Essential Oil from Pinus Koraiensis Pinecones Inhibits Gastric Cancer Cells via the HIPPO/YAP Signaling Pathway
Abstract
:1. Introduction
2. Results
2.1. Chemical Composition of Essential Oil
2.2. Anti-Tumor Activity of PEO In Vitro
2.2.1. Cell Cytotoxicity Activity In Vitro
2.2.2. Cell Migration Capacity Analysis
2.2.3. Cell Cycle Analysis
2.2.4. Cell Apoptosis Analysis
2.2.5. Analysis of Mitochondrial Membrane Potential
2.3. RNA Sequencing Analysis
2.3.1. Screening for Differentially Expressed Genes (DEGs)
2.3.2. Functional and Pathway Enrichment Analyses
2.3.3. Real-Time PCR Analysis
2.3.4. Western Blot Analysis
3. Discussion
4. Materials and Methods
4.1. Plant Materials and Oil Extraction
4.2. GC/MS Analysis
4.3. In Vitro Anti-Tumors Assay
4.3.1. Cytotoxicity Assay
4.3.2. Scratch Wound-Healing Assay
4.3.3. Cell Cycle Analysis
4.3.4. Apoptosis Analysis
4.3.5. Measurement of the Mitochondrial Membrane Potential (ΔΨm) with JC-1
4.4. The Mechanism of PEO on MGC-803 Cells
4.4.1. RNA Extraction and Sequencing
4.4.2. Differential Gene Expression Analysis
4.4.3. Gene Ontology (GO) and Pathway Analysis
4.4.4. Real-Time PCR Analysis
4.4.5. Western Blot Analysis
4.5. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Tan, P.; Yeoh, K.-G. Genetics and molecular pathogenesis of gastric adenocarcinoma. Gastroenterology 2015, 149, 1153–1162. [Google Scholar] [CrossRef] [PubMed]
- Qiao, Y.; Li, T.; Zheng, S.; Wang, H. The hippo pathway as a drug target in gastric cancer. Cancer Lett. 2018, 420, 14–25. [Google Scholar] [CrossRef] [PubMed]
- Kuo, C.-Y.; Chao, Y.; Li, C.-P. Update on treatment of gastric cancer. J. Chin. Med. Assoc. 2014, 77, 345–353. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jakubek, M.; Kejík, Z.; Kaplánek, R.; Hromádka, R.; Šandriková, V.; Sýkora, D.; Antonyová, V.; Urban, M.; Dytrych, P.; Mikula, I.; et al. Strategy for improved therapeutic efficiency of curcumin in the treatment of gastric cancer. Biomed. Pharmacother. 2019, 118, 109278. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Tang, H.; Zeng, X.; Ye, D.; Liu, J. Resveratrol inhibits proliferation, migration and invasion via Akt and ERK1/2 signaling pathways in renal cell carcinoma cells. Biomed. Pharmacother. 2018, 98, 36–44. [Google Scholar] [CrossRef] [PubMed]
- Qiu, J.; Zhang, H.; Wang, Z.; Liu, S.; Regenstein, J.M. Response surface methodology for the synthesis of an Auricularia auriculajudae polysaccharides-CDDP complex. Int. J. Biol. Macromol. 2016, 93, 333–343. [Google Scholar] [CrossRef]
- Nascimento, K.F.D.; Moreira, F.M.F.; Santos, J.A.; Kassuya, C.A.L.; Croda, J.H.R.; Cardoso, C.A.L.; Vieira, M.D.C.; Ruiz, A.L.T.G.; Foglio, M.A.; De Carvalho, J.E.; et al. Antioxidant, anti-inflammatory, antiproliferative and antimycobacterial activities of the essential oil of Psidium guineense Sw. and spathulenol. J. Ethnopharmacol. 2018, 210, 351–358. [Google Scholar] [CrossRef]
- Lang, M.; Ferron, P.-J.; Bursztyka, J.; Montjarret, A.; Duteil, E.; Bazire, A.; Bedoux, G. Evaluation of immunomodulatory activities of essential oils by high content analysis. J. Biotechnol. 2019, 303, 65–71. [Google Scholar] [CrossRef]
- Luo, W.; Du, Z.; Zheng, Y.; Liang, X.; Huang, G.; Zhang, Q.; Liu, Z.; Zhang, K.; Zheng, X.; Lin, L.; et al. Phytochemical composition and bioactivities of essential oils from six Lamiaceae species. Ind. Crop. Prod. 2019, 133, 357–364. [Google Scholar] [CrossRef]
- Ait Babahmad, R.; Aghraz, A.; Boutafda, A.; Papazoglou, E.G.; Tarantilis, P.A.; Kanakis, C.; Hafidi, M.; Ouhdouch, Y.; Outzourhit, A.; Ouhammou, A. Chemical composition of essential oil of Jatropha curcas, L. Leaves and its antioxidant and antimicrobial activities. Ind. Crop. Prod. 2018, 121, 405–410. [Google Scholar] [CrossRef]
- Sadekuzzaman, M.; Mizan, M.F.R.; Kim, H.-S.; Yang, S.; Ha, S.-D. Activity of thyme and tea tree essential oils against selected foodborne pathogens in biofilms on abiotic surfaces. LWT 2018, 89, 134–139. [Google Scholar] [CrossRef]
- Maurya, A.K.; Mohanty, S.; Pal, A.; Chanotiya, C.S.; Bawankule, D.U. The essential oil from Citrus limetta Risso peels alleviates skin inflammation: In-vitro and in-vivo study. J. Ethnopharmacol. 2018, 212, 86–94. [Google Scholar] [CrossRef] [PubMed]
- Elkady, W.M.; Ayoub, I.M. Chemical profiling and antiproliferative effect of essential oils of two Araucaria species cultivated in Egypt. Ind. Crop. Prod. 2018, 118, 188–195. [Google Scholar] [CrossRef]
- Pascual-Villalobos, M.; Cantó-Tejero, M.; Vallejo, R.; Guirao, P.; Rodríguez-Rojo, S.; Cocero, M. Use of nanoemulsions of plant essential oils as aphid repellents. Ind. Crop. Prod. 2017, 110, 45–57. [Google Scholar] [CrossRef]
- Yi, J.; Wang, Z.; Bai, H.; Yu, X.; Jing, J.; Zuo, L. Optimization of purification, identification and evaluation of the in vitro antitumor activity of polyphenols from Pinus koraiensis pinecones. Molecules 2015, 20, 10450–10467. [Google Scholar] [CrossRef]
- Yi, J.; Li, S.; Wang, C.; Cao, N.; Qu, H.; Cheng, C.; Wang, Z.; Wang, L.; Zhou, L. Potential applications of polyphenols on main ncRNAs regulations as novel therapeutic strategy for cancer. Biomed. Pharmacother. 2019, 113, 108703. [Google Scholar] [CrossRef]
- Yi, J.; Cheng, C.; Li, S.; Wang, D.; Wang, L.; Wang, Z. Preparation optimization and protective effect on 60Co-γ radiation damage of Pinus koraiensis pinecone polyphenols microspheres. Int. J. Biol. Macromol. 2018, 113, 583–591. [Google Scholar] [CrossRef]
- Lee, T.K.; Park, J.Y.; Yu, J.S.; Jang, T.S.; Oh, S.T.; Pang, C.; Ko, Y.-J.; Kang, K.S.; Kim, K.H. 7α,15-Dihydroxydehydroabietic acid from Pinus koraiensis inhibits the promotion of angiogenesis through downregulation of VEGF, p-Akt and p-ERK in HUVECs. Bioorg. Med. Chem. Lett. 2018, 28, 1084–1089. [Google Scholar] [CrossRef]
- Mitić, Z.S.; Jovanović, B.; Jovanović, S.; Mihajilov-Krstev, T.; Stojanović-Radić, Z.Z.; Cvetković, V.J.; Mitrović, T.L.; Marin, P.D.; Zlatković, B.K.; Stojanović, G.S. Comparative study of the essential oils of four Pinus species: Chemical composition, antimicrobial and insect larvicidal activity. Ind. Crop. Prod. 2018, 111, 55–62. [Google Scholar]
- Wu, Y.-P.; Liang, X.; Liu, X.-Y.; Zhong, K.; Gao, B.; Huang, Y.-N.; Gao, H. Cedrus deodara pine needle as a potential source of natural antioxidants: Bioactive constituents and antioxidant activities. J. Funct. Foods 2015, 14, 605–612. [Google Scholar] [CrossRef]
- Maugeri-Saccà, M.; De Maria, R. The Hippo pathway in normal development and cancer. Pharmacol. Therapeut. 2018, 186, 60–72. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Xu, X.; Maglic, D.; Dill, M.T.; Mojumdar, K.; Ng, P.K.-S.; Jeong, K.J.; Tsang, Y.H.; Moreno, D.; Bhavana, V.H.; et al. Comprehensive molecular characterization of the hippo signaling pathway in cancer. Cell Rep. 2018, 25, 1304–1317. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Huang, T.; Zhang, J.; Cheng, A.S.; Yu, J.; Kang, W.; To, K.F. Emerging roles of Hippo signaling in inflammation and YAP-driven tumor immunity. Cancer Lett. 2018, 426, 73–79. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Q.; Jia, X.; Zhang, Y.; Dong, Y.; Lei, Y.; Tan, X.; Williamson, R.A.; Wang, A.; Zhang, D.; Ma, J. Tetrandrine induces apoptosis in human neuroblastoma through regulating the Hippo/YAP signaling pathway. Biochem. Bioph. Res. Commun. 2019, 513, 846–851. [Google Scholar] [CrossRef] [PubMed]
- Wang, T.; Mao, B.; Cheng, C.; Zou, Z.; Gao, J.; Yang, Y.; Lei, T.; Qi, X.; Yuan, Z.; Xu, W.; et al. YAP promotes breast cancer metastasis by repressing growth differentiation factor-15. Biochim. Biophys. Acta Mol. Basis Dis. 2018, 1864, 1744–1753. [Google Scholar] [CrossRef] [PubMed]
- Yin, K.; Dang, S.; Cui, L.; Fan, X.; Wang, L.; Xie, R.; Qu, J.; Shang, M.; Chen, J.; Xu, Z. Netrin-1 promotes metastasis of gastric cancer by regulating YAP activity. Biochem. Bioph. Res. Commun. 2018, 496, 76–82. [Google Scholar] [CrossRef]
- Bhandari, K.B.; West, C.; Klein, D.; Subbiah, S.; Surowiec, K. Essential oil composition of ‘WW-B.Dahl’ old world bluestem (Bothriochloa bladhii) grown in the Texas High Plains. Ind. Crop. Prod. 2019, 133, 1–9. [Google Scholar] [CrossRef]
- Nirmal, N.P.; Mereddy, R.; Li, L.; Sultanbawa, Y. Formulation, characterisation and antibacterial activity of lemon myrtle and anise myrtle essential oil in water nanoemulsion. Food Chem. 2018, 254, 1–7. [Google Scholar] [CrossRef] [Green Version]
- Mitić, Z.S.; Jovanović, B.; Jovanović, S.Č.; Stojanović-Radić, Z.Z.; Mihajilov-Krstev, T.; Jovanović, N.M.; Nikolić, B.M.; Marin, P.D.; Zlatković, B.K.; Stojanović, G.S. Essential oils of Pinus halepensis and P. heldreichii: Chemical composition, antimicrobial and insect larvicidal activity. Ind. Crop. Prod. 2019, 140, 111702. [Google Scholar] [CrossRef]
- Ray, A.; Jena, S.; Dash, B.; Kar, B.; Halder, T.; Chatterjee, T.; Ghosh, B.; Panda, P.C.; Nayak, S.; Mahapatra, N. Chemical diversity, antioxidant and antimicrobial activities of the essential oils from Indian populations of Hedychium coronarium Koen. Ind. Crop. Prod. 2018, 112, 353–362. [Google Scholar] [CrossRef]
- Tao, Y.; Song, Y.; Han, T.; Wang, C.; Zhao, T.; Gu, Y. miR-205 Regulation of ICT1 has an oncogenic potential via promoting the migration and invasion of gastric cancer cells. Biomed. Pharmacother. 2017, 96, 191–197. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Chen, S.; Wei, C.; Rankin, G.O.; Ye, X.; Chen, Y.C. Flavonoids from Chinese bayberry leaves induced apoptosis and G1 cell cycle arrest via Erk pathway in ovarian cancer cells. Eur. J. Med. Chem. 2018, 147, 218–226. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Azevedo-Barbosa, H.; Ferreira-Silva, G.Á.; Silva, C.F.; De Souza, T.B.; Dias, D.F.; De Paula, A.C.C.; Ionta, M.; Carvalho, D.T. Phenylpropanoid-based sulfonamide promotes cyclin D1 and cyclin E down-regulation and induces cell cycle arrest at G1/S transition in estrogen positive MCF-7 cell line. Toxicol. In Vitro 2019, 59, 150–160. [Google Scholar] [CrossRef] [PubMed]
- Sadeghi, S.; Davoodvandi, A.; Pourhanifeh, M.H.; Sharifi, N.; Arefnezhad, R.; Sahebnasagh, R.; Moghadam, S.A.; Sahebkar, A.; Mirzaei, H. Anti-cancer effects of cinnamon: Insights into its apoptosis effects. Eur. J. Med. Chem. 2019, 178, 131–140. [Google Scholar] [CrossRef] [PubMed]
- Quassinti, L.; Maggi, F.; Ortolani, F.; Lupidi, G.; Petrelli, D.; Vitali, L.A.; Miano, A.; Bramucci, M. Exploring new applications of tulip tree (Liriodendron tulipifera L.): Leaf essential oil as apoptotic agent for human glioblastoma. Environ. Sci. Pollut. Res. 2019, 1–13. [Google Scholar] [CrossRef]
- Chen, W.; Wang, H.; Liu, Y.; Xu, W.; Ling, C.; Li, Y.; Liu, J.; Chen, M.; Zhang, Y.; Chen, B.; et al. Linc-RoR promotes proliferation, migration, and invasion via the Hippo/YAP pathway in pancreatic cancer cells. J. Cell. Biochem. 2019. [Google Scholar] [CrossRef]
- Raut, J.S.; Karuppayil, S.M. A status review on the medicinal properties of essential oils. Ind. Crop. Prod. 2014, 62, 250–264. [Google Scholar] [CrossRef]
- Ribeiro-Santos, R.; Andrade, M.; De Melo, N.R.; Sanches-Silva, A. Use of essential oils in active food packaging: Recent advances and future trends. Trends Food Sci. Technol. 2017, 61, 132–140. [Google Scholar] [CrossRef]
- Pavela, R.; Benelli, G. Essential oils as ecofriendly biopesticides? Challenges and constraints. Trends Plant. Sci. 2016, 21, 1000–1007. [Google Scholar] [CrossRef]
- Mohagheghniapour, A.; Saharkhiz, M.J.; Golmakani, M.T.; Niakousari, M. Variations in chemical compositions of essential oil from sour orange (Citrus aurantium L.) blossoms by different isolation methods. Sustain. Chem. Pharm. 2018, 10, 118–124. [Google Scholar] [CrossRef]
- Galdino, P.M.; Nascimento, M.V.M.; Florentino, I.F.; Lino, R.C.; Fajemiroye, J.O.; Chaibub, B.A.; De Paula, J.R.; De Lima, T.C.M.; Costa, E.A. The anxiolytic-like effect of an essential oil derived from Spiranthera odoratissima A. St. Hil. leaves and its major component, β-caryophyllene, in male mice. Prog. Neuropsychopharmacol. Biol. Psychiatry 2012, 38, 276–284. [Google Scholar] [CrossRef] [PubMed]
- Yi, F.; Sun, J.; Bao, X.; Ma, B.; Sun, M. Influence of molecular distillation on antioxidant and antimicrobial activities of rose essential oils. LWT 2019, 102, 310–316. [Google Scholar] [CrossRef]
- Chen, J.; Lu, M.; Jing, Y.; Dong, J. The synthesis of l-carvone and limonene derivatives with increased antiproliferative effect and activation of ERK pathway in prostate cancer cells. Bioorg. Med. Chem. 2006, 14, 6539–6547. [Google Scholar] [CrossRef] [PubMed]
- El-Abid, H.; Amaral, C.; Cunha, S.C.; Augusto, T.V.; Fernandes, J.O.; Correia-Da-Silva, G.; Teixeira, N.; Moumni, M. Chemical composition and anti-cancer properties of Juniperus oxycedrus L. essential oils on estrogen receptor-positive breast cancer cells. J. Funct. Foods 2019, 59, 261–271. [Google Scholar] [CrossRef]
- Chen, W.; Liu, Y.; Li, M.; Mao, J.; Zhang, L.; Huang, R.; Jin, X.; Ye, L. Anti-tumor effect of α-pinene on human hepatoma cell lines through inducing G2/M cell cycle arrest. J. Pharmacol. Sci. 2015, 127, 332–338. [Google Scholar] [CrossRef]
- Vandresen, F.; Falzirolli, H.; Almeida Batista, S.A.; Da Silva-Giardini, A.P.B.; de Oliveira, D.N.; Catharino, R.R.; Ruiz, A.L.T.G.; de Carvalho, J.E.; Foglio, M.A.; Da Silva, C.C. Novel R-(+)-limonene-based thiosemicarbazones and their antitumor activity against human tumor cell lines. Eur. J. Med. Chem. 2014, 79, 110–116. [Google Scholar] [CrossRef]
- Bouyahya, A.; Belmehdi, O.; El Jemli, M.; Marmouzi, I.; Bourais, I.; Abrini, J.; Faouzi, M.E.A.; Dakka, N.; Bakri, Y. Chemical variability of Centaurium erythraea essential oils at three developmental stages and investigation of their in vitro antioxidant, antidiabetic, dermatoprotective and antibacterial activities. Ind. Crop. Prod. 2019, 132, 111–117. [Google Scholar] [CrossRef]
- Zhang, J.; Huang, R.-Z.; Cao, H.-J.; Cheng, A.-W.; Jiang, C.-S.; Liao, Z.-X.; Liu, C.; Sun, J.-Y. Chemical composition, in vitro anti-tumor activities and related mechanisms of the essential oil from the roots of Potentilla discolor. Ind. Crop. Prod. 2018, 113, 19–27. [Google Scholar] [CrossRef]
- Poma, P.; Labbozzetta, M.; McCubrey, J.A.; Ramarosandratana, A.V.; Sajeva, M.; Zito, P.; Notarbartolo, M. Antitumor Mechanism of the Essential Oils from Two Succulent Plants in Multidrug Resistance Leukemia Cell. Pharmaceuticals 2019, 12, 124. [Google Scholar] [CrossRef]
- Wang, R.; Li, J.; Zhao, Y.; Li, Y.; Yin, L. Investigating the therapeutic potential and mechanism of curcumin in breast cancer based on RNA sequencing and bioinformatics analysis. Breast Cancer-Tokyo 2018, 25, 206–212. [Google Scholar] [CrossRef]
- Zhao, X.; Liu, Z.; Liu, Z.; Meng, R.; Shi, C.; Chen, X.; Bu, X.; Guo, N. Phenotype and RNA-seq-Based transcriptome profiling of Staphylococcus aureus biofilms in response to tea tree oil. Microb. Pathog. 2018, 123, 304–313. [Google Scholar] [CrossRef] [PubMed]
- Yu, H.-X.; Yao, Y.; Bu, F.-T.; Chen, Y.; Wu, Y.-T.; Yang, Y.; Chen, X.; Zhu, Y.; Wang, Q.; Pan, X.-Y.; et al. Blockade of YAP alleviates hepatic fibrosis through accelerating apoptosis and reversion of activated hepatic stellate cells. Mol. Immunol. 2019, 107, 29–40. [Google Scholar] [CrossRef] [PubMed]
- Bi, L.; Ma, F.; Tian, R.; Zhou, Y.; Lan, W.; Song, Q.; Cheng, X. AJUBA increases the cisplatin resistance through hippo pathway in cervical cancer. Gene 2018, 644, 148–154. [Google Scholar] [CrossRef]
- Plouffe, S.W.; Hong, A.W.; Guan, K.-L. Disease implications of the Hippo/YAP pathway. Trends Mol. Med. 2015, 21, 212–222. [Google Scholar] [CrossRef] [PubMed]
- Das Thakur, M.; Feng, Y.; Jagannathan, R.; Seppa, M.J.; Skeath, J.B.; Longmore, G.D. Ajuba LIM proteins are negative regulators of the Hippo signaling pathway. Curr. Biol. 2010, 20, 657–662. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Fu, L.; Liu, B.; Lin, X.; Dong, Q.; Wang, E. Ajuba overexpression regulates mitochondrial potential and glucose uptake through YAP/Bcl-xL/GLUT1 in human gastric cancer. Gene 2019, 693, 16–24. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Chen, Y.; An, T.; Liu, P.; Zhu, J.; Yang, H.; Zhang, W.; Dong, T.; Jiang, J.; Zhang, Y.; et al. Nuciferine inhibits the progression of glioblastoma by suppressing the SOX2-AKT/STAT3-Slug signaling pathway. J. Exp. Clin. Canc. Res. 2019, 38, 139. [Google Scholar] [CrossRef] [PubMed]
- Geng, P.-F.; Wang, C.-C.; Li, Z.-H.; Hu, X.-N.; Zhao, T.-Q.; Fu, D.-J.; Zhao, B.; Yu, B.; Liu, H.-M. Design, synthesis and preliminary biological evaluation of 5,8-dihydropteridine-6,7-diones that induce apoptosis and suppress cell migration. Eur. J. Med. Chem. 2018, 143, 1959–1967. [Google Scholar] [CrossRef]
- Fu, D.-J.; Song, J.; Hou, Y.-H.; Zhao, R.-H.; Li, J.-H.; Mao, R.-W.; Yang, J.-J.; Li, P.; Zi, X.-L.; Li, Z.-H.; et al. Discovery of 5,6-diaryl-1,2,4-triazines hybrids as potential apoptosis inducers. Eur. J. Med. Chem. 2017, 138, 1076–1088. [Google Scholar] [CrossRef]
Sample Availability: Samples of the compounds are not available from the authors. |
No. | Compounds | RI a | RI b | % |
---|---|---|---|---|
1 | Santene | 882 | 884 | 0.06 |
2 | Tricyclene | 918 | 919 | 0.11 |
3 | Bicyclo [3.1.0]hexane, 4-methyl-1-(1-methylethyl)-didehydro deriv. | 926 | — | 0.11 |
4 | α-Pinene | 934 | 934 | 40.91 |
5 | Camphene | 944 | 945 | 1.08 |
6 | Cosmene | 968 | — | 0.07 |
7 | β-Pinene | 973 | 972 | 7.04 |
8 | β-Myrcene | 992 | 992 | 2.04 |
9 | 3-Carene | 1008 | 1007 | 4.12 |
10 | Limonene | 1030 | 1031 | 24.82 |
11 | Bicyclo [3.1.0]hexane, 6-isopropylidene-1-methyl- | 1088 | — | 0.24 |
12 | L-trans-Pinocarveol | 1138 | 1140 | 0.58 |
13 | L-camphor | 1142 | 1142 | 0.35 |
14 | cis-Verbenol | 1145 | 1137 | 0.24 |
15 | Pinocarvone | 1161 | 1162 | 0.13 |
16 | Borneol | 1166 | 1160 | 0.64 |
17 | 3-Pinanone | 1173 | — | 0.15 |
18 | 4-Terpineol | 1178 | 1177 | 0.59 |
19 | p-menth-1-en-8-ol | 1193 | 1192 | 1.41 |
20 | Myrtenol | 1197 | 1195 | 0.80 |
21 | Verbenone | 1209 | 1205 | 0.58 |
22 | L-α-bornyl acetate | 1285 | 1287 | 0.92 |
23 | α-Longipinene | 1349 | 1350 | 0.55 |
24 | Copaene | 1375 | 1375 | 0.57 |
25 | D-longifolene | 1404 | 1405 | 0.59 |
26 | β-Caryophyllen | 1419 | 1420 | 2.57 |
27 | α-Caryophyllen | 1454 | 1452 | 0.43 |
28 | γ-Muurolene | 1477 | 1478 | 0.06 |
29 | Germacrene D | 1482 | 1484 | 0.11 |
30 | α-Muurolene | 1501 | 1502 | 0.26 |
31 | α-Himachalene | 1510 | 1500 | 0.07 |
32 | (+)-δ-Cadinene | 1523 | 1526 | 0.29 |
33 | Caryophyllene oxide | 1583 | 1585 | 1.48 |
34 | α-Humulene oxide II | 1610 | 1608 | 0.12 |
35 | Pentyl cinnamate | 1760 | — | 0.27 |
36 | Cembrene | 1941 | 1944 | 0.06 |
37 | 1-Heptatriacotanol | 1956 | — | 0.02 |
38 | 4b,8-Dimethyl-2-isopropylphenanthrene, 4b,5,6,7,8,8a,9,10-octahydro- | 1995 | — | 0.48 |
39 | Manoyl oxide | 2009 | — | 0.17 |
40 | 7-Isopropyl-1,1,4a-trimethyl-1,2,3,4,4a,9,10,10a-octahydrophenanthrene | 2079 | — | 0.34 |
41 | 1-Phenanthrenecarboxaldehyde, 1,2,3,4,4a,9,10,10a-octahydro-1,4a-dimethyl-7-(1-methylethyl)-, [1R-(1. α, 4a.β,10a.α)]- | 2316 | — | 0.30 |
Total | 95.73 |
Rank | Gene Name | Gene Feature | log2fc | Fold Change | p-Value |
---|---|---|---|---|---|
1 | SLC7A11 | Up-regulated | 2.35 | 5.10 | 3.50 × 10−6 |
2 | A2M | Down-regulated | −1.14 | 0.45 | 2.40 × 10−5 |
3 | ALPP | Down-regulated | −1.36 | 0.39 | 2.71 × 10−5 |
4 | HTRA3 | Up-regulated | 1.76 | 3.38 | 4.11 × 10−5 |
5 | AKR1C2 | Up-regulated | 1.71 | 3.27 | 9.99 × 10−5 |
6 | AKR1C1 | Up-regulated | 2.59 | 6.04 | 1.32 × 10−4 |
7 | HMOX1 | Up-regulated | 2.08 | 4.24 | 2.76 × 10−4 |
8 | AC069257.3 | Down-regulated | −1.11 | 0.46 | 6.14 × 10−4 |
9 | ALPI | Down-regulated | −1.24 | 0.42 | 9.15 × 10−4 |
10 | CA9 | Down-regulated | −1.06 | 0.48 | 3.71 × 10−3 |
Gene | Bidirectional Primer Sequence |
---|---|
GAPDH (HUMAN) | F:5′ GGGAAACTGTGGCGTGAT 3’ R:5′ GAGTGGGTGTCGCTGTTGA 3’ |
LATS2 | F:5’ TGGTGGAGTGTTGGAGTGAT 3’ R:5′ AGCGTGTTCTCCCAGTTGAT 3’ |
YAP1 | F:5’ GCCAGCAGGTTGGGAGAT 3’ R:5′TGTGATTTAAGAAGTATCTCTGACC 3’ |
AJUBA | F:5’ TGTCACCGACTACCACAAA 3’ R:5′ ATCACCCTCACGATGTCC 3’ |
FAT4 | F:5’ ATTTAGGACCAGAAGCGAGAA 3’ R:5′ CTCTCCACTTTCCCAGCAA 3’ |
STK3 | F:5’ TCAAGAATGCCAAACCTGTA 3’ R:5′ GGATTCCAACATCGTGCTA 3’ |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, Y.; Xin, C.; Qiu, J.; Wang, Z. Essential Oil from Pinus Koraiensis Pinecones Inhibits Gastric Cancer Cells via the HIPPO/YAP Signaling Pathway. Molecules 2019, 24, 3851. https://doi.org/10.3390/molecules24213851
Zhang Y, Xin C, Qiu J, Wang Z. Essential Oil from Pinus Koraiensis Pinecones Inhibits Gastric Cancer Cells via the HIPPO/YAP Signaling Pathway. Molecules. 2019; 24(21):3851. https://doi.org/10.3390/molecules24213851
Chicago/Turabian StyleZhang, Yandong, Chao Xin, Junqiang Qiu, and Zhenyu Wang. 2019. "Essential Oil from Pinus Koraiensis Pinecones Inhibits Gastric Cancer Cells via the HIPPO/YAP Signaling Pathway" Molecules 24, no. 21: 3851. https://doi.org/10.3390/molecules24213851