RNA Trans-Splicing Modulation via Antisense Molecule Interference
Abstract
1. Introduction
2. Results
2.1. Generation of Antisense Molecules for Trans-Splicing Enhancement
2.2. asRNA34 Facilitates RTM-Mediated RNA Editing
2.3. Splice Site-Specific Antisense Oligonucleotides Increase RNA Trans-Splicing Levels
3. Discussion
4. Materials and Methods
4.1. Construction of asRNA Library and Antisense Oligonucleotides
4.2. Screening Constructs
4.3. Cell Culture and Plasmid Transfection
4.4. Flow Cytometric Analysis
4.5. RNA Isolation and cDNA Synthesis
4.6. sqRT-PCR Analysis of Cis- and Trans-Splicing Levels
4.7. Western Blot Analysis
4.8. Statistical Analysis of SqRT-PCR Data
4.9. Analysis of Splicing Enhancer and Silencer
Supplementary Materials
Acknowledgments
Author Contributions
Conflicts of Interest
Abbreviations
| ASO | antisense oligonucleotide |
| asRNA | antisense RNA |
| BD | binding domain |
| EB | epidermolysis bullosa |
| EBS | epidermolysis bullosa simplex |
| DEB | dystrophic epidermolysis bullosa |
| KRT14-scMG | KRT14 screening minigene |
| KRT14-scRTM | KRT14 screening RTM |
| RDEB | recessive dystrophic epidermolysis bullosa |
| RTM | RNA trans-splicing molecule |
| SMaRT | Spliceosome mediated RNA trans-splicing |
References
- Bornert, O.; Peking, P.; Bremer, J.; Koller, U.; van den Akker, P.C.; Aartsma-Rus, A.; Pasmooij, A.M.G.; Murauer, E.M.; Nyström, A. RNA-based therapies for genodermatoses. Exp. Dermatol. 2017, 26, 3–10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Koo, T.; Popplewell, L.; Athanasopoulos, T.; Dickson, G. Triple trans-splicing adeno-associated virus vectors capable of transferring the coding sequence for full-length dystrophin protein into dystrophic mice. Hum. Gene Ther. 2014, 25, 98–108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kole, R.; Krainer, A.R.; Altman, S. RNA therapeutics: Beyond RNA interference and antisense oligonucleotides. Nat. Rev. Drug Discov. 2012, 11, 125–140. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Coady, T.H.; Lorson, C.L. Trans-splicing-mediated improvement in a severe mouse model of spinal muscular atrophy. J. Neurosci. 2010, 30, 126–130. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lorain, S.; Peccate, C.; Le Hir, M.; Garcia, L. Exon Exchange Approach to Repair Duchenne Dystrophin Transcripts. PLoS ONE 2010, 5. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wally, V.; Brunner, M.; Lettner, T.; Wagner, M.; Koller, U.; Trost, A.; Murauer, E.M.; Hainzl, S.; Hintner, H.; Bauer, J.W. K14 mRNA reprogramming for dominant epidermolysis bullosa simplex. Hum. Mol. Genet. 2010, 19, 4715–4725. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peking, P.; Koller, U.; Duarte, B.; Murillas, R.; Wolf, S.; Maetzig, T.; Rothe, M.; Kocher, T.; García, M.; Brachtl, G.; et al. An RNA-targeted therapy for dystrophic epidermolysis bullosa. Nucleic Acids Res. 2017, 45, 10259–10269. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wally, V.; Klausegger, A.; Koller, U.; Lochmüller, H.; Krause, S.; Wiche, G.; Mitchell, L.G.; Hintner, H.; Bauer, J.W. 5′ trans-splicing repair of the PLEC1 gene. J. Investig. Dermatol. 2008, 128, 568–574. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Koller, U.; Wally, V.; Mitchell, L.G.; Klausegger, A.; Murauer, E.M.; Mayr, E.; Gruber, C.; Hainzl, S.; Hintner, H.; Bauer, J.W. A novel screening system improves genetic correction by internal exon replacement. Nucleic Acids Res. 2011, 39, E108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Monjaret, F.; Bourg, N.; Suel, L.; Roudaut, C.; Le Roy, F.; Richard, I.; Charton, K. Cis-splicing and Translation of the Pre-Trans-splicing Molecule Combine With Efficiency in Spliceosome-mediated RNA Trans-splicing. Mol. Ther. 2014, 22, 1176–1187. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Avale, M.E.; Rodríguez-Martín, T.; Gallo, J.-M. Trans-splicing correction of tau isoform imbalance in a mouse model of tau mis-splicing. Hum. Mol. Genet. 2013, 22, 2603–2611. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rindt, H.; Yen, P.-F.; Thebeau, C.N.; Peterson, T.S.; Weisman, G.A.; Lorson, C.L. Replacement of huntingtin exon 1 by trans-splicing. Cell. Mol. Life Sci. 2012, 69. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Haugen, P.; Simon, D.M.; Bhattacharya, M. The natural history of group I introns. Trends Genet. 2005, 21, 111–119. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Olson, K.E.; Müller, U.F. An in vivo selection method to optimize trans-splicing ribozymes. RNA 2012, 18, 581–589. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lan, N.; Howrey, R.P.; Lee, S.W.; Smith, C.A.; Sullenger, B.A. Ribozyme-mediated repair of sickle β-globin mRNAs in erythrocyte precursors. Science 1998, 280, 1593–1596. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kwon, B.-S.; Jung, H.-S.; Song, M.-S.; Cho, K.S.; Kim, S.-C.; Kimm, K.; Jeong, J.S.; Kim, I.-H.; Lee, S.-W. Specific regression of human cancer cells by ribozyme-mediated targeted replacement of tumor-specific transcript. Mol. Ther. J. Am. Soc. Gene Ther. 2005, 12, 824–834. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, Y.-H.; Kim, K.T.; Lee, S.-J.; Hong, S.-H.; Moon, J.Y.; Yoon, E.K.; Kim, S.; Kim, E.O.; Kang, S.H.; Kim, S.K.; et al. Image-aided Suicide Gene Therapy Utilizing Multifunctional hTERT-targeting Adenovirus for Clinical Translation in Hepatocellular Carcinoma. Theranostics 2016, 6, 357–368. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Koller, U.; Wally, V.; Bauer, J.W.; Murauer, E.M. Considerations for a Successful RNA Trans-splicing Repair of Genetic Disorders. Mol. Ther. Nucleic Acids 2014, 3, E157. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hüttner, C.; Murauer, E.M.; Hainzl, S.; Kocher, T.; Neumayer, A.; Reichelt, J.; Bauer, J.W.; Koller, U. Designing Efficient Double RNA trans-Splicing Molecules for Targeted RNA Repair. Int. J. Mol. Sci. 2016, 17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fine, J.-D.; Bruckner-Tuderman, L.; Eady, R.A.J.; Bauer, E.A.; Bauer, J.W.; Has, C.; Heagerty, A.; Hintner, H.; Hovnanian, A.; Jonkman, M.F.; et al. Inherited epidermolysis bullosa: Updated recommendations on diagnosis and classification. J. Am. Acad. Dermatol. 2014, 70, 1103–1126. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bauer, J.W.; Murauer, E.M.; Wally, V.; Koller, U. RNA trans-splicing for genodermatoses. Methods Mol. Biol. 2013, 961, 441–455. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Murauer, E.M.; Koller, U.; Hainzl, S.; Wally, V.; Bauer, J.W. A reporter-based screen to identify potent 3’ trans-splicing molecules for endogenous RNA repair. Hum. Gene Ther. Methods 2013, 24, 19–27. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peking, P.; Koller, U.; Hainzl, S.; Kitzmueller, S.; Kocher, T.; Mayr, E.; Nyström, A.; Lener, T.; Reichelt, J.; Bauer, J.W.; et al. A Gene Gun-mediated Nonviral RNA trans-splicing Strategy for COL7A1 Repair. Mol. Ther. Nucleic Acids 2016, 5, E287. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tockner, B.; Kocher, T.; Hainzl, S.; Reichelt, J.; Bauer, J.W.; Koller, U.; Murauer, E.M. Construction and validation of an RNA trans-splicing molecule suitable to repair a large number of COL7A1 mutations. Gene Ther. 2016, 23, 775–784. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Remington, J.; Wang, X.; Hou, Y.; Zhou, H.; Burnett, J.; Muirhead, T.; Uitto, J.; Keene, D.R.; Woodley, D.T.; Chen, M. Injection of recombinant human type VII collagen corrects the disease phenotype in a murine model of dystrophic epidermolysis bullosa. Mol. Ther. J. Am. Soc. Gene Ther. 2009, 17, 26–33. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cheng, J.; Syder, A.J.; Yu, Q.C.; Letai, A.; Paller, A.S.; Fuchs, E. The genetic basis of epidermolytic hyperkeratosis: A disorder of differentiation-specific epidermal keratin genes. Cell 1992, 70, 811–819. [Google Scholar] [CrossRef] [Scilit]
- Chipev, C.C.; Korge, B.P.; Markova, N.; Bale, S.J.; DiGiovanna, J.J.; Compton, J.G.; Steinert, P.M. A leucine—Proline mutation in the H1 subdomain of keratin 1 causes epidermolytic hyperkeratosis. Cell 1992, 70, 821–828. [Google Scholar] [CrossRef] [Scilit]
- Koller, U.; Hainzl, S.; Kocher, T.; Hüttner, C.; Klausegger, A.; Gruber, C.; Mayr, E.; Wally, V.; Bauer, J.W.; Murauer, E.M. Trans-Splicing Improvement by the Combined Application of Antisense Strategies. Int. J. Mol. Sci. 2015, 16, 1179–1191. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Turczynski, S.; Titeux, M.; Pironon, N.; Hovnanian, A. Antisense-mediated exon skipping to reframe transcripts. Methods Mol. Biol. 2012, 867, 221–238. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Goto, M.; Sawamura, D.; Nishie, W.; Sakai, K.; McMillan, J.R.; Akiyama, M.; Shimizu, H. Targeted skipping of a single exon harboring a premature termination codon mutation: Implications and potential for gene correction therapy for selective dystrophic epidermolysis bullosa patients. J. Investig. Dermatol. 2006, 126, 2614–2620. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, W.; Lu, Z.; Li, F.; Wang, W.; Qian, N.; Duan, J.; Zhang, Y.; Wang, F.; Chen, T. Efficient in vivo gene editing using ribonucleoproteins in skin stem cells of recessive dystrophic epidermolysis bullosa mouse model. Proc. Natl. Acad. Sci. USA 2017, 114, 1660–1665. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Coady, T.H.; Baughan, T.D.; Shababi, M.; Passini, M.A.; Lorson, C.L. Development of a single vector system that enhances trans-splicing of SMN2 transcripts. PLoS ONE 2008, 3, E3468. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fine, J.-D. Inherited epidermolysis bullosa. Orphanet J. Rare Dis. 2010, 5, 12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kocher, T.; Peking, P.; Klausegger, A.; Murauer, E.M.; Hofbauer, J.P.; Wally, V.; Lettner, T.; Hainzl, S.; Ablinger, M.; Bauer, J.W.; et al. Cut and Paste: Efficient Homology-Directed Repair of a Dominant Negative KRT14 Mutation via CRISPR/Cas9 Nickases. Mol. Ther. J. Am. Soc. Gene Ther. 2017, 25, 2585–2598. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gruber, C.; Gratz, I.K.; Murauer, E.M.; Mayr, E.; Koller, U.; Bruckner-Tuderman, L.; Meneguzzi, G.; Hintner, H.; Bauer, J.W. Spliceosome-mediated RNA trans-splicing facilitates targeted delivery of suicide genes to cancer cells. Mol. Cancer Ther. 2011, 10, 233–241. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gruber, C.; Koller, U.; Murauer, E.M.; Hainzl, S.; Hüttner, C.; Kocher, T.; South, A.P.; Hintner, H.; Bauer, J.W. The design and optimization of RNA trans-splicing molecules for skin cancer therapy. Mol. Oncol. 2013, 7, 1056–1068. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cao, T.; Longley, M.A.; Wang, X.-J.; Roop, D.R. An Inducible Mouse Model for Epidermolysis Bullosa Simplex. J. Cell Biol. 2001, 152, 651–656. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Desmet, F.-O.; Hamroun, D.; Lalande, M.; Collod-Béroud, G.; Claustres, M.; Béroud, C. Human Splicing Finder: An online bioinformatics tool to predict splicing signals. Nucleic Acids Res. 2009, 37, E67. [Google Scholar] [CrossRef] [Scilit] [PubMed]







| Length (nt) | KRT14 Binding Position (nt) | Length (nt) | KRT14 Binding Position (nt) | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| from | to | from | to | ||||||||
| asRNA1 | 42 | 477 | In6 | 518 | In6 | asRNA68 | 174 | 9 | Ex5 | 182 | In5 |
| asRNA2 | 110 | 246 | Ex6 | 355 | Ex6 | asRNA69 | 20 | 13 | Ex5 | 32 | Ex5 |
| asRNA3 | 117 | 235 | Ex6 | 351 | Ex6 | asRNA70 | 20 | 13 | Ex5 | 32 | Ex5 |
| asRNA4 | 148 | 183 | In5 | 330 | Ex6 | asRNA71 | 380 | 1 | Ex5 | 380 | Ex6 |
| asRNA5 | 150 | 409 | Ex6 | 558 | Ex7 | asRNA72 | 193 | 1 | Ex5 | 193 | In5 |
| asRNA7 | 155 | 529 | In6 | 683 | In7 | asRNA73_1 | 74 | 563 | Ex7 | 636 | In7 |
| asRNA8 | 163 | 12 | Ex5 | 174 | In5 | asRNA73_2 | 21 | 1122 | In7 | 1142 | In7 |
| asRNA13 | 192 | 216 | In5 | 407 | Ex6 | asRNA76_1 | 27 | 693 | In7 | 719 | In7 |
| asRNA14 | 203 | 324 | Ex6 | 526 | In6 | asRNA76_2 | 246 | 1 | Ex5 | 246 | Ex6 |
| asRNA15 | 220 | 464 | In6 | 683 | In7 | asRNA78 | 118 | 327 | Ex6 | 444 | In6 |
| asRNA16 | 225 | 264 | Ex6 | 488 | In6 | asRNA81 | 217 | 1 | Ex5 | 217 | In5 |
| asRNA17 | 228 | 275 | Ex6 | 502 | In6 | asRNA83 | 592 | 1 | Ex5 | 592 | In7 |
| asRNA18 | 228 | 275 | Ex6 | 502 | In6 | asRNA84 | 230 | 1 | Ex5 | 230 | Ex6 |
| asRNA19 | 228 | 254 | Ex6 | 481 | In6 | asRNA86 | 308 | 292 | Ex6 | 599 | In7 |
| asRNA20 | 245 | 6 | Ex5 | 250 | Ex6 | asRNA87 | 287 | 1 | Ex5 | 287 | Ex6 |
| asRNA21 | 230 | 452 | In6 | 681 | In7 | asRNA92_1 | 119 | 1 | Ex5 | 119 | Ex5 |
| asRNA22 | 255 | 429 | Ex6 | 683 | In7 | asRNA92_2 | 178 | 1 | Ex5 | 178 | In5 |
| asRNA23 | 243 | 18 | Ex5 | 260 | Ex6 | asRNA94 | 96 | 1 | Ex5 | 96 | Ex5 |
| asRNA24 | 289 | 395 | Ex6 | 683 | In7 | asRNA97 | 95 | 541 | Ex7 | 635 | In7 |
| asRNA25 | 288 | 394 | Ex6 | 681 | In7 | asRNA99 | 119 | 1 | Ex5 | 119 | Ex5 |
| asRNA26 | 291 | 392 | Ex6 | 682 | In7 | asRNA100 | 127 | 401 | Ex6 | 527 | In6 |
| asRNA29 | 366 | 318 | Ex6 | 683 | In7 | asRNA101 | 195 | 2 | Ex5 | 196 | In5 |
| asRNA30 | 377 | 8 | Ex5 | 384 | Ex6 | asRNA105 | 251 | 1 | Ex5 | 251 | Ex6 |
| asRNA31 | 379 | 1 | Ex5 | 379 | Ex6 | asRNA109 | 435 | 1 | Ex5 | 435 | Ex6 |
| asRNA32 | 406 | 316 | Ex6 | 721 | In7 | asRNA111 | 164 | 766 | In7 | 929 | In7 |
| asRNA33 | 386 | 1 | Ex5 | 386 | Ex6 | asRNA113 | 192 | 1 | Ex5 | 192 | In5 |
| asRNA34 | 324 | 1 | Ex5 | 324 | Ex6 | asRNA115 | 506 | 1 | Ex5 | 506 | In6 |
| asRNA35 | 414 | 1 | Ex5 | 414 | Ex6 | asRNA116 | 362 | 1 | Ex5 | 362 | Ex6 |
| asRNA39 | 303 | 1 | Ex5 | 303 | Ex6 | asRNA119 | 19 | 15 | Ex5 | 33 | Ex5 |
| asRNA47 | 235 | 1 | Ex5 | 235 | Ex6 | asRNA120 | 44 | 492 | In6 | 535 | In6 |
| asRNA48 | 168 | 46 | Ex5 | 213 | In5 | asRNA124 | 85 | 167 | In5 | 251 | Ex6 |
| asRNA53 | 382 | 1 | Ex5 | 382 | Ex6 | asRNA125 | 272 | 1 | Ex5 | 272 | Ex6 |
| asRNA59 | 287 | 244 | Ex6 | 530 | In6 | asRNA130 | 330 | 8 | Ex6 | 337 | Ex6 |
| asRNA60 | 620 | 1 | Ex5 | 620 | In7 | asRNA131 | 132 | 700 | In7 | 831 | In7 |
| asRNA62 | 287 | 244 | Ex6 | 530 | In6 | asRNA133 | 68 | 96 | Ex5 | 163 | In5 |
| asRNA64 | 346 | 242 | Ex6 | 587 | In7 | asRNA134 | 150 | 401 | Ex6 | 550 | Ex7 |
| asRNA66 | 519 | 266 | Ex6 | 784 | In7 | asRNA135 | 368 | 1 | Ex5 | 368 | Ex6 |
| Trans-Splicing | p-Value | Significance |
|---|---|---|
| 1 µg asRNA34 vs. 2 µg asRNA34 | 0.0492 | * |
| 1 µg asRNA34 vs. 3 µg asRNA34 | 0.0229 | * |
| 2 µg asRNA34 vs. 3 µg asRNA34 | 0.0244 | * |
| 1 µg scRTM vs. 2 µg scRTM | 0.0419 | * |
| 1 µg scRTM vs. 3 µg scRTM | 0.0021 | * |
| 2 µg scRTM vs. 3 µg scRTM | 0.0325 | * |
| Cis-Splicing | p-Value | Significance |
|---|---|---|
| cis-splicing exon 5/6-6/7 | ||
| 1 µg asRNA34 vs. 2 µg asRNA34 | 0.0095 | ** |
| 1 µg asRNA34 vs. 3 µg asRNA34 | 0.003 | ** |
| 2 µg asRNA34 vs. 3 µg asRNA34 | 0.0056 | ** |
| 1 µg scRTM vs. 2 µg scRTM | 0.6587 | ns |
| 1 µg scRTM vs. 3 µg scRTM | 0.0291 | * |
| 2 µg scRTM vs. 3 µg scRTM | 0.0155 | * |
| cis-splicing exon 6/7-GFP | ||
| 1 µg asRNA34 vs. 2 µg asRNA34 | 0.0459 | * |
| 1 µg asRNA34 vs. 3 µg asRNA34 | 0.0247 | * |
| 2 µg asRNA34 vs. 3 µg asRNA34 | 0.0401 | * |
| 1 µg scRTM vs. 2 µg scRTM | 0.8726 | ns |
| 1 µg scRTM vs. 3 µg scRTM | 0.0175 | * |
| 2 µg scRTM vs. 3 µg scRTM | 0.0018 | ** |
| ASO | Sequence | nt |
|---|---|---|
| ASO1 | GCCAAGACTCACTGGGCGTC | 20 |
| ASO2 | GGAGGGCCAAGACTCACTGG | 20 |
| ASO3 | CTCACTGGGCGTCCTCGCCC | 20 |
| ASO4 | GCTGCATGCAGTAGCGACCTTTGG | 24 |
| ASO5 | TCTCCTGCTCCAGCCGCGTC | 20 |
| ASO6 | GAGGGTCTTACCATCTCTGG | 20 |
| ASO7 | CTGCAGAGGAGGAGGGTCTTACC | 23 |
| ASO8 | CATCTCTGGATGACTGCGAT | 20 |
| ASO9 | CCAGAGGAGAACTGGGAGGAGG | 22 |
| scrASO2 | TGTGGCGAGTAGACTCGAAG | 20 |
| Trans- and Cis-Splicing | p-Value | Significance |
|---|---|---|
| trans-splicing | ||
| scrASO vs. ASO7 | <0.0001 | *** |
| scrASO vs. ASO9 | <0.0001 | *** |
| cis-splicing exon 5/6-6/7 | ||
| scrASO vs. ASO7 | 0.0011 | ** |
| scrASO vs. ASO9 | 0.0011 | ** |
| cis-splicing exon 6/7-GFP | ||
| scrASO vs. ASO7 | 0.0023 | ** |
| scrASO vs. ASO9 | 0.2506 | ns |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liemberger, B.; Piñón Hofbauer, J.; Wally, V.; Arzt, C.; Hainzl, S.; Kocher, T.; Murauer, E.M.; Bauer, J.W.; Reichelt, J.; Koller, U. RNA Trans-Splicing Modulation via Antisense Molecule Interference. Int. J. Mol. Sci. 2018, 19, 762. https://doi.org/10.3390/ijms19030762
Liemberger B, Piñón Hofbauer J, Wally V, Arzt C, Hainzl S, Kocher T, Murauer EM, Bauer JW, Reichelt J, Koller U. RNA Trans-Splicing Modulation via Antisense Molecule Interference. International Journal of Molecular Sciences. 2018; 19(3):762. https://doi.org/10.3390/ijms19030762
Chicago/Turabian StyleLiemberger, Bernadette, Josefina Piñón Hofbauer, Verena Wally, Claudia Arzt, Stefan Hainzl, Thomas Kocher, Eva M. Murauer, Johann W. Bauer, Julia Reichelt, and Ulrich Koller. 2018. "RNA Trans-Splicing Modulation via Antisense Molecule Interference" International Journal of Molecular Sciences 19, no. 3: 762. https://doi.org/10.3390/ijms19030762
APA StyleLiemberger, B., Piñón Hofbauer, J., Wally, V., Arzt, C., Hainzl, S., Kocher, T., Murauer, E. M., Bauer, J. W., Reichelt, J., & Koller, U. (2018). RNA Trans-Splicing Modulation via Antisense Molecule Interference. International Journal of Molecular Sciences, 19(3), 762. https://doi.org/10.3390/ijms19030762

