A Novel Human TGF-β1 Fusion Protein in Combination with rhBMP-2 Increases Chondro-Osteogenic Differentiation of Bone Marrow Mesenchymal Stem Cells
Abstract
:1. Introduction
2. Results and Discussion
2.1. Morphology and Cell Number in 3D (Three-Dimensional) Collagen Culture
2.2. Flow Cytometry Analysis of Cells
2.3. Quantitative Real Time RT-PCR (RT-qPCR) Analysis
2.4. Biochemical Assays
Time (Days) | Treatment | Calcium (mg/dL) |
---|---|---|
10 | Control | 0.41 ± 0.26 |
TGF-β1-F2 | 0.62 ± 0.37 | |
14 | Control | 0.47 ± 0.16 |
TGF-β1-F2 | 0.71 ± 0.23 | |
16 | Control | 0.50 ± 0.16 |
TGF-β1-F2 | 1.74 ± 0.25 ** | |
TGF-β1-F2 + BMP-2 | 2.47 ± 0.21 *** |
2.5. In Vivo Implantation and Histological Study
2.6. Discussion
3. Experimental Section
3.1. Recombinant Human TGF (Transforming Growth Factor)-β1 Fusion Protein
3.2. Isolation of Primary MSCs (Marrow Stromal Cells) and 3D Culture
3.3. Flow Cytometry Analysis of Cells
3.4. RT-qPCR Analysis
Gene Name | Accession Number | Primer Sequence 5'-3' (Forward, Reverse) Reference | Theoric/Used Annealing Temperature (°C) | Product Size (bp) |
---|---|---|---|---|
Nanog | NM_001100781 | GCCCTGAGAAGAAAGAAGAGAA TACCTTTGCCTCTGAAACCT | 59.3/60.0 | 112 |
Oct4 (Pou5f1) | NM_001009178 | CCCATTTCACCACACTCTACTC GACAGGAACAGAGGGAAAGG Han et al. 2012 [66] | 60.9/60.0 | 68 |
Sox2 | NM_001109181 | ATTACCCGCAGCAAAATGAC GCGTTAATTTGGATGGGATTGG Han et al. 2012 [66] | 59.0/60.0 | 60 |
Bsp (Ibsp) | NM_012587 | ATGAAGGAAAGCGACGAGGA GTGGAGTTGGTGCTGGTG | 60.9/60.0 | 113 |
Osx (Sp7) | NM_001037632 | CTTTCCCCACTCATTTCCTG CTAGGCAGGCAGTCAGAAG Takahashi et al. 2008 [67] | 61.1/60.0 | 90 |
Oc (Bglap) | NM_013414 | ACCCTCTCTCTGCTCACTC CTTACTGCCCTCCTGCTT Zhou et al. 2010 [68] | 61.8/60.0 | 124 |
Gapdh | NM_017008 | CATGCCGCCTGGAGAAAC CCCAGGATGCCCTTTAGT Han et al. 2012 [66] | 60.9/60.0 | 88 |
3.5. Biochemical Assays
3.6. In Vivo Implantation and Histological Study
3.7. Statistics
4. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Bianco, P.; Cao, X.; Frenette, P.S.; Mao, J.J.; Robey, P.G.; Simmons, P.J.; Wang, C.Y. The meaning, the sense and the significance: Translating the science of mesenchymal stem cells into medicine. Nat. Med. 2013, 19, 35–42. [Google Scholar]
- Prockop, D.J. Marrow stromal cells as stem cells for nonhematopoietic tissues. Science 1997, 276, 71–74. [Google Scholar]
- Okano, T.; Dezawa, M. A new age of regenerative medicine: Fusion of tissue engineering and stem cell research. Anat. Rec. (Hoboken) 2014, 297, 4–5. [Google Scholar] [CrossRef]
- Jiang, Y.; Jahagirdar, B.N.; Reinhardt, R.L.; Schwartz, R.E.; Keene, C.D.; Ortiz-Gonzalez, X.R.; Reyes, M.; Lenvik, T.; Lund, T.; Blackstad, M.; et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature 2002, 418, 41–49. [Google Scholar] [CrossRef]
- Hemmrich, K.; von Heimburg, D.; Cierpka, K.; Haydarlioglu, S.; Pallua, N. Optimization of the differentiation of human preadipocytes in vitro. Differentiation 2005, 73, 28–35. [Google Scholar] [CrossRef]
- Isern, J.; Méndez-Ferrer, S. Stem cell interactions in a bone marrow niche. Curr. Osteoporos. Rep. 2011, 9, 210–218. [Google Scholar] [CrossRef]
- Silva, W.A., Jr.; Covas, D.T.; Panepucci, R.A.; Proto-Siqueira, R.; Siufi, J.L.C.; Zanette, D.L.; Santos, A.R.D.; Zago, M.A. The profile of gene expression of human marrow mesenchymal stem cells. Stem Cells 2003, 21, 661–669. [Google Scholar] [CrossRef]
- Das, M.; Sundell, I.B.; Koka, P.S. Adult mesenchymal stem cells and their potency in the cell-based therapy. J. Stem Cells 2013, 8, 1–16. [Google Scholar]
- Hofstetter, C.P.; Schwarz, E.J.; Hess, D.; Widenfalk, J.; el Manira, A.; Prockop, D.J.; Olson, L. Marrow stromal cells form guiding strands in the injured spinal cord and promote recovery. Proc. Natl. Acad. Sci. USA 2002, 99, 2199–2204. [Google Scholar] [CrossRef]
- Horwitz, E.M.; Gordon, P.L.; Koo, W.K.K.; Marx, J.C.; Neel, M.D.; McNall, R.Y.; Muul, L.; Hofmann, T. Isolated allogeneic bone marrow-derived mesenchymal cells engraft and stimulate growth in children with osteogenesis imperfecta: Implications for cell therapy of bone. Proc. Natl. Acad. Sci. USA 2002, 99, 8932–8937. [Google Scholar] [CrossRef]
- Chen, T.L. Inhibition of growth and differentiation of osteoprogenitors in mouse bone marrow stromal cell cultures by increased donor age and glucocorticoid treatment. Bone 2004, 35, 83–95. [Google Scholar] [CrossRef]
- Shenaq, D.S.; Rastegar, F.; Petkovic, D.; Zhang, B.Q.; He, B.C.; Chen, L.; Zuo, G.W.; Luo, Q.; Shi, Q.; Wagner, E.R.; et al. Mesenchymal progenitor cells and their orthopedic applications: Forging a path towards clinical trials. Stem Cells Int. 2010, 2010. [Google Scholar] [CrossRef]
- Centrella, M.; Horowitz, M.C.; Wozney, J.M.; McCarthy, T.L. Transforming growth factor-beta gene family members and bone. Endocr. Rev. 1994, 15, 27–39. [Google Scholar]
- Chen, G.; Deng, C.; Li, Y.P. TGF-β and BMP signaling in osteoblast differentiation and bone formation. Int. J. Biol. Sci. 2012, 8, 272–288. [Google Scholar] [CrossRef]
- Long, M.W.; Robinson, J.A.; Ashcraft, E.A.; Mann, K.G. Regulation of human bone marrow-derived osteoprogenitor cells by osteogenic growth factors. J. Clin. Investig. 1995, 95, 881–887. [Google Scholar] [CrossRef]
- Lu, L.; Yaszemski, M.J.; Mikos, A.G. TGF-beta1 release from biodegradable polymer microparticles: Its effects on marrow stromal osteoblast function. J. Bone Jt. Surg. Am. 2001, 83-A (Suppl. 1), S82–S91. [Google Scholar]
- Zhao, L.; Hantash, B.M. TGF-β1 regulates differentiation of bone marrow mesenchymal stem cells. Vitam. Horm. 2011, 87, 127–141. [Google Scholar] [CrossRef]
- Murphy, C.M.; O’Brien, F.J.; Little, D.G.; Schindeler, A. Cell-scaffold interactions in the bone tissue engineering triad. Eur. Cell Mater. 2013, 26, 120–132. [Google Scholar]
- Roberts, A.B.; Sporn, M.B. Physiological actions and clinical applications of transforming growth factor-beta (TGF-beta). Growth Factors 1993, 8, 1–9. [Google Scholar] [CrossRef]
- Gazit, D.; Zilberman, Y.; Turgeman, G.; Zhou, S.; Kahn, A. Recombinant TGF-beta1 stimulates bone marrow osteoprogenitor cell activity and bone matrix synthesis in osteopenic, old male mice. J. Cell. Biochem. 1999, 73, 379–389. [Google Scholar] [CrossRef]
- Moxham, J.P.; Kibblewhite, D.J.; Dvorak, M.; Perey, B.; Tencer, A.F.; Bruce, A.G.; Strong, D.M. TGF-beta 1 forms functionally normal bone in a segmental sheep tibial diaphyseal defect. J. Otolaryngol. 1996, 25, 388–392. [Google Scholar]
- Walsh, S.; Jefferiss, C.; Stewart, K.; Beresford, J.N. TGFbeta1 limits the expansion of the osteoprogenitor fraction in cultures of human bone marrow stromal cells. Cell Tissue Res. 2003, 311, 187–198. [Google Scholar]
- Urist, M.R. Bone: Formation by autoinduction. Science 1965, 150, 893–899. [Google Scholar]
- Reddi, A.H. Role of morphogenetic proteins in skeletal tissue engineering and regeneration. Nat. Biotechnol. 1998, 16, 247–252. [Google Scholar] [CrossRef]
- Wozney, J.M.; Rosen, V. Bone morphogenetic protein and bone morphogenetic protein gene family in bone formation and repair. Clin. Orthop. Relat. Res. 1998, 346, 26–37. [Google Scholar]
- Tachi, K.; Takami, M.; Sato, H.; Mochizuki, A.; Zhao, B.; Miyamoto, Y.; Tsukasaki, H.; Inoue, T.; Shintani, S.; Koike, T.; et al. Enhancement of bone morphogenetic protein-2-induced ectopic bone formation by transforming growth factor-β1. Tissue Eng. A 2011, 17, 597–606. [Google Scholar]
- Andrades, J.A.; Han, B.; Becerra, J.; Sorgente, N.; Hall, F.L.; Nimni, M.E. A recombinant human TGF-beta1 fusion protein with collagen-binding domain promotes migration, growth, and differentiation of bone marrow mesenchymal cells. Exp. Cell Res. 1999, 250, 485–498. [Google Scholar] [CrossRef]
- Andrades, J.A.; Becerra, J. Type I collagen combined with a recombinant TGF-β serves as a scaffold for mesenchymal stem cells. In Advances in Skeletal Reconstruction Using Bone Morphogenetic Proteins; World Scientific: Singapore, Singapore, 2002; pp. 281–309. [Google Scholar]
- Andrades, J.A.; Han, B.; Nimni, M.E.; Ertl, D.C.; Simpkins, R.J.; Arrabal, M.P.; Becerra, J. A modified rhTGF-beta1 and rhBMP-2 are effective in initiating a chondro-osseous differentiation pathway in bone marrow cells cultured in vitro. Connect. Tissue Res. 2003, 44, 188–197. [Google Scholar] [CrossRef]
- Becerra, J.; Guerado, E.; Claros, S.; Alonso, M.; Bertrand, M.L.; González, C.; Andrades, J.A. Autologous human-derived bone marrow cells exposed to a novel TGF-beta1 fusion protein for the treatment of critically sized tibial defect. Regen. Med. 2006, 1, 267–278. [Google Scholar] [CrossRef]
- Neve, A.; Corrado, A.; Cantatore, F.P. Osteoblast physiology in normal and pathological conditions. Cell Tissue Res. 2011, 343, 289–302. [Google Scholar] [CrossRef]
- Reilly, G.C.; Radin, S.; Chen, A.T.; Ducheyne, P. Differential alkaline phosphatase responses of rat and human bone marrow derived mesenchymal stem cells to 45S5 bioactive glass. Biomaterials 2007, 28, 4091–4097. [Google Scholar] [CrossRef]
- Birmingham, E.; Niebur, G.L.; McHugh, P.E.; Shaw, G.; Barry, F.P.; McNamara, L.M. Osteogenic differentiation of mesenchymal stem cells is regulated by osteocyte and osteoblast cells in a simplified bone niche. Eur. Cell Mater. 2012, 23, 13–27. [Google Scholar]
- Hoemann, C.D.; el-Gabalawy, H.; McKee, M.D. In vitro osteogenesis assays: Influence of the primary cell source on alkaline phosphatase activity and mineralization. Pathol. Biol. 2009, 57, 318–323. [Google Scholar]
- Huang, Z.; Nelson, E.R.; Smith, R.L.; Goodman, S.B. The sequential expression profiles of growth factors from osteoprogenitors [correction of osteroprogenitors] to osteoblasts in vitro. Tissue Eng. 2007, 13, 2311–2320. [Google Scholar] [CrossRef]
- Claros, S.; Rodríguez-Losada, N.; Cruz, E.; Guerado, E.; Becerra, J.; Andrades, J.A. Characterization of adult stem/progenitor cell populations from bone marrow in a three-dimensional collagen gel culture system. Cell Transplant. 2012, 21, 2021–2032. [Google Scholar] [CrossRef]
- Minguell, J.J.; Fierro, F.A.; Epuñan, M.J.; Erices, A.A.; Sierralta, W.D. Nonstimulated human uncommitted mesenchymal stem cells express cell markers of mesenchymal and neural lineages. Stem Cells Dev. 2005, 14, 408–414. [Google Scholar] [CrossRef]
- Beyer Nardi, N.; da Silva Meirelles, L. Mesenchymal stem cells: Isolation, in vitro expansion and characterization. Handb. Exp. Pharmacol. 2006, 174, 249–282. [Google Scholar] [CrossRef]
- Dominici, M.; le Blanc, K.; Mueller, I.; Slaper-Cortenbach, I.; Marini, F.; Krause, D.; Deans, R.; Keating, A.; Prockop, D.; Horwitz, E. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy 2006, 8, 315–317. [Google Scholar] [CrossRef]
- Jones, E.A.; Kinsey, S.E.; English, A.; Jones, R.A.; Straszynski, L.; Meredith, D.M.; Markham, A.F.; Jack, A.; Emery, P.; McGonagle, D. Isolation and characterization of bone marrow multipotential mesenchymal progenitor cells. Arthritis Rheum. 2002, 46, 3349–3360. [Google Scholar] [CrossRef]
- Kolf, C.M.; Cho, E.; Tuan, R.S. Mesenchymal stromal cells. Biology of adult mesenchymal stem cells: Regulation of niche, self-renewal and differentiation. Arthritis Res. Ther. 2007, 9, 204. [Google Scholar] [CrossRef] [Green Version]
- Rasmusson, I. Immune modulation by mesenchymal stem cells. Exp. Cell Res. 2006, 312, 2169–2179. [Google Scholar] [CrossRef]
- Smadja, D.M.; Mauge, L.; Sanchez, O.; Silvestre, J.S.; Guerin, C.; Godier, A.; Henno, P.; Gaussem, P.; Israël-Biet, D. Distinct patterns of circulating endothelial cells in pulmonary hypertension. Eur. Respir. J. 2010, 36, 1284–1293. [Google Scholar] [CrossRef]
- Untergasser, G.; Koeck, R.; Wolf, D.; Rumpold, H.; Ott, H.; Debbage, P.; Koppelstaetter, C.; Gunsilius, E. CD34+/CD133− circulating endothelial precursor cells (CEP): Characterization, senescence and in vivo application. Exp. Gerontol. 2006, 41, 600–608. [Google Scholar] [CrossRef]
- Li, R.; Stewart, D.J.; von Schroeder, H.P.; Mackinnon, E.S.; Schemitsch, E.H. Effect of cell-based VEGF gene therapy on healing of a segmental bone defect. J. Orthop. Res. 2009, 27, 8–14. [Google Scholar] [CrossRef]
- Matsumoto, T.; Kuroda, R.; Mifune, Y.; Kawamoto, A.; Shoji, T.; Miwa, M.; Asahara, T.; Kurosaka, M. Circulating endothelial/skeletal progenitor cells for bone regeneration and healing. Bone 2008, 43, 434–439. [Google Scholar]
- Chambers, I.; Tomlinson, S.R. The transcriptional foundation of pluripotency. Development 2009, 136, 2311–2322. [Google Scholar] [CrossRef]
- Mitsui, K.; Tokuzawa, Y.; Itoh, H.; Segawa, K.; Murakami, M.; Takahashi, K.; Maruyama, M.; Maeda, M.; Yamanaka, S. The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells. Cell 2003, 113, 631–642. [Google Scholar] [CrossRef]
- Rodda, D.J.; Chew, J.L.; Lim, L.H.; Loh, Y.H.; Wang, B.; Ng, H.H.; Robson, P. Transcriptional regulation of nanog by OCT4 and SOX2. J. Biol. Chem. 2005, 280, 24731–24737. [Google Scholar]
- Yoon, D.S.; Kim, Y.H.; Jung, H.S.; Paik, S.; Lee, J.W. Importance of Sox2 in maintenance of cell proliferation and multipotency of mesenchymal stem cells in low-density culture. Cell Prolif. 2011, 44, 428–440. [Google Scholar] [CrossRef]
- Zheng, C.; Yang, S.; Guo, Z.; Liao, W.; Zhang, L.; Yang, R.; Han, Z.C. Human multipotent mesenchymal stromal cells from fetal lung expressing pluripotent markers and differentiating into cell types of three germ layers. Cell Transplant. 2009, 18, 1093–1109. [Google Scholar] [CrossRef]
- Navarro, P.; Festuccia, N.; Colby, D.; Gagliardi, A.; Mullin, N.P.; Zhang, W.; Karwacki-Neisius, V.; Osorno, R.; Kelly, D.; Robertson, M.; et al. OCT4/SOX2-independent Nanog autorepression modulates heterogeneous Nanog gene expression in mouse ES cells. EMBO J. 2012, 31, 4547–4562. [Google Scholar] [CrossRef]
- Wang, Z.; Oron, E.; Nelson, B.; Razis, S.; Ivanova, N. Distinct lineage specification roles for NANOG, OCT4, and SOX2 in human embryonic stem cells. Cell Stem Cell 2012, 10, 440–454. [Google Scholar] [CrossRef]
- Takahashi, K.; Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 2006, 126, 663–676. [Google Scholar]
- Yu, J.; Vodyanik, M.A.; Smuga-Otto, K.; Antosiewicz-Bourget, J.; Frane, J.L.; Tian, S.; Nie, J.; Jonsdottir, G.A.; Ruotti, V.; Stewart, R.; et al. Induced pluripotent stem cell lines derived from human somatic cells. Science 2007, 318, 1917–1920. [Google Scholar] [CrossRef]
- Zhao, H.; Li, Y.; Jin, H.; Xie, L.; Liu, C.; Jiang, F.; Luo, Y.; Yin, G.; Li, Y.; Wang, J.; et al. Rapid and efficient reprogramming of human amnion-derived cells into pluripotency by three factors OCT4/SOX2/NANOG. Differentiation 2010, 80, 123–129. [Google Scholar]
- Nakashima, K.; Zhou, X.; Kunkel, G.; Zhang, Z.; Deng, J.M.; Behringer, R.R.; de Crombrugghe, B. The novel zinc finger-containing transcription factor osterix is required for osteoblast differentiation and bone formation. Cell 2002, 108, 17–29. [Google Scholar] [CrossRef]
- Nishio, Y.; Dong, Y.; Paris, M.; O’Keefe, R.J.; Schwarz, E.M.; Drissi, H. Runx2-mediated regulation of the zinc finger Osterix/Sp7 gene. Gene 2006, 372, 62–70. [Google Scholar] [CrossRef]
- Scotti, C.; Tonnarelli, B.; Papadimitropoulos, A.; Scherberich, A.; Schaeren, S.; Schauerte, A.; Lopez-Rios, J.; Zeller, R.; Barbero, A.; Martin, I. Recapitulation of endochondral bone formation using human adult mesenchymal stem cells as a paradigm for developmental engineering. Proc. Natl. Acad. Sci. USA 2010, 107, 7251–7256. [Google Scholar] [CrossRef]
- Van den Bos, T.; Speijer, D.; Bank, R.A.; Brömme, D.; Everts, V. Differences in matrix composition between calvaria and long bone in mice suggest differences in biomechanical properties and resorption: Special emphasis on collagen. Bone 2008, 43, 459–468. [Google Scholar] [CrossRef]
- Alonso, M.; Claros, S.; Becerra, J.; Andrades, J.A. The effect of type I collagen on osteochondrogenic differentiation in adipose-derived stromal cells in vivo. Cytotherapy 2008, 10, 597–610. [Google Scholar] [CrossRef]
- Andrades, J.A.; Santamaría, J.A.; Nimni, M.E.; Becerra, J. Selection and amplification of a bone marrow cell population and its induction to the chondro-osteogenic lineage by rhOP-1: An in vitro and in vivo study. Int. J. Dev. Biol. 2001, 45, 689–693. [Google Scholar]
- Ashton, B.A.; Allen, T.D.; Howlett, C.R.; Eaglesom, C.C.; Hattori, A.; Owen, M. Formation of bone and cartilage by marrow stromal cells in diffusion chambers in vivo. Clin. Orthop. Relat. Res. 1980, 151, 294–307. [Google Scholar]
- Claros, S.; Alonso, M.; Becerra, J.; Andrades, J.A. Selection and induction of rat skeletal muscle-derived cells to the chondro-osteogenic lineage. Cell. Mol. Biol. 2008, 54, 1–10. [Google Scholar]
- Gordon, E.M.; Skotzko, M.; Kundu, R.K.; Han, B.; Andrades, J.; Nimni, M.; Anderson, W.F.; Hall, F.L. Capture and expansion of bone marrow-derived mesenchymal progenitor cells with a transforming growth factor-beta1-von Willebrand’s factor fusion protein for retrovirus-mediated delivery of coagulation factor IX. Hum. Gene Ther. 1997, 8, 1385–1394. [Google Scholar] [CrossRef]
- Han, S.; Zhao, Y.; Xiao, Z.; Han, J.; Chen, B.; Chen, L.; Dai, J. The three-dimensional collagen scaffold improves the stemness of rat bone marrow mesenchymal stem cells. J. Genet. Genomics 2012, 39, 633–641. [Google Scholar] [CrossRef]
- Takahashi, T.; Kamiya, N.; Kawabata, N.; Takagi, M. The effect of retinoic acid on a zinc finger transcription factor, AJ18, during differentiation of a rat clonal preosteoblastic cell line, ROB-C20, into osteoblasts. Arch. Oral Biol. 2008, 53, 87–94. [Google Scholar] [CrossRef]
- Zhou, Y.; Guan, X.X.; Zhu, Z.L.; Guo, J.; Huang, Y.C.; Hou, W.W.; Yu, H.Y. Caffeine inhibits the viability and osteogenic differentiation of rat bone marrow-derived mesenchymal stromal cells. Br. J. Pharmacol. 2010, 161, 1542–1552. [Google Scholar] [CrossRef]
© 2014 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Claros, S.; Rico-Llanos, G.A.; Becerra, J.; Andrades, J.A. A Novel Human TGF-β1 Fusion Protein in Combination with rhBMP-2 Increases Chondro-Osteogenic Differentiation of Bone Marrow Mesenchymal Stem Cells. Int. J. Mol. Sci. 2014, 15, 11255-11274. https://doi.org/10.3390/ijms150711255
Claros S, Rico-Llanos GA, Becerra J, Andrades JA. A Novel Human TGF-β1 Fusion Protein in Combination with rhBMP-2 Increases Chondro-Osteogenic Differentiation of Bone Marrow Mesenchymal Stem Cells. International Journal of Molecular Sciences. 2014; 15(7):11255-11274. https://doi.org/10.3390/ijms150711255
Chicago/Turabian StyleClaros, Silvia, Gustavo A. Rico-Llanos, José Becerra, and José A. Andrades. 2014. "A Novel Human TGF-β1 Fusion Protein in Combination with rhBMP-2 Increases Chondro-Osteogenic Differentiation of Bone Marrow Mesenchymal Stem Cells" International Journal of Molecular Sciences 15, no. 7: 11255-11274. https://doi.org/10.3390/ijms150711255
APA StyleClaros, S., Rico-Llanos, G. A., Becerra, J., & Andrades, J. A. (2014). A Novel Human TGF-β1 Fusion Protein in Combination with rhBMP-2 Increases Chondro-Osteogenic Differentiation of Bone Marrow Mesenchymal Stem Cells. International Journal of Molecular Sciences, 15(7), 11255-11274. https://doi.org/10.3390/ijms150711255