in acid rain-treated bean plants: Protective role of exogenous polyamines. Plant Sci. 2000, 151, 59–66. [Google Scholar] [CrossRef] [Scilit]
- Dhindsa, R.S.; Plumb-Dhindsa, P.; Thorpe, T.A. Leaf Senescence: Correlated with increased levels of membrane permeability and lipid peroxidation, and decreased levels of superoxide dismutase and catalase. J. Exp. Bot. 1981, 32, 93–101. [Google Scholar] [CrossRef] [Scilit]
- Xia, X.J.; Wang, Y.J.; Zhou, Y.H.; Tao, Y.; Mao, W.H.; Shi, K.; Asami, T.; Chen, Z.; Yu, J.Q. Reactive oxygen species are involved in brassinosteroid-induced stress tolerance in cucumber. Plant Physiol. 2009, 150, 801–814. [Google Scholar] [CrossRef] [Scilit] [PubMed]









| Target Gene | Accession No. | Forward Primer (5′–3′) | Reverse Primer (5′–3′) |
|---|---|---|---|
| SOD | DV867103 | CACTGGACCTCACTTCAAC | GTAGCAACACCATCCACTC |
| POD | DV867327 | CTTCGACAACGCCTACTAC | TTTGCCCATGTTCACCA |
| CAT | DY543619 | TTGCCAATAAGAGGGAGAATG | CGAAGCCGAGCATGTAAG |
| APX | GR281667 | AGGACATTGTTGCCCTTTC | GCTCCGTGAAGTAAGAGTTG |
| DHAR | DV853556 | GAAAGGTGCCTGTGTTTAATG | GTGATGGAGTTGGGTACTTC |
| GR | AB277097 | GATGGAGGCTACTTGCTTTG | GCTAAGACCCACGACAGATA |
| MDHAR | DV865007 | CCATGAAGCTCTACAACGAG | GTAGAAGTAGGGCAGGTAGT |
| HSP70 | DV860338.1 | CCTGCCCAATTTGCATTACC | CAGACGGAGAAGCAACTGAA |
| HSP90 | GR280041.1 | CCACCCATACTCACCTGTCACG | CAAGGAGAAGTTTGAAGGGCTATG |
| DHN3 | FE527922.1 | CATGGCGTCTACTGCTTGTA | CAGAGGACTTGAACCCAGATAC |
| MT1 | DV865927.1 | TCTCCAAGCTCATCTTCTTCTCATT | TTCGTCCAGGTCAGGGTACATC |
| WRKY75 | DV867719.1 | TGGTGGTGACGACATACGAGG | GGTTGGTAAAGGTTGAGGAGGTG |
| MYB13 | GR279830.1 | CATTCAGTTTACCCGAGTGCG | CATAAAACATGACCCATCACAGCT |
| ABF3 | DV862003.1 | ATCTGCCTGCGGAGGACACT | TGAAGCATCGGAACAGTGGC |
| CDPK26 | GR281936.1 | ATCCAGGCTGCTCACTCCGTA | AACCAACGCAGGGTAGGATTTC |
| MAPK1 | DV866362.1 | AGCTGGCCCTGCATGGATAA | CAGGACAATGTTCAGATGGAGGC |
| 14-3-3 | DV866921.1 | TCATGGACAAGATCAAGGAGAAG | CAAACACCCAAGTGAGCTAAAC |
| ACT2 | DY543529 | CCTTTTCCAGCCATCTTTCA | GAGGTCCTTCCTGATATCCA |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, Z.; Peng, Y.; Huang, B. Alteration of Transcripts of Stress-Protective Genes and Transcriptional Factors by γ-Aminobutyric Acid (GABA) Associated with Improved Heat and Drought Tolerance in Creeping Bentgrass (Agrostis stolonifera). Int. J. Mol. Sci. 2018, 19, 1623. https://doi.org/10.3390/ijms19061623
Li Z, Peng Y, Huang B. Alteration of Transcripts of Stress-Protective Genes and Transcriptional Factors by γ-Aminobutyric Acid (GABA) Associated with Improved Heat and Drought Tolerance in Creeping Bentgrass (Agrostis stolonifera). International Journal of Molecular Sciences. 2018; 19(6):1623. https://doi.org/10.3390/ijms19061623
Chicago/Turabian StyleLi, Zhou, Yan Peng, and Bingru Huang. 2018. "Alteration of Transcripts of Stress-Protective Genes and Transcriptional Factors by γ-Aminobutyric Acid (GABA) Associated with Improved Heat and Drought Tolerance in Creeping Bentgrass (Agrostis stolonifera)" International Journal of Molecular Sciences 19, no. 6: 1623. https://doi.org/10.3390/ijms19061623
APA StyleLi, Z., Peng, Y., & Huang, B. (2018). Alteration of Transcripts of Stress-Protective Genes and Transcriptional Factors by γ-Aminobutyric Acid (GABA) Associated with Improved Heat and Drought Tolerance in Creeping Bentgrass (Agrostis stolonifera). International Journal of Molecular Sciences, 19(6), 1623. https://doi.org/10.3390/ijms19061623
