The Effects of Selective Hematopoietic Expression of Human IL-37 on Systemic Inflammation and Atherosclerosis in LDLr-Deficient Mice
Abstract
:1. Introduction
2. Results
2.1. Hematopoietic IL-37 Expression Does Not Affect Metabolic Parameters
2.2. Hematopoietic IL-37 Expression Moderately Reduces the Inflammatory State
2.3. Hematopoietic IL-37 Expression Does Not Affect Atherosclerosis Development
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. Assessment of Successful Bone Marrow Reconstitution
4.3. Plasma Lipid and Systemic Inflammation Analysis
4.4. Flow Cytometry
4.5. Ex Vivo Stimulation of Peritoneal Macrophages
4.6. Gene Expression Analysis
4.7. Atherosclerosis Development
4.8. Statistical Analysis
5. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
Abbreviations
BMT | Bone marrow transplantation |
IL | Interleukin |
KC | Keratinocyte chemoattractant |
LDL(r) | Low-density lipoprotein (receptor) |
LPS | Lipopolysaccharide |
sE-selectin | Soluble E-selectin |
Tg | Transgenic |
WT | Wild-type |
WTD | Western-type diet |
References
- Ait-Oufella, H.; Taleb, S.; Mallat, Z.; Tedgui, A. Recent advances on the role of cytokines in atherosclerosis. Arterioscler. Thromb. Vasc. Biol. 2011, 31, 969–979. [Google Scholar] [CrossRef] [PubMed]
- Leitinger, N.; Schulman, I.G. Phenotypic polarization of macrophages in atherosclerosis. Arterioscler. Thromb. Vasc. Biol. 2013, 33, 1120–1126. [Google Scholar] [CrossRef] [PubMed]
- Cuneo, A.A.; Autieri, M.V. Expression and function of anti-inflammatory interleukins: The other side of the vascular response to injury. Curr. Vasc. Pharmacol. 2009, 7, 267–276. [Google Scholar] [CrossRef] [PubMed]
- Mallat, Z.; Besnard, S.; Duriez, M.; Deleuze, V.; Emmanuel, F.; Bureau, M.F.; Soubrier, F.; Esposito, B.; Duez, H.; Fievet, C.; et al. Protective role of interleukin-10 in atherosclerosis. Circ. Res. 1999, 85, e17–e24. [Google Scholar] [CrossRef] [PubMed]
- Lutgens, E.; Gijbels, M.; Smook, M.; Heeringa, P.; Gotwals, P.; Koteliansky, V.E.; Daemen, M.J. Transforming growth factor-β mediates balance between inflammation and fibrosis during plaque progression. Arterioscler. Thromb. Vasc. Biol. 2002, 22, 975–982. [Google Scholar] [CrossRef] [PubMed]
- Miller, A.M.; Xu, D.; Asquith, D.L.; Denby, L.; Li, Y.; Sattar, N.; Baker, A.H.; McInnes, I.B.; Liew, F.Y. IL-33 reduces the development of atherosclerosis. J. Exp. Med. 2008, 205, 339–346. [Google Scholar] [CrossRef] [PubMed]
- Elhage, R.; Maret, A.; Pieraggi, M.T.; Thiers, J.C.; Arnal, J.F.; Bayard, F. Differential effects of interleukin-1 receptor antagonist and tumor necrosis factor binding protein on fatty-streak formation in apolipoprotein E-deficient mice. Circulation 1998, 97, 242–244. [Google Scholar] [CrossRef] [PubMed]
- Nold, M.F.; Nold-Petry, C.A.; Zepp, J.A.; Palmer, B.E.; Bufler, P.; Dinarello, C.A. IL-37 is a fundamental inhibitor of innate immunity. Nat. Immunol. 2010, 11, 1014–1022. [Google Scholar] [CrossRef] [PubMed]
- Boraschi, D.; Lucchesi, D.; Hainzl, S.; Leitner, M.; Maier, E.; Mangelberger, D.; Oostingh, G.J.; Pfaller, T.; Pixner, C.; Posselt, G.; et al. IL-37: A new anti-inflammatory cytokine of the IL-1 family. Eur. Cytokine Netw. 2011, 22, 127–147. [Google Scholar] [PubMed]
- Yang, T.; Lin, Q.; Zhao, M.; Hu, Y.; Yu, Y.; Jin, J.; Zhou, H.; Hu, X.; Wei, R.; Zhang, X.; et al. IL-37 is a novel proangiogenic factor of developmental and pathological angiogenesis. Arterioscler. Thromb. Vasc. Biol. 2015, 35, 2638–2646. [Google Scholar] [CrossRef] [PubMed]
- Ballak, D.B.; van Diepen, J.A.; Moschen, A.R.; Jansen, H.J.; Hijmans, A.; Groenhof, G.J.; Leenders, F.; Bufler, P.; Boekschoten, M.V.; Muller, M.; et al. IL-37 protects against obesity-induced inflammation and insulin resistance. Nat. Commun. 2014, 5, 4711. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Imaeda, H.; Takahashi, K.; Fujimoto, T.; Kasumi, E.; Ban, H.; Bamba, S.; Sonoda, H.; Shimizu, T.; Fujiyama, Y.; Andoh, A. Epithelial expression of interleukin-37b in inflammatory bowel disease. Clin. Exp. Immunol. 2013, 172, 410–416. [Google Scholar] [CrossRef] [PubMed]
- Bufler, P.; Gamboni-Robertson, F.; Azam, T.; Kim, S.H.; Dinarello, C.A. Interleukin-1 homologues IL-1F7b and IL-18 contain functional mRNA instability elements within the coding region responsive to lipopolysaccharide. Biochem. J. 2004, 381, 503–510. [Google Scholar] [CrossRef] [PubMed]
- Sharma, S.; Kulk, N.; Nold, M.F.; Graf, R.; Kim, S.H.; Reinhardt, D.; Dinarello, C.A.; Bufler, P. The IL-1 family member 7b translocates to the nucleus and down-regulates proinflammatory cytokines. J. Immunol. 2008, 180, 5477–5482. [Google Scholar] [CrossRef] [PubMed]
- Bulau, A.M.; Fink, M.; Maucksch, C.; Kappler, R.; Mayr, D.; Wagner, K.; Bufler, P. In vivo expression of interleukin-37 reduces local and systemic inflammation in concanavalin A-induced hepatitis. Sci. World J. 2011, 11, 2480–2490. [Google Scholar] [CrossRef] [PubMed]
- McNamee, E.N.; Masterson, J.C.; Jedlicka, P.; McManus, M.; Grenz, A.; Collins, C.B.; Nold, M.F.; Nold-Petry, C.; Bufler, P.; Dinarello, C.A.; et al. Interleukin 37 expression protects mice from colitis. Proc. Natl. Acad. Sci. USA 2011, 108, 16711–16716. [Google Scholar] [CrossRef] [PubMed]
- Ji, Q.; Meng, K.; Yu, K.; Huang, S.; Huang, Y.; Min, X.; Zhong, Y.; Wu, B.; Liu, Y.; Nie, S.; et al. Exogenous interleukin 37 ameliorates atherosclerosis via inducing the Treg response in ApoE-deficient mice. Sci. Rep. 2017, 7, 3310. [Google Scholar] [CrossRef] [PubMed]
- Patel, U.; Rajasingh, S.; Samanta, S.; Cao, T.; Dawn, B.; Rajasingh, J. Macrophage polarization in response to epigenetic modifiers during infection and inflammation. Drug Discov. Today 2017, 22, 186–193. [Google Scholar] [CrossRef] [PubMed]
- Ammirati, E.; Moroni, F.; Magnoni, M.; Camici, P.G. The role of T and B cells in human atherosclerosis and atherothrombosis. Clin. Exp. Immunol. 2015, 179, 173–187. [Google Scholar] [CrossRef] [PubMed]
- Shi, C.; Pamer, E.G. Monocyte recruitment during infection and inflammation. Nat. Rev. Immunol. 2011, 11, 762–774. [Google Scholar] [CrossRef] [PubMed]
- Weber, C.; Zernecke, A.; Libby, P. The multifaceted contributions of leukocyte subsets to atherosclerosis: Lessons from mouse models. Nat. Rev. Immunol. 2008, 8, 802–815. [Google Scholar] [CrossRef] [PubMed]
- Moretti, S.; Bozza, S.; Oikonomou, V.; Renga, G.; Casagrande, A.; Iannitti, R.G.; Puccetti, M.; Garlanda, C.; Kim, S.; Li, S.; et al. IL-37 inhibits inflammasome activation and disease severity in murine aspergillosis. PLoS Pathog. 2014, 10, e1004462. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cavalli, G.; Koenders, M.; Kalabokis, V.; Kim, J.; Tan, A.C.; Garlanda, C.; Mantovani, A.; Dagna, L.; Joosten, L.A.; Dinarello, C.A. Treating experimental arthritis with the innate immune inhibitor interleukin-37 reduces joint and systemic inflammation. Rheumatology 2016, 55, 2220–2229. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.Q.; Dong, K.; Zhou, L.; Jiao, G.H.; Zhu, C.Z.; Li, W.W.; Yu, G.; Wu, W.T.; Chen, S.; Sun, Z.N.; et al. IL-37b gene transfer enhances the therapeutic efficacy of mesenchumal stromal cells in DSS-induced colitis mice. Acta. Pharmacol. Sin. 2015, 36, 1377–1387. [Google Scholar] [CrossRef] [PubMed]
- Chai, M.; Ji, Q.; Zhang, H.; Zhou, Y.; Yang, Q.; Zhou, Y.; Guo, G.; Liu, W.; Han, W.; Yang, L.; et al. The protective effect of interleukin-37 on vascular calcification and atherosclerosis in apolipoprotein E-deficient mice with diabetes. J. Interferon Cytokine Res. 2015, 35, 530–539. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Zhai, Y.; Ao, L.; Hui, H.; Fullerton, D.A.; Dinarello, C.A.; Meng, X. Interleukin-37 suppresses the inflammatory response to protect cardiac function in old endotoxemic mice. Cytokine 2017, 95, 55–63. [Google Scholar] [CrossRef] [PubMed]
- Wu, B.; Meng, K.; Ji, Q.; Cheng, M.; Yu, K.; Zhao, X.; Tony, H.; Liu, Y.; Zhou, Y.; Chang, C.; et al. Interleukin-37 ameliorates myocardial ischaemia/reperfusion injury in mice. Clin. Exp. Immunol. 2014, 176, 438–451. [Google Scholar] [CrossRef] [PubMed]
- Dinarello, C.A.; Nold-Petry, C.; Nold, M.; Fujita, M.; Li, S.; Kim, S.; Bufler, P. Suppression of innate inflammation and immunity by interleukin-37. Eur. J. Immunol. 2016, 46, 1067–1081. [Google Scholar] [CrossRef] [PubMed]
- Zeng, Q.; Song, R.; Fullerton, D.A.; Ao, L.; Zhai, Y.; Li, S.; Ballak, D.B.; Cleveland, J.C., Jr.; Reece, T.B.; McKinsey, T.A.; et al. Interleukin-37 suppresses the osteogenic responses of human aortic valve interstitial cells in vitro and alleviates valve lesions in mice. Proc. Natl. Acad. Sci. USA 2017, 114, 1631–1636. [Google Scholar] [CrossRef] [PubMed]
- Hirschfeld, M.; Ma, Y.; Weis, J.H.; Vogel, S.N.; Weis, J.J. Cutting edge: Repurification of lipopolysaccharide eliminates signaling through both human and murine toll-like receptor 2. J. Immunol. 2000, 165, 618–622. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward Primer | Reverse Primer |
---|---|---|
Ccr7 | ATGGACCCAGGGAAACCCAGGAA | CAGTATCACCAGCCCGTTGCCG |
Cd163 | CTCAGGAAACCAATCCCAGA | CAAGAGCCCTCGTGGTAGAC |
β2-microglobulin | TGACCGGCTTGTATGCTATC | CAGTGTGAGCCAGGATATAG |
Mcp1 | GCATCTGCCCTAAGGTCTTCA | TTCACTGTCACACTGGTCACTCCTA |
Mrc1 | GAGAGCCAAGCCATGAGA | GTCTGCACCCTCCGGTAC |
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hoeke, G.; Khedoe, P.P.S.J.; Van Diepen, J.A.; Pike-Overzet, K.; Van de Ven, B.; Vazirpanah, N.; Mol, I.; Hiemstra, P.S.; Staal, F.J.T.; Stienstra, R.; et al. The Effects of Selective Hematopoietic Expression of Human IL-37 on Systemic Inflammation and Atherosclerosis in LDLr-Deficient Mice. Int. J. Mol. Sci. 2017, 18, 1672. https://doi.org/10.3390/ijms18081672
Hoeke G, Khedoe PPSJ, Van Diepen JA, Pike-Overzet K, Van de Ven B, Vazirpanah N, Mol I, Hiemstra PS, Staal FJT, Stienstra R, et al. The Effects of Selective Hematopoietic Expression of Human IL-37 on Systemic Inflammation and Atherosclerosis in LDLr-Deficient Mice. International Journal of Molecular Sciences. 2017; 18(8):1672. https://doi.org/10.3390/ijms18081672
Chicago/Turabian StyleHoeke, Geerte, P. Padmini S.J. Khedoe, Janna A. Van Diepen, Karin Pike-Overzet, Britt Van de Ven, Nadia Vazirpanah, Isabel Mol, Pieter S. Hiemstra, Frank J.T. Staal, Rinke Stienstra, and et al. 2017. "The Effects of Selective Hematopoietic Expression of Human IL-37 on Systemic Inflammation and Atherosclerosis in LDLr-Deficient Mice" International Journal of Molecular Sciences 18, no. 8: 1672. https://doi.org/10.3390/ijms18081672
APA StyleHoeke, G., Khedoe, P. P. S. J., Van Diepen, J. A., Pike-Overzet, K., Van de Ven, B., Vazirpanah, N., Mol, I., Hiemstra, P. S., Staal, F. J. T., Stienstra, R., Netea, M. G., Dinarello, C. A., Rensen, P. C. N., & Berbée, J. F. P. (2017). The Effects of Selective Hematopoietic Expression of Human IL-37 on Systemic Inflammation and Atherosclerosis in LDLr-Deficient Mice. International Journal of Molecular Sciences, 18(8), 1672. https://doi.org/10.3390/ijms18081672