Avocado Seeds-Mediated Alleviation of Cyclosporine A-Induced Hepatotoxicity Involves the Inhibition of Oxidative Stress and Proapoptotic Endoplasmic Reticulum Stress
Abstract
1. Introduction
2. Materials and Methods
2.1. Preparation of AvS Powder
2.2. Detection of AvS Phenolic Compounds by HPLC
2.3. Experimental Design
2.4. Serum Biochemical Analysis
2.5. Determination of Oxidant and Antioxidant Status in Liver
2.6. Real-Time PCR
2.7. Comet Assay
2.8. Histopathology Examination
2.9. Statistical Analysis
3. Results
3.1. HPLC Analysis of AvS
3.2. AvS Ameliorated Liver Function Deteriorated by CsA
3.3. AvS restored Hepatic Oxidant and Antioxidant Status Disturbed by CsA
3.4. AvS inhibited Proapoptotic ER Stress Induced by CsA
3.5. AvS Alleviated DNA Damage Caused by CsA
3.6. AvS Relieved Hepatic Damage Score Induced by CsA
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Sample Availability
References
- Attia, A.A.; Salama, A.F.; Eldiasty, J.G.; Mosallam, S.A.E.-R.; El-Naggar, S.A.; El-Magd, M.A.; Nasser, H.M.; Elmetwalli, A. Amygdalin potentiates the anti-cancer effect of Sorafenib on Ehrlich ascites carcinoma and ameliorates the associated liver damage. Sci. Rep. 2022, 12, 6494. [Google Scholar] [CrossRef] [Scilit]
- Mohamed, A.E.; El-Magd, M.A.; El-Said, K.S.; El-Sharnouby, M.; Tousson, E.M.; Salama, A.F. Potential therapeutic effect of thymoquinone and/or bee pollen on fluvastatin-induced hepatitis in rats. Sci. Rep. 2021, 11, 15688. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Türk, G.; Ateşşahin, A.; Sönmez, M.; Yüce, A.; Ceribaşi, A.O. Lycopene protects against cyclosporine A-induced testicular toxicity in rats. Theriogenology 2007, 67, 778–785. [Google Scholar] [CrossRef] [Scilit]
- Naesens, M.; Kuypers, D.R.; Sarwal, M. Calcineurin inhibitor nephrotoxicity. Clin. J. Am. Soc. Nephrol. 2009, 4, 481–508. [Google Scholar] [CrossRef] [Scilit]
- Kadmon, M.; Klünemann, C.; Böhme, M.; Ishikawa, T.; Gorgas, K.; Otto, G.; Herfarth, C.; Keppler, D. Inhibition by cyclosporin A of adenosine triphosphate-dependent transport from the hepatocyte into bile. Gastroenterology 1993, 104, 1507–1514. [Google Scholar] [CrossRef] [Scilit]
- Serrya, M.S.; Nader, M.A.; Abdelmageed, M.E. Hepatoprotective effect of the tyrosine kinase inhibitor nilotinib against cyclosporine-A induced liver injury in rats through blocking the Bax/Cytochrome C/caspase-3 apoptotic signaling pathway. J. Biochem. Mol. Toxicol. 2021, 35, e22764. [Google Scholar] [CrossRef] [Scilit]
- Korolczuk, A.; Caban, K.; Amarowicz, M.; Czechowska, G.; Irla-Miduch, J. Oxidative Stress and Liver Morphology in Experimental Cyclosporine A-Induced Hepatotoxicity. BioMed Res. Int. 2016, 2016, 5823271. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abboud, G.; Kaplowitz, N. Drug-induced liver injury. Drug Saf. 2007, 30, 277–294. [Google Scholar] [CrossRef] [Scilit]
- Hagar, H.H. The protective effect of taurine against cyclosporine A-induced oxidative stress and hepatotoxicity in rats. Toxicol. Lett. 2004, 151, 335–343. [Google Scholar] [CrossRef] [Scilit]
- Elmoslemany, A.M.; El-Magd, M.A.; Ghamry, H.I.; Alshahrani, M.Y.; Zidan, N.S.; Zedan, A.M.G. Avocado Seeds Relieve Oxidative Stress-Dependent Nephrotoxicity but Enhance Immunosuppression Induced by Cyclosporine in Rats. Antioxidants 2021, 10, 1194. [Google Scholar] [CrossRef] [Scilit]
- Vangaveti, S.; Das, P.; Kumar, V.L. Metformin and silymarin afford protection in cyclosporine A induced hepatorenal toxicity in rat by modulating redox status and inflammation. J. Biochem. Mol. Toxicol. 2021, 35, e22614. [Google Scholar] [CrossRef] [Scilit]
- El-Sherbeeny, N.A.; Nader, M.A. The protective effect of vildagliptin in chronic experimental cyclosporine A-induced hepatotoxicity. Can. J. Physiol. Pharmacol. 2016, 94, 251–256. [Google Scholar] [CrossRef] [Scilit]
- Faheem, S.A.; El-Sayed, N.M.; Moustafa, Y.M.; Saeed, N.M.; Hazem, R.M. Pyrvinium pamoate ameliorates cyclosporin A- induced hepatotoxicity via the modulation of Wnt/β-catenin signaling and upregulation of PPAR-γ. Int. Immunopharmacol. 2022, 104, 108538. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Akbulut, S.; Elbe, H.; Eris, C.; Dogan, Z.; Toprak, G.; Yalcin, E.; Otan, E.; Turkoz, Y. Effects of antioxidant agents against cyclosporine-induced hepatotoxicity. J. Surg. Res. 2015, 193, 658–666. [Google Scholar] [CrossRef] [Scilit]
- Durak, I.; Ozbek, H.; Elgün, S. Cyclosporine reduces hepatic antioxidant capacity: Protective roles of antioxidants. Int. Immunopharmacol. 2004, 4, 469–473. [Google Scholar] [CrossRef] [Scilit]
- Pan, X.; Wang, X.; Wang, X.; Zhang, W.; Sun, Z.; Liang, X.; Zhang, X.; Li, W.; Li, Z. Protective effects of new Wenshen Shengjing Decoction on cyclosporine-induced impairment of testosterone synthesis and spermatogenic apoptosis. Exp. Ther. Med. 2018, 15, 813–821. [Google Scholar] [CrossRef] [Scilit]
- Yilmaz, D.E.; Kirschner, K.; Demirci, H.; Himmerkus, N.; Bachmann, S.; Mutig, K. Immunosuppressive calcineurin inhibitor cyclosporine A induces proapoptotic endoplasmic reticulum stress in renal tubular cells. J. Biol. Chem. 2022, 298, 101589. [Google Scholar] [CrossRef] [Scilit]
- Cybulsky, A.V. Endoplasmic reticulum stress, the unfolded protein response and autophagy in kidney diseases. Nat. Rev. Nephrol. 2017, 13, 681–696. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kurus, M.; Esrefoglu, M.; Karabulut, A.B.; Sogutlu, G.; Kaya, M.; Otlu, A. Oral L-arginine protects against cyclosporine-induced hepatotoxicity in rats. Exp. Toxicol. Pathol. Off. J. Ges. Fur Toxikol. Pathol. 2008, 60, 411–419. [Google Scholar] [CrossRef] [Scilit]
- Kwak, C.; Mun, K. The beneficial effect of melatonin for cyclosporine hepatotoxicity in rats. Transplant. Proc. 2000, 32, 2009–2010. [Google Scholar] [CrossRef] [Scilit]
- Rezzani, R.; Rodella, L.; Buffoli, B.; Goodman, A.A.; Abraham, N.G.; Lianos, E.A.; Bianchi, R. Change in renal heme oxygenase expression in cyclosporine A-induced injury. J. Histochem. Cytochem. Off. J. Histochem. Soc. 2005, 53, 105–112. [Google Scholar] [CrossRef] [Scilit]
- Erarslan, E.; Ekiz, F.; Uz, B.; Koca, C.; Turkcu, U.O.; Bayrak, R.; Delibasi, T. Effects of erdosteine on cyclosporine-A-induced hepatotoxicity in rats. Drug Chem. Toxicol. 2011, 34, 32–37. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bhuyan, D.J.; Alsherbiny, M.A.; Perera, S.; Low, M.; Basu, A.; Devi, O.A.; Barooah, M.S.; Li, C.G.; Papoutsis, K. The odyssey of bioactive compounds in avocado (Persea americana) and their health benefits. Antioxidants 2019, 8, 426. [Google Scholar] [CrossRef] [Scilit]
- Padilla-Camberos, E.; Martínez-Velázquez, M.; Flores-Fernández, J.M.; Villanueva-Rodríguez, S. Acute toxicity and genotoxic activity of avocado seed extract (Persea americana Mill., c.v. Hass). Sci. World J. 2013, 2013, 245828. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dao, P.T.A.; An, N.T.H.; Thuy, N.T.T.; Tuyet, N.T.A.; Truc, T.T.M. Screening on Antioxidant Activities of By-Products from Vegetables and Fruits in Tay Nguyen Region and Applying for Shrimp Cold Storage. In Proceedings of the 2016 3rd International Conference on Green Technology and Sustainable Development (GTSD), Kaohsiung, Taiwan, 24–25 November 2016; pp. 93–97. [Google Scholar]
- Tugiyanti, E.; Iriyanti, N.; Apriyanto, Y.S. The effect of avocado seed powder (Persea americana Mill.) on the liver and kidney functions and meat quality of culled female quail (Coturnix coturnix japonica). Vet. World 2019, 12, 1608–1615. [Google Scholar] [CrossRef] [Scilit]
- Abu Khudir, R.; El-Magd, M.A.; Salama, A.F.; Tousson, E.M.; El-Dsoki, S.M. Curcumin Attenuated Oxidative Stress and Inflammation on Hepatitis Induced by Fluvastatin in Female Albino Rats. Alex. J. Vet. Sci. 2019, 62, 102–115. [Google Scholar] [CrossRef] [Scilit]
- Uchenna, U.E.; Shori, A.B.; Baba, A.S. Inclusion of avocado (Persea americana) seeds in the diet to improve carbohydrate and lipid metabolism in rats. Rev. Argent. De Endocrinol. Y Metab. 2017, 54, 140–148. [Google Scholar] [CrossRef] [Scilit]
- Aboulhoda, B.E.; El-Din, S.S.; Khalifa, M.M.; Arsanyos, S.F.; Motawie, A.G.; Sedeek, M.S.; Abdelfattah, G.H.; Abdelgalil, W.A. Histological, immunohistochemical, and molecular investigation on the hepatotoxic effect of potassium dichromate and the ameliorating role of Persea americana mill pulp extract. Microsc. Res. Tech. 2021, 84, 2434–2450. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brai, B.I.; Adisa, R.A.; Odetola, A.A. Hepatoprotective properties of aqueous leaf extract of Persea Americana, Mill (Lauraceae)‘avocado’against CCL4-induced damage in rats. Afr. J. Tradit. Complement. Altern. Med. 2014, 11, 237–244. [Google Scholar] [CrossRef] [Scilit]
- Kim, K.-H.; Tsao, R.; Yang, R.; Cui, S.W. Phenolic acid profiles and antioxidant activities of wheat bran extracts and the effect of hydrolysis conditions. Food Chem. 2006, 95, 466–473. [Google Scholar] [CrossRef] [Scilit]
- Mesbah, L.; Soraya, B.; Narimane, S.; Jean, P.F. Protective effect of flavonides against the toxicity of vinblastine cyclophosphamide and paracetamol by inhibition of lipid-peroxydation and increase of liver glutathione. Haematology 2004, 7, 59–67. [Google Scholar]
- Misra, H.P.; Fridovich, I. The role of superoxide anion in the autoxidation of epinephrine and a simple assay for superoxide dismutase. J. Biol. Chem. 1972, 247, 3170–3175. [Google Scholar] [CrossRef] [Scilit]
- Aebi, H. Catalase In Vitro. In Methods in Enzymology, 3rd ed.; Lippincott-Raven Publishers: Philadelphia, PA, USA, 1984; Volume 105, pp. 121–126. [Google Scholar]
- Hafeman, D.G.; Sunde, R.A.; Hoekstra, W.G. Effect of dietary selenium on erythrocyte and liver glutathione peroxidase in the rat. J. Nutr. 1974, 104, 580–587. [Google Scholar] [CrossRef] [Scilit]
- Elgazar, A.A.; Selim, N.M.; Abdel-Hamid, N.M.; El-Magd, M.A.; El Hefnawy, H.M. Isolates from Alpinia officinarum Hance attenuate LPS induced inflammation in HepG2: Evidence from In Silico and In Vitro Studies. Phytother. Res. 2018, 32, 1273–1288. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saleh, A.A.; Amber, K.; El-Magd, M.A.; Atta, M.S.; Mohammed, A.A.; Ragab, M.M.; Abd El-Kader, H. Integrative effects of feeding Aspergillus awamori and fructooligosaccharide on growth performance and digestibility in broilers: Promotion muscle protein metabolism. Biomed. Res. Int. 2014, 2014, 946859. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Badawy, A.A.; El-Magd, M.A.; AlSadrah, S.A. Therapeutic Effect of Camel Milk and Its Exosomes on MCF7 Cells In Vitro and In Vivo. Integr. Cancer Ther. 2018, 7, 1235–1246. [Google Scholar] [CrossRef] [Scilit]
- Bingul, I.; Olgac, V.; Bekpinar, S.; Uysal, M. The protective effect of resveratrol against cyclosporine A-induced oxidative stress and hepatotoxicity. Arch. Physiol. Biochem. 2021, 127, 551–556. [Google Scholar] [CrossRef] [Scilit]
- Sánchez-Lozada, L.G.; Gamba, G.; Bolio, A.; Jiménez, F.; Herrera-Acosta, J.; Bobadilla, N.A. Nifedipine prevents changes in nitric oxide synthase mRNA levels induced by cyclosporine. Hypertension 2000, 36, 642–647. [Google Scholar] [CrossRef] [Scilit]
- Nacar, A.; Karaboğa, I.; Okuyan, H.M.; Sefil, N.K.; Nacar, E.; Motor, S.; Akküçük, S.; Ozkan, O.V. Investigation of the protective effect of erdosteine against cyclosporine-induced injury in rat liver with histological and biochemical methods. Turk. J. Med. Sci. 2015, 45, 1390–1395. [Google Scholar] [CrossRef] [Scilit]
- Mohamed, Y.; Basyony, M.A.; El-Desouki, N.I.; Abdo, W.S.; El-Magd, M.A. The potential therapeutic effect for melatonin and mesenchymal stem cells on hepatocellular carcinoma. BioMedicine 2019, 9, 23–29. [Google Scholar] [CrossRef] [Scilit]
- El-Magd, M.A.; Kahilo, K.A.; Nasr, N.E.; Kamal, T.; Shukry, M.; Saleh, A.A. A potential mechanism associated with lead-induced testicular toxicity in rats. Andrologia 2016, 49, e12750. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abdelhady, D.; El-Abasy, M.; Abou-Asa, S.; Elbialy, Z.; Shukry, M.; Hussein, A.; Saleh, A.; El-Magd, M. The ameliorative effect of Aspergillus awamori on aflatoxin B1-induced hepatic damage in rabbits. World Mycotoxin J. 2017, 10, 363–373. [Google Scholar] [CrossRef] [Scilit]
- El-Sayed, R.; El-Demerdash, F.; El-Magd, M. Ginseng ameliorates pulmonary toxicity induced by silicon dioxide nanoparticles in rats. Asian Pac. J. Trop. Biomed. 2021, 11, 254–262. [Google Scholar]
- El-Demerdash, F.M.; El-Magd, M.A.; El-Sayed, R.A. Panax ginseng modulates oxidative stress, DNA damage, apoptosis, and inflammations induced by silicon dioxide nanoparticles in rats. Environ. Toxicol. 2021, 36, 362–1374. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, Q.; Wang, X.; Nepovimova, E.; Wang, Y.; Yang, H.; Kuca, K. Mechanism of cyclosporine A nephrotoxicity: Oxidative stress, autophagy, and signalings. Food Chem. Toxicol. 2018, 118, 889–907. [Google Scholar] [CrossRef] [Scilit]
- Levy, O.; Labbé, A.; Borderie, V.; Laroche, L.; Bouheraoua, N. Topical cyclosporine in ophthalmology: Pharmacology and clinical indications. J. Fr. D’ophtalmologie 2016, 39, 292–307. [Google Scholar] [CrossRef] [Scilit]
- Xiao, Z.; Shan, J.; Li, C.; Luo, L.; Lu, J.; Li, S.; Long, D.; Li, Y. Mechanisms of cyclosporine-induced renal cell apoptosis: A systematic review. Am. J. Nephrol. 2013, 37, 30–40. [Google Scholar] [CrossRef] [Scilit]
- de Hornedo, J.P.; de Arriba, G.; Fernández, M.C.; Martínez, S.B.; Cid, T.P. Cyclosporin A causes oxidative stress and mitochondrial dysfunction in renal tubular cells. Nefrología 2007, 27, 565–573. [Google Scholar]
- Pallet, N.; Rabant, M.; Xu-Dubois, Y.-C.; LeCorre, D.; Mucchielli, M.-H.; Imbeaud, S.; Agier, N.; Hertig, A.; Thervet, E.; Legendre, C. Response of human renal tubular cells to cyclosporine and sirolimus: A toxicogenomic study. Toxicol. Appl. Pharm. 2008, 229, 184–196. [Google Scholar] [CrossRef] [Scilit]
- Ram, B.M.; Ramakrishna, G. Endoplasmic reticulum vacuolation and unfolded protein response leading to paraptosis like cell death in cyclosporine A treated cancer cervix cells is mediated by cyclophilin B inhibition. Biochim. Biophys. Acta (BBA)-Mol. Cell Res. 2014, 1843, 2497–2512. [Google Scholar] [CrossRef] [Scilit]
- Hetz, C. The unfolded protein response: Controlling cell fate decisions under ER stress and beyond. Nat. Rev. Mol. Cell Biol. 2012, 13, 89–102. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, W.T.; Ha, D.; Kanel, G.; Lee, A.S. Targeted deletion of ER chaperone GRP94 in the liver results in injury, repopulation of GRP94-positive hepatocytes, and spontaneous hepatocellular carcinoma development in aged mice. Neoplasia 2014, 16, 617–626. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, W.; Bostic, T.R.; Gu, L. Antioxidant capacities, procyanidins and pigments in avocados of different strains and cultivars. Food Chem. 2010, 122, 1193–1198. [Google Scholar] [CrossRef] [Scilit]
- Li, X.; Wang, X.; Chen, D.; Chen, S. Antioxidant activity and mechanism of protocatechuic acid in vitro. Funct. Foods Health Dis. 2011, 1, 232–244. [Google Scholar] [CrossRef] [Scilit]
- Laksmiani, N.P.L.; Sanjaya, I.K.N.; Leliqia, N.P.E. The activity of avocado (Persea americana Mill.) seed extract containing catechin as a skin lightening agent. J. Pharm. Pharmacogn. Res. 2020, 8, 449–456. [Google Scholar]
- Gülçin, İ. Antioxidant activity of caffeic acid (3,4-dihydroxycinnamic acid). Toxicology 2006, 217, 213–220. [Google Scholar] [CrossRef] [Scilit]
- Rosero, J.C.; Cruz, S.; Osorio, C.; Hurtado, N. Analysis of Phenolic Composition of Byproducts (Seeds and Peels) of Avocado (Persea americana Mill.) Cultivated in Colombia. Molecules 2019, 24, 3209. [Google Scholar] [CrossRef] [Scilit]
- Dabas, D.; Elias, R.J.; Ziegler, G.R.; Lambert, J.D. In Vitro Antioxidant and Cancer Inhibitory Activity of a Colored Avocado Seed Extract. Int. J. Food Sci. 2019, 2019, 6509421. [Google Scholar] [CrossRef] [Scilit]
- Plaza, L.; Sánchez-Moreno, C.; de Pascual-Teresa, S.; de Ancos, B.; Cano, M.P. Fatty acids, sterols, and antioxidant activity in minimally processed avocados during refrigerated storage. J. Agric. Food Chem. 2009, 57, 3204–3209. [Google Scholar] [CrossRef] [Scilit]
- Lara-Márquez, M.; Báez-Magaña, M.; Raymundo-Ramos, C.; Spagnuolo, P.A.; Macías-Rodríguez, L.; Salgado-Garciglia, R.; Ochoa-Zarzosa, A.; López-Meza, J.E. Lipid-rich extract from Mexican avocado (Persea americana var. drymifolia) induces apoptosis and modulates the inflammatory response in Caco-2 human colon cancer cells. J. Funct. Foods 2020, 64, 103658. [Google Scholar] [CrossRef] [Scilit]
- Pham, T.N.M.; Jeong, S.Y.; Kim, D.H.; Park, Y.H.; Lee, J.S.; Lee, K.W.; Moon, I.S.; Choung, S.Y.; Kim, S.H.; Kang, T.H.; et al. Protective Mechanisms of Avocado Oil Extract Against Ototoxicity. Nutrients 2020, 12, 947. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chipurupalli, S.; Samavedam, U.; Robinson, N. Crosstalk Between ER Stress, Autophagy and Inflammation. Front. Med. 2021, 8, 2125. [Google Scholar] [CrossRef] [Scilit] [PubMed]




| Gene | Forward Primer | Reverse Primer |
|---|---|---|
| XBP1 | AAACAGAGTAGCAGCGCAGACTGC | GGATCTCTAAAACTAGAGGCTTGGTG |
| BIP | CTGGGTACATTTGATCTGACTGG | GCATCCTGGTGGCTTTCCAGCCATTC |
| CHOP | AGGAGAGAGAAACCGGTCCAA | GGACACTGTCTCAAAGGCGA |
| Bax | ACACCTGAGCTGACCTTG | AGCCCATGATGGTTCTGATC |
| Casp3 | GGTATTGAGACAGACAGTGG | CATGGGATCTGTTTCTTTGC |
| Bcl2 | ATCGCTCTGTGGATGACTGAGTAC | AGAGACAGCCAGGAGAAATCAAAC |
| GAPDH | CAACTCCCTCAAGATTGTCAGCAA | GGCATGGACTGTGGTCATGA |
| Compound | Retention Time | Concentration (μg/g) |
|---|---|---|
| Gallic acid | 3.98 | 1.87 |
| Protocatechuic acid | 7.79 | 35.51 |
| Gentisic acid | 12.41 | Not detected |
| p-hydroxybenzoic acid | 14.59 | 7.08 |
| Catechin | 16.69 | 30.80 |
| Caffeic acid | 18.94 | 12.44 |
| Syringic acid | 21.43 | Not detected |
| Vanillic acid | 22.94 | 0.53 |
| Ferulic acid | 33.43 | 5.57 |
| Sinapic acid | 35.42 | 4.07 |
| p-Coumaric acid | 37.75 | 0.75 |
| Rutin | 39.19 | Not detected |
| Rosmarinic acid | 42.62 | 0.97 |
| Apigenin-7-glucoside | 49.37 | 1.14 |
| Cinnamic acid | 53.96 | 0.65 |
| Quercetin | 55.99 | 0.38 |
| Apigenin | 58.66 | Not detected |
| Kaempferol | 59.97 | Not detected |
| Chrysin | 61.22 | 1.90 |
| Parameters | Cnt | AvS | CsA | AvS + CsA |
|---|---|---|---|---|
| ALT (U/L) | 34.23 ± 1.74 c | 32.53 ± 2.15 c | 90.33 ± 5.64 a | 61.46 ± 2.79 b |
| AST (U/L) | 79.20 ± 5.81 c | 72.05 ± 5.36 c | 208.52 ± 13.15 a | 119.27 ± 8.53 b |
| ALP (U/L) | 159.36 ± 7.03 c | 141.92 ± 7.44 c | 260.39 ± 18.82 a | 207.09 ± 14.13 b |
| γ-GTP (U/L) | 9.15 ± 0.52 c | 8.36 ± 0.47 c | 28.25 ± 1.42 a | 19.18 ± 0.84 b |
| Albumin (g/dL) | 2.95 ± 0.15 a | 2.67 ± 0.16 a | 1.70 ± 0.10 b | 2.39 ± 0.13 a |
| Total bilirubin (mg/dL) | 0.35 ± 0.01 c | 0.36 ± 0.01 c | 1.12 ± 0.05 a | 0.62 ± 0.03 b |
| Direct bilirubin (mg/dL) | 0.11 ± 0.007 c | 0.08 ± 0.002 c | 0.32 ± 0.01 a | 0.13 ± 0.008 b |
| Indirect bilirubin (mg/dL) | 0.24 ± 0.01 c | 0.28 ± 0.01 c | 0.80 ± 0.04 a | 0.49 ± 0.02 b |
| Parameters | Cnt | AvS | CsA | AvS + CsA |
|---|---|---|---|---|
| MDA (nmol/g tissue) | 39.00 ± 1.39 c | 36.27 ± 1.54 c | 146.83 ± 7.62 a | 81.44 ± 4.50 b |
| SOD (U/g tissue) | 35.5 ± 1.56 a | 37.11 ± 1.64 a | 8.93 ± 0.42 c | 17.19 ± 0.56 b |
| CAT (U/g tissue) | 54.66 ± 1.27 a | 55.17 ± 1.40 a | 18.83 ± 0.77 c | 35.28 ± 1.03 b |
| GPx (U/g tissue) | 28.75 ± 0.92 a | 31.83 ± 1.04 a | 13.16 ± 0.42 c | 22.83 ± 0.70 b |
| Parameters | Cnt | AvS | CsA | AvS + CsA |
|---|---|---|---|---|
| Tailed % | 3 | 4.5 | 20 | 12 |
| Untailed % | 97 | 95.5 | 80 | 88 |
| Tail length (µm) | 1.75 ± 0.11 c | 2.00 ± 0.14 c | 6.14 ± 0.35 a | 4.01 ± 0.28 b |
| Tail DNA% | 1.68 | 1.82 | 5.35 | 3.19 |
| Tail moment * | 2.94 | 3.64 | 32.85 | 12.79 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
El-Magd, M.A.; Zedan, A.M.G.; Zidan, N.S.; Sakran, M.I.; Bahattab, O.; Oyouni, A.A.A.; Al-Amer, O.M.; Alalawy, A.I.; Elmoslemany, A.M. Avocado Seeds-Mediated Alleviation of Cyclosporine A-Induced Hepatotoxicity Involves the Inhibition of Oxidative Stress and Proapoptotic Endoplasmic Reticulum Stress. Molecules 2022, 27, 7859. https://doi.org/10.3390/molecules27227859
El-Magd MA, Zedan AMG, Zidan NS, Sakran MI, Bahattab O, Oyouni AAA, Al-Amer OM, Alalawy AI, Elmoslemany AM. Avocado Seeds-Mediated Alleviation of Cyclosporine A-Induced Hepatotoxicity Involves the Inhibition of Oxidative Stress and Proapoptotic Endoplasmic Reticulum Stress. Molecules. 2022; 27(22):7859. https://doi.org/10.3390/molecules27227859
Chicago/Turabian StyleEl-Magd, Mohammed A., Amina M. G. Zedan, Nahla S. Zidan, Mohamed I. Sakran, Omar Bahattab, Atif Abdulwahab A. Oyouni, Osama M. Al-Amer, Adel I. Alalawy, and Amira M. Elmoslemany. 2022. "Avocado Seeds-Mediated Alleviation of Cyclosporine A-Induced Hepatotoxicity Involves the Inhibition of Oxidative Stress and Proapoptotic Endoplasmic Reticulum Stress" Molecules 27, no. 22: 7859. https://doi.org/10.3390/molecules27227859
APA StyleEl-Magd, M. A., Zedan, A. M. G., Zidan, N. S., Sakran, M. I., Bahattab, O., Oyouni, A. A. A., Al-Amer, O. M., Alalawy, A. I., & Elmoslemany, A. M. (2022). Avocado Seeds-Mediated Alleviation of Cyclosporine A-Induced Hepatotoxicity Involves the Inhibition of Oxidative Stress and Proapoptotic Endoplasmic Reticulum Stress. Molecules, 27(22), 7859. https://doi.org/10.3390/molecules27227859

