Sign in to use this feature.

Years

Between: -

Subjects

remove_circle_outline
remove_circle_outline
remove_circle_outline
remove_circle_outline
remove_circle_outline
remove_circle_outline

Journals

Article Types

Countries / Regions

Search Results (26)

Search Parameters:
Keywords = 11-mer aptamer

Order results
Result details
Results per page
Select all
Export citation of selected articles as:
17 pages, 2133 KiB  
Article
A Truncated Multi-Thiol Aptamer-Based SARS-CoV-2 Electrochemical Biosensor: Towards Variant-Specific Point-of-Care Detection with Optimized Fabrication
by Sergio Roberto Molina Ramirez, Nafiseh Samiseresht, Mateo Alejandro Martínez-Roque, Ferdinando Catania, Kevin Graef, Martin Rabe, Andreas Offenhäusser, Dirk Mayer and Gabriela Figueroa-Miranda
Biosensors 2025, 15(1), 24; https://doi.org/10.3390/bios15010024 - 6 Jan 2025
Cited by 1 | Viewed by 2128
Abstract
With the goal of fast and accurate diagnosis of infectious diseases, this study presents a novel electrochemical biosensor that employs a refined aptamer (C9t) for the detection of spike (S) protein SARS-CoV-2 variants in a flexible multielectrode aptasensor array with PoC capabilities. Two [...] Read more.
With the goal of fast and accurate diagnosis of infectious diseases, this study presents a novel electrochemical biosensor that employs a refined aptamer (C9t) for the detection of spike (S) protein SARS-CoV-2 variants in a flexible multielectrode aptasensor array with PoC capabilities. Two aptamer modifications were employed: removing the primer binding sites and including two dithiol phosphoramidite anchor molecules. Thus, reducing fabrication time from 24 to 3 h and increasing the stability and sparseness for multi-thiol aptasensors compared to a standard aptasensor using single thiols, without a reduction in aptamer density. The biosensor fabrication, optimization, and detection were verified in detail by electrochemistry, QCM-D, SPR, and XPS. The analyte–receptor binding was further confirmed spectroscopically at the level of individual molecules by AFM-IR. The aptasensor possesses a low limit of detection (8.0 fg/mL), the highest sensitivity reported for S protein (209.5 signal per concentration decade), and a wide dynamic detection range (8.0 fg/mL–38 ng/mL) in nasopharyngeal samples, covering the clinically relevant range. Furthermore, the C9t aptasensor showed high selectivity for SARS-CoV-2 S proteins over biomarkers for MERS-CoV, RSV, and Influenza. Even more, it showed a three times higher sensitivity for the Omicron in comparison to the Wuhan strain (wild type), alpha, and beta variants of the SARS-CoV-2 virus. Those results demonstrate the creation of an affordable and variant-selective refined C9t aptasensor that outperformed current rapid diagnosis tests. Full article
Show Figures

Graphical abstract

14 pages, 4051 KiB  
Communication
Towards Aptamer-Targeted Drug Delivery to Brain Tumors: The Synthesis of Ramified Conjugates of an EGFR-Specific Aptamer with MMAE on a Cathepsin B-Cleavable Linker
by Vladimir A. Brylev, Ekaterina V. Ryabukhina, Ekaterina V. Nazarova, Nadezhda S. Samoylenkova, Evgeny L. Gulyak, Ksenia A. Sapozhnikova, Fatima M. Dzarieva, Alexey V. Ustinov, Igor N. Pronin, Dmitry Y. Usachev, Alexey M. Kopylov, Andrey V. Golovin, Galina V. Pavlova, Dmitry Yu. Ryazantsev and Vladimir A. Korshun
Pharmaceutics 2024, 16(11), 1434; https://doi.org/10.3390/pharmaceutics16111434 - 11 Nov 2024
Viewed by 1994
Abstract
Background/Objectives: Targeted delivery of chemotherapeutic agents is a well-established approach to cancer therapy. Antibody–drug conjugates (ADCs) typically carry toxic payloads attached to a tumor-associated antigen-targeting IgG antibody via an enzyme-cleavable linker that releases the drug inside the cell. Aptamers are a promising alternative [...] Read more.
Background/Objectives: Targeted delivery of chemotherapeutic agents is a well-established approach to cancer therapy. Antibody–drug conjugates (ADCs) typically carry toxic payloads attached to a tumor-associated antigen-targeting IgG antibody via an enzyme-cleavable linker that releases the drug inside the cell. Aptamers are a promising alternative to antibodies in terms of antigen targeting; however, their polynucleotide nature and smaller size result in a completely different PK/PD profile compared to an IgG. This may prove advantageous: owing to their lower molecular weight, aptamer-drug conjugates may achieve better penetration of solid tumors compared to ADCs. Methods: On the way to therapeutic aptamer–drug conjugates, we aimed to develop a versatile and modular approach for the assembly of aptamer–enzymatically cleavable payload conjugates of various drug–aptamer ratios. We chose the epidermal growth factor receptor (EGFR), a transmembrane protein often overexpressed in brain tumors, as the target antigen. We used the 46 mer EGFR-targeting DNA sequence GR-20, monomethylauristatin E (MMAE) on the cathepsin-cleavable ValCit-p-aminobenzylcarbamate linker as the payload, and pentaerythritol-based tetraazide as the branching point for the straightforward synthesis of aptamer–drug conjugates by means of a stepwise Cu-catalyzed azide–alkyne cycloaddition (CuAAC) click reaction. Results: Branched aptamer conjugates of 1:3, 2:2, and 3:1 stoichiometry were synthesized and showed higher cytotoxic activity compared to a 1:1 conjugate, particularly on several glioma cell lines. Conclusions: This approach is convenient and potentially applicable to any aptamer sequence, as well as other payloads and cleavable linkers, thus paving the way for future development of aptamer–drug therapeutics by easily providing a range of branched conjugates for in vitro and in vivo testing. Full article
Show Figures

Figure 1

19 pages, 3449 KiB  
Article
Enhancing Electrochemical Biosensor Performance for 17β-Estradiol Determination with Short Split—Aptamers
by Normazida Rozi, Sharina Abu Hanifah, Nurul Huda Abd Karim, Lee Yook Heng, Sayuri L. Higashi and Masato Ikeda
Biosensors 2022, 12(12), 1077; https://doi.org/10.3390/bios12121077 - 25 Nov 2022
Cited by 7 | Viewed by 2623
Abstract
Chronic exposure of 17β-estradiol (E2) even at low concentration can disorganize the endocrine system and lead to undesirable health problems in the long run. An electrochemical biosensor for rapid detection of E2 in water samples was successfully developed. The biosensor was based on [...] Read more.
Chronic exposure of 17β-estradiol (E2) even at low concentration can disorganize the endocrine system and lead to undesirable health problems in the long run. An electrochemical biosensor for rapid detection of E2 in water samples was successfully developed. The biosensor was based on split DNA aptamers attached onto poly (methacrylic acid-co-n butyl acrylate-succinimide) microspheres deposited on polypyrrole nanowires coated electrode (PPY/PMAA-NBA). The sandwich paired of split DNA aptamers used were truncated from 75 mer parent aptamers. These two strands of 12-mer and 14-mer split DNA aptamers were then immobilized on the PMAA-NBA microspheres. In the presence of E2, the split DNA aptamers formed an apt12-E2-apt14 complex, where the binding reaction on the electrode surface led to the detection of E2 by differential pulse voltammetry using ferrocyanide as a redox indicator. Under optimum conditions, the aptasensor detected E2 concentrations in the range of 1 × 10−4 M to 1 × 10−12 M (R2 = 0.9772) with a detection limit of 4.8 × 10−13 M. E2, which were successfully measured in a real sample with 97–104% recovery and showed a good correlation (R2 = 0.9999) with the established method, such as high-performance liquid chromatography. Interactions between short and sandwich-type aptamers (split aptamers) demonstrated improvement in aptasensor performance, especially the selectivity towards several potential interferents. Full article
(This article belongs to the Special Issue Recent Progress in DNA Nanostructure-Based Electrochemical Biosensors)
Show Figures

Figure 1

9 pages, 2635 KiB  
Article
Using the Intrinsic Fluorescence of DNA to Characterize Aptamer Binding
by Chang Lu, Anand Lopez, Jinkai Zheng and Juewen Liu
Molecules 2022, 27(22), 7809; https://doi.org/10.3390/molecules27227809 - 12 Nov 2022
Cited by 6 | Viewed by 3302
Abstract
The reliable, readily accessible and label-free measurement of aptamer binding remains a challenge in the field. Recent reports have shown large changes in the intrinsic fluorescence of DNA upon the formation of G-quadruplex and i-motif structures. In this work, we examined whether DNA [...] Read more.
The reliable, readily accessible and label-free measurement of aptamer binding remains a challenge in the field. Recent reports have shown large changes in the intrinsic fluorescence of DNA upon the formation of G-quadruplex and i-motif structures. In this work, we examined whether DNA intrinsic fluorescence can be used for studying aptamer binding. First, DNA hybridization resulted in a drop in the fluorescence, which was observed for A30/T30 and a 24-mer random DNA sequence. Next, a series of DNA aptamers were studied. Cortisol and Hg2+ induced fluorescence increases for their respective aptamers. For the cortisol aptamer, the length of the terminal stem needs to be short to produce a fluorescence change. However, caffeine and adenosine failed to produce a fluorescence change, regardless of the stem length. Overall, using the intrinsic fluorescence of DNA may be a reliable and accessible method to study a limited number of aptamers that can produce fluorescence changes. Full article
Show Figures

Figure 1

10 pages, 3023 KiB  
Article
A Sensitive Aptamer Fluorescence Anisotropy Sensor for Cd2+ Using Affinity-Enhanced Aptamers with Phosphorothioate Modification
by Hao Yu and Qiang Zhao
Biosensors 2022, 12(10), 887; https://doi.org/10.3390/bios12100887 - 17 Oct 2022
Cited by 11 | Viewed by 3110
Abstract
Rapid and sensitive detection of heavy metal cadmium ions (Cd2+) is of great significance to food safety and environmental monitoring, as Cd2+ contamination and exposure cause serious health risk. In this study we demonstrated an aptamer-based fluorescence anisotropy (FA) sensor [...] Read more.
Rapid and sensitive detection of heavy metal cadmium ions (Cd2+) is of great significance to food safety and environmental monitoring, as Cd2+ contamination and exposure cause serious health risk. In this study we demonstrated an aptamer-based fluorescence anisotropy (FA) sensor for Cd2+ with a single tetramethylrhodamine (TMR)-labeled 15-mer Cd2+ binding aptamer (CBA15), integrating the strengths of aptamers as affinity recognition elements for preparation, stability, and modification, and the advantages of FA for signaling in terms of sensitivity, simplicity, reproducibility, and high throughput. In this sensor, the Cd2+-binding-induced aptamer structure change provoked significant alteration of FA responses. To acquire better sensing performance, we further introduced single phosphorothioate (PS) modification of CBA15 at a specific phosphate backbone position, to enhance aptamer affinity by possible strong interaction between sulfur and Cd2+. The aptamer with PS modification at the third guanine (G) nucleotide (CBA15-G3S) had four times higher affinity than CBA15. Using as an aptamer probe CBA15-G3S with a TMR label at the 12th T, we achieved sensitive selective FA detection of Cd2+, with a detection limit of 6.1 nM Cd2+. This aptamer-based FA sensor works in a direct format for detection without need for labeling Cd2+, overcoming the limitations of traditional competitive immuno-FA assay using antibodies and fluorescently labeled Cd2+. This FA method enabled the detection of Cd2+ in real water samples, showing broad application potential. Full article
(This article belongs to the Special Issue Label-Free Biosensor)
Show Figures

Figure 1

23 pages, 4600 KiB  
Article
Truncated Analogues of a G-Quadruplex-Forming Aptamer Targeting Mutant Huntingtin: Shorter Is Better!
by Claudia Riccardi, Federica D’Aria, Dominga Fasano, Filomena Anna Digilio, Maria Rosaria Carillo, Jussara Amato, Laura De Rosa, Simona Paladino, Mariarosa Anna Beatrice Melone, Daniela Montesarchio and Concetta Giancola
Int. J. Mol. Sci. 2022, 23(20), 12412; https://doi.org/10.3390/ijms232012412 - 17 Oct 2022
Cited by 8 | Viewed by 2464
Abstract
Two analogues of the MS3 aptamer, which was previously shown to have an exquisite capability to selectively bind and modulate the activity of mutant huntingtin (mHTT), have been here designed and evaluated in their physicochemical and biological properties. Featured by a distinctive propensity [...] Read more.
Two analogues of the MS3 aptamer, which was previously shown to have an exquisite capability to selectively bind and modulate the activity of mutant huntingtin (mHTT), have been here designed and evaluated in their physicochemical and biological properties. Featured by a distinctive propensity to form complex G-quadruplex structures, including large multimeric aggregates, the original 36-mer MS3 has been truncated to give a 33-mer (here named MS3-33) and a 17-mer (here named MS3-17). A combined use of different techniques (UV, CD, DSC, gel electrophoresis) allowed a detailed physicochemical characterization of these novel G-quadruplex-forming aptamers, tested in vitro on SH-SY5Y cells and in vivo on a Drosophila Huntington’s disease model, in which these shorter MS3-derived oligonucleotides proved to have improved bioactivity in comparison with the parent aptamer. Full article
Show Figures

Figure 1

14 pages, 1714 KiB  
Article
Aptamer against Aflatoxin B1 Obtained by SELEX and Applied in Detection
by Chung-Hsuan Yang and Ching-Hsiu Tsai
Biosensors 2022, 12(10), 848; https://doi.org/10.3390/bios12100848 - 9 Oct 2022
Cited by 13 | Viewed by 3090
Abstract
Aflatoxins, especially aflatoxin B1 (AFB1), are the most prevalent mycotoxins in nature. They contaminate various crops and cause global food and feed safety concerns. Therefore, a simple, rapid, sensitive, and specific AFB1 detection tool is urgently needed. Aptamers generated by SELEX technology can [...] Read more.
Aflatoxins, especially aflatoxin B1 (AFB1), are the most prevalent mycotoxins in nature. They contaminate various crops and cause global food and feed safety concerns. Therefore, a simple, rapid, sensitive, and specific AFB1 detection tool is urgently needed. Aptamers generated by SELEX technology can specifically bind the desired targets with high affinity. The broad range of targets expands the scope of applications for aptamers. We used an AFB1-immobilized magnetic nanoparticle for SELEX to select AFB1-specific aptamers. One aptamer, fl−2CS1, revealed a dissociation constant (Kd = 2.5 μM) with AFB1 determined by isothermal titration calorimetry. Furthermore, no interaction was shown with other toxins (AFB2, AFG1, AFG2, OTA, and FB1). According to structural prediction and analysis, we identified a short version of the AFB1-specific aptamer, fl−2CS1/core, with a minimum length of 39-mer used in the AFB1-aptasensor system by real-time qPCR. The aptasensor showed a broad range of detection from 50 ppt to 50 ppb with an accuracy of 90% in the spiked peanut extract samples. With the application of the AFB1-aptasensor we have constructed, a wide range detection tool with high accuracy might be developed as a point-of-care testing tool in agriculture. Full article
(This article belongs to the Section Environmental Biosensors and Biosensing)
Show Figures

Figure 1

12 pages, 2919 KiB  
Communication
Effect of DNA Aptamer Concentration on the Conductivity of a Water-Gated Al:ZnO Thin-Film Transistor-Based Biosensor
by Andrejs Ogurcovs, Kevon Kadiwala, Eriks Sledevskis, Marina Krasovska, Ilona Plaksenkova and Edgars Butanovs
Sensors 2022, 22(9), 3408; https://doi.org/10.3390/s22093408 - 29 Apr 2022
Cited by 8 | Viewed by 2908
Abstract
Field-effect transistor-based biosensors (bio-FETs) are promising candidates for the rapid high-sensitivity and high-selectivity sensing of various analytes in healthcare, clinical diagnostics, and the food industry. However, bio-FETs still have several unresolved problems that hinder their technological transfer, such as electrical stability. Therefore, it [...] Read more.
Field-effect transistor-based biosensors (bio-FETs) are promising candidates for the rapid high-sensitivity and high-selectivity sensing of various analytes in healthcare, clinical diagnostics, and the food industry. However, bio-FETs still have several unresolved problems that hinder their technological transfer, such as electrical stability. Therefore, it is important to develop reliable, efficient devices and establish facile electrochemical characterization methods. In this work, we have fabricated a flexible biosensor based on an Al:ZnO thin-film transistor (TFT) gated through an aqueous electrolyte on a polyimide substrate. In addition, we demonstrated techniques for establishing the operating range of such devices. The Al:ZnO-based devices with a channel length/width ratio of 12.35 and a channel thickness of 50 nm were produced at room temperature via magnetron sputtering. These Al:ZnO-based devices exhibited high field-effect mobility (μ = 6.85 cm2/Vs) and threshold voltage (Vth = 654 mV), thus showing promise for application on temperature-sensitive substrates. X-ray photoelectron spectroscopy was used to verify the chemical composition of the deposited films, while the morphological aspects of the films were assessed using scanning electron and atomic force microscopies. The gate–channel electric capacitance of 40 nF/cm2 was determined using electrochemical impedance spectroscopy, while the electrochemical window of the gate–channel system was determined as 1.8 V (from −0.6 V to +1.2 V) using cyclic voltammetry. A deionized water solution of 10 mer (CCC AAG GTC C) DNA aptamer (molar weight −2972.9 g/mol) in a concentration ranging from 1–1000 pM/μL was used as an analyte. An increase in aptamer concentration caused a proportional decrease in the TFT channel conductivity. The techniques demonstrated in this work can be applied to optimize the operating parameters of various semiconductor materials in order to create a universal detection platform for biosensing applications, such as multi-element FET sensor arrays based on various composition nanostructured films, which use advanced neural network signal processing. Full article
(This article belongs to the Section Biosensors)
Show Figures

Figure 1

11 pages, 1862 KiB  
Article
Comparison of Duplex and Quadruplex Folding Structure Adenosine Aptamers for Carbon Nanotube Field Effect Transistor Aptasensors
by Hong Phan T. Nguyen, Thanihaichelvan Murugathas and Natalie O. V. Plank
Nanomaterials 2021, 11(9), 2280; https://doi.org/10.3390/nano11092280 - 2 Sep 2021
Cited by 9 | Viewed by 2923
Abstract
Carbon nanotube field effect transistor (CNT FET) aptasensors have been investigated for the detection of adenosine using two different aptamer sequences, a 35-mer and a 27-mer. We found limits of detection for adenosine of 100 pM and 320 nM for the 35-mer and [...] Read more.
Carbon nanotube field effect transistor (CNT FET) aptasensors have been investigated for the detection of adenosine using two different aptamer sequences, a 35-mer and a 27-mer. We found limits of detection for adenosine of 100 pM and 320 nM for the 35-mer and 27-mer aptamers, with dissociation constants of 1.2 nM and 160 nM, respectively. Upon analyte recognition the 35-mer adenosine aptamer adopts a compact G-quadruplex structure while the 27-mer adenosine aptamer changes to a folded duplex. Using the CNT FET aptasensor platform adenosine could be detected with high sensitivity over the range of 100 pM to 10 µM, highlighting the suitability of the CNT FET aptasensor platform for high performance adenosine detection. The aptamer restructuring format is critical for high sensitivity with the G-quadraplex aptasensor having a 130-fold smaller dissociation constant than the duplex forming aptasensor. Full article
(This article belongs to the Special Issue Carbon-Based Nanocomposites for Biosensing Approaches)
Show Figures

Graphical abstract

29 pages, 4905 KiB  
Review
A Review on the Development of Gold and Silver Nanoparticles-Based Biosensor as a Detection Strategy of Emerging and Pathogenic RNA Virus
by Nadiah Ibrahim, Nur Diyana Jamaluddin, Ling Ling Tan and Nurul Yuziana Mohd Yusof
Sensors 2021, 21(15), 5114; https://doi.org/10.3390/s21155114 - 28 Jul 2021
Cited by 73 | Viewed by 8550
Abstract
The emergence of highly pathogenic and deadly human coronaviruses, namely SARS-CoV and MERS-CoV within the past two decades and currently SARS-CoV-2, have resulted in millions of human death across the world. In addition, other human viral diseases, such as mosquito borne-viral diseases and [...] Read more.
The emergence of highly pathogenic and deadly human coronaviruses, namely SARS-CoV and MERS-CoV within the past two decades and currently SARS-CoV-2, have resulted in millions of human death across the world. In addition, other human viral diseases, such as mosquito borne-viral diseases and blood-borne viruses, also contribute to a higher risk of death in severe cases. To date, there is no specific drug or medicine available to cure these human viral diseases. Therefore, the early and rapid detection without compromising the test accuracy is required in order to provide a suitable treatment for the containment of the diseases. Recently, nanomaterials-based biosensors have attracted enormous interest due to their biological activities and unique sensing properties, which enable the detection of analytes such as nucleic acid (DNA or RNA), aptamers, and proteins in clinical samples. In addition, the advances of nanotechnologies also enable the development of miniaturized detection systems for point-of-care (POC) biosensors, which could be a new strategy for detecting human viral diseases. The detection of virus-specific genes by using single-stranded DNA (ssDNA) probes has become a particular interest due to their higher sensitivity and specificity compared to immunological methods based on antibody or antigen for early diagnosis of viral infection. Hence, this review has been developed to provide an overview of the current development of nanoparticles-based biosensors that target pathogenic RNA viruses, toward a robust and effective detection strategy of the existing or newly emerging human viral diseases such as SARS-CoV-2. This review emphasizes the nanoparticles-based biosensors developed using noble metals such as gold (Au) and silver (Ag) by virtue of their powerful characteristics as a signal amplifier or enhancer in the detection of nucleic acid. In addition, this review provides a broad knowledge with respect to several analytical methods involved in the development of nanoparticles-based biosensors for the detection of viral nucleic acid using both optical and electrochemical techniques. Full article
(This article belongs to the Section Biosensors)
Show Figures

Figure 1

14 pages, 2783 KiB  
Article
Aptamers Against the β-Conglutin Allergen: Insights into the Behavior of the Shortest Multimeric(Intra)Molecular DNA G-Quadruplex
by Ciara K. O’ Sullivan, Teresa Mairal, Miriam Jauset-Rubio, Marketa Svobodova, Vasso Skouridou, Veronica Esposito, Antonella Virgilio and Aldo Galeone
Int. J. Mol. Sci. 2021, 22(3), 1150; https://doi.org/10.3390/ijms22031150 - 24 Jan 2021
Cited by 11 | Viewed by 3168
Abstract
In previous work, a 93-mer aptamer was selected against the anaphylactic allergen, β-conglutin and truncated to an 11-mer, improving the affinity by two orders of magnitude, whilst maintaining the specificity. This 11-mer was observed to fold in a G-quadruplex, and preliminary results indicated [...] Read more.
In previous work, a 93-mer aptamer was selected against the anaphylactic allergen, β-conglutin and truncated to an 11-mer, improving the affinity by two orders of magnitude, whilst maintaining the specificity. This 11-mer was observed to fold in a G-quadruplex, and preliminary results indicated the existence of a combination of monomeric and higher-order structures. Building on this previous work, in the current study, we aimed to elucidate a deeper understanding of the structural forms of this 11-mer and the effect of the structure on its binding ability. A battery of techniques including polyacrylamide gel electrophoresis, high-performance liquid chromatography in combination with electrospray ionization time-of-flight mass spectrometry, matrix-assisted laser desorption/ionization time-of-flight, thermal binding analysis, circular dichroism and nuclear magnetic resonance were used to probe the structure of both the 11-mer and the 11-mer flanked with TT- at either the 5′ or 3′ end or at both ends. The TT-tail at the 5′ end hinders stacking effects and effectively enforces the 11-mer to maintain a monomeric form. The 11-mer and the TT- derivatives of the 11-mer were also evaluated for their ability to bind its cognate target using microscale thermophoresis and surface plasmon resonance, and biolayer interferometry confirmed the nanomolar affinity of the 11-mer. All the techniques utilized confirmed that the 11-mer was found to exist in a combination of monomeric and higher-order structures, and that independent of the structural form present, nanomolar affinity was observed. Full article
Show Figures

Figure 1

16 pages, 5127 KiB  
Article
Impedimetric Microcystin-LR Aptasensor Prepared with Sulfonated Poly(2,5-dimethoxyaniline)–Silver Nanocomposite
by Mawethu Pascoe Bilibana, Usisipho Feleni, Avril Rae Williams and Emmanuel Iwuoha
Processes 2021, 9(1), 179; https://doi.org/10.3390/pr9010179 - 19 Jan 2021
Cited by 13 | Viewed by 3329
Abstract
This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, l-leucine; R, l-arginine) (MC-LR) containing a 5′ thiolated 60-mer DNA aptamer (i.e., 5′-SH-(CH2)6GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCT CCGC-3′). A nanocomposite electrode platform comprising biocompatible poly(2,5-dimethoxyaniline) (PDMA)-poly(vinylsulfonate) (PVS) and silver nanoparticle [...] Read more.
This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, l-leucine; R, l-arginine) (MC-LR) containing a 5′ thiolated 60-mer DNA aptamer (i.e., 5′-SH-(CH2)6GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCT CCGC-3′). A nanocomposite electrode platform comprising biocompatible poly(2,5-dimethoxyaniline) (PDMA)-poly(vinylsulfonate) (PVS) and silver nanoparticle (Ag0) on a glassy carbon electrode (GCE), i.e., (GCE/PDMA–PVS–Ag0) was used in the biosensor development. Small-angle X-ray scattering (SAXS) spectroscopic analysis revealed that the PDMA–PVS–Ag0 nanocomposites were polydispersed and contained embedded Ag0. Electrochemical impedance spectroscopy (EIS) responses of the aptasensor gave a dynamic linear range (DLR) and limit of detection (LOD) values of 0.01–0.1 ng L−1 MC-LR and 0.003 ng L−1 MC-LR, respectively. The cross-reactivity studies, which was validated with enzyme-linked immunosorbent assay (ELISA), showed that the aptasensor possesses excellent selectivity for MC-LR. Full article
(This article belongs to the Special Issue Application of Metal-Based Nanoparticles in Electrochemical Systems)
Show Figures

Figure 1

16 pages, 3213 KiB  
Article
Investigation of a Truncated Aptamer for Ofloxacin Detection Using a Rapid FRET-Based Apta-Assay
by Sondes Ben Aissa, Mohamed Mastouri, Gaëlle Catanante, Noureddine Raouafi and Jean Louis Marty
Antibiotics 2020, 9(12), 860; https://doi.org/10.3390/antibiotics9120860 - 3 Dec 2020
Cited by 15 | Viewed by 4525
Abstract
In this work, we describe the use of a new truncated aptamer for the determination of ofloxacin (OFL), being a principal quinolone commonly used in both human and animal healthcare. Since the affinity of a 72-mer ssDNA sequence has been previously described without [...] Read more.
In this work, we describe the use of a new truncated aptamer for the determination of ofloxacin (OFL), being a principal quinolone commonly used in both human and animal healthcare. Since the affinity of a 72-mer ssDNA sequence has been previously described without further investigations, this paper demonstrates the first computational prediction of the binding motif between this aptamer and OFL through in silico molecular docking studies. Besides, we suggest the application of the characterized recognition mechanism in a simple FRET (Förster Resonance Energy Transfer) pattern for the rapid aptasensing of the quinolone of interest. Accordingly, our approach harnesses the fluorescence quenching of the fluorescein-tagged aptamer (FAM-APT) induced by its partial hybridization to a tetramethyl rhodamine-labelled complementary ssDNA (TAMRA-cDNA). In such a structure, dye labels brought into close proximity act as a FRET pair. Upon ofloxacin addition, an affinity competition occurs to form a more stable FAM-APT/OFL complex, thus unquenching the FAM-APT signal. Interestingly, the recovered fluorescence intensity was found to correlate well with the antibiotic’s concentrations in the range of 0.2–200 μM in HEPES buffer, with a linear response that ranged between 0.2 and 20 μM. The rapid apta-assay achieved limits of detection and quantification of 0.12 and 0.40 μM, respectively. The truncated aptamer has also shown an improved specificity toward OFL than other quinolones, compared to the original full-length aptamer described in previous works. Finally, the practical application of the developed apta-assay was successfully confirmed to detect OFL quinolone in spiked milk samples, with satisfactory recoveries ranging between 97.4% and 111.4%. Full article
(This article belongs to the Special Issue Aptamer-Based Biosensors for Antibiotic Detection)
Show Figures

Graphical abstract

14 pages, 1883 KiB  
Article
A Sensitive Impedimetric Aptasensor Based on Carbon Nanodots Modified Electrode for Detection of 17ß-Estradiol
by Mohd Hazani Mat Zaid, Jaafar Abdullah, Normazida Rozi, Aliff Aiman Mohamad Rozlan and Sharina Abu Hanifah
Nanomaterials 2020, 10(7), 1346; https://doi.org/10.3390/nano10071346 - 10 Jul 2020
Cited by 39 | Viewed by 4164
Abstract
A simple and sensitive aptasensor based on conductive carbon nanodots (CDs) was fabricated for the detection of 17ß-Estradiol (E2). In the present study, the hydrothermal synthesis of carbon nanodots was successfully electrodeposited on a screen-printed electrode (SPE) as a platform for immobilization of [...] Read more.
A simple and sensitive aptasensor based on conductive carbon nanodots (CDs) was fabricated for the detection of 17ß-Estradiol (E2). In the present study, the hydrothermal synthesis of carbon nanodots was successfully electrodeposited on a screen-printed electrode (SPE) as a platform for immobilization of 76-mer aptamer probe. The morphology and structure of the nanomaterial were characterized by UV-visible absorption spectra, Fluorescence spectra, Transmission electron microscopy (TEM) and Fourier transform infrared spectroscopy (FTIR). Moreover, cyclic voltammetry and electrochemical impedance spectroscopy were used to investigate the electrochemical performance of the prepared electrodes. Subsequently, impedimetric (EIS) measurements were employed to investigate the relative impedances changes before and after E2 binding, which results in a linear relationship of E2 concentration in the range of 1.0 × 10−7 to 1.0 × 10 −12 M, with a detection limit of 0.5 × 10−12 M. Moreover, the developed biosensor showed high selectivity toward E2 and exhibited excellent discrimination against progesterone (PRG), estriol (E3) and bisphenol A (BPA), respectively. Moreover, the average recovery rate of spiked river water samples with E2 ranged from 98.2% to 103.8%, with relative standard deviations between 1.1% and 3.8%, revealing the potential application of the present biosensor for E2 detection in water samples. Full article
Show Figures

Figure 1

26 pages, 3876 KiB  
Article
Design, Synthesis and Characterization of Cyclic NU172 Analogues: A Biophysical and Biological Insight
by Claudia Riccardi, Albert Meyer, Jean-Jacques Vasseur, Domenico Cavasso, Irene Russo Krauss, Luigi Paduano, François Morvan and Daniela Montesarchio
Int. J. Mol. Sci. 2020, 21(11), 3860; https://doi.org/10.3390/ijms21113860 - 29 May 2020
Cited by 26 | Viewed by 3895
Abstract
NU172—a 26-mer oligonucleotide able to bind exosite I of human thrombin and inhibit its activity—was the first aptamer to reach Phase II clinical studies as an anticoagulant in heart disease treatments. With the aim of favoring its functional duplex-quadruplex conformation and thus improving [...] Read more.
NU172—a 26-mer oligonucleotide able to bind exosite I of human thrombin and inhibit its activity—was the first aptamer to reach Phase II clinical studies as an anticoagulant in heart disease treatments. With the aim of favoring its functional duplex-quadruplex conformation and thus improving its enzymatic stability, as well as its thrombin inhibitory activity, herein a focused set of cyclic NU172 analogues—obtained by connecting its 5′- and 3′-extremities with flexible linkers—was synthesized. Two different chemical approaches were exploited in the cyclization procedure, one based on the oxime ligation method and the other on Cu(I)-assisted azide-alkyne cycloaddition (CuAAC), affording NU172 analogues including circularizing linkers with different length and chemical nature. The resulting cyclic NU172 derivatives were characterized using several biophysical techniques (ultraviolet (UV) and circular dichroism (CD) spectroscopies, gel electrophoresis) and then investigated for their serum resistance and anticoagulant activity in vitro. All the cyclic NU172 analogues showed higher thermal stability and nuclease resistance compared to unmodified NU172. These favorable properties were, however, associated with reduced—even though still significant—anticoagulant activity, suggesting that the conformational constraints introduced upon cyclization were somehow detrimental for protein recognition. These results provide useful information for the design of improved analogues of NU172 and related duplex-quadruplex structures. Full article
(This article belongs to the Special Issue Aptamers: Functional-Structural Studies and Biomedical Applications)
Show Figures

Graphical abstract

Back to TopTop