A PCR-RFLP Method for Distinguishing Closely Related Common Quail (Coturnix coturnix) and Japanese Quail (Coturnix japonica): Forensics and Conservation Implications

Simple Summary

Farmed Japanese Quail and wild Common Quail are considered symplesiomorphic due to an uncanny similarity in their feather and overall morphology. These two birds are indistinguishable even to the eyes of a trained ornithologist. Such a conundrum has led to the illegal trade of wild Common Quail in the guise of farmed Japanese Quail, leading to biodiversity losses and increased anthropogenic pressures on the species of wild Common Quail. Further, wildlife crime control bureaus and forest departments of India are shorthanded in handling perpetrators who indulge in the illegal trade of wild Common Quail, as basic genetic techniques might not be efficient enough to differentiate between such closely related species. Hence, we designed an efficient and reliable test to distinguish between these two species, which we present in this study.

Abstract

The genus Coturnix, comprising migratory Old World quails, includes Common Quail (Coturnix coturnix) and Japanese Quail (Coturnix japonica), which are nearly indistinguishable morphologically. This similarity poses challenges in species identification, leading to conservation issues such as the illegal trade of wild Common Quail in the name of farmed Japanese Quail. To address this issue, we employed two approaches: (1) mining species-specific short sequence repeats (SSRs) and (2) designing a PCR-restriction fragment length polymorphism (PCR-RFLP) assay targeting the COX1 gene to distinguish these species. While SSR markers proved unreliable, the PCR-RFLP assay successfully distinguished between Common Quail and Japanese Quail, leveraging the unique BsaBI restriction site in the Common Quail COX1 gene. This method demonstrated high specificity and reproducibility, offering a robust tool for forensic and conservation applications. Our findings provide a reliable, efficient, and accessible technique for wildlife managers and researchers to regulate the illegal trade of Coturnix quails and support conservation efforts.

1. Introduction

The genus Coturnix, within the family Phasianidae, comprises migratory Old World quails found across Asia, Africa, Australia, and Europe [1]. Among these, Common Quail (Coturnix coturnix) and Japanese Quail (Coturnix japonica) are extensively studied for their roles in agriculture and conservation, and as model organisms [2,3,4,5,6]. Intriguingly, Common Quail and Japanese Quail are conspicuously similarly in their appearance, and for all practical purposes are considered indistinguishable in field conditions [1,7,8]. Historically, vocalizations served as the primary method for differentiating these species [1,7,8]. In recent years phylogenetic, evolutionary, and biogeographic studies have shown that Common Quail and Japanese Quail are closely related and follow similar evolutionary trajectory [9,10,11].

Such splitting similarity in appearances has conservation implications, as it facilitates the illegal trade of wild Common Quail, often misrepresented as legally farmed Japanese Quail in India [6,12]. India has both wild Common Quail and farmed Japanese Quail populations, and permits the legal farming of Japanese Quail. The falsification of meat and meat products is a common issue in illegal trades worldwide, driven by financial incentives, which exerts negative anthropogenic pressure on wildlife [13,14]. Responding to the illegal trade, the Ministry of Environment, Forests, and Climate Change (MoEFCC), Government of India, initially prohibited the farming and sale of Japanese Quail [15]. After a thorough evaluation, this prohibition was lifted, allowing the resumption of Japanese Quail farming, albeit with significant financial losses incurred during the interim [16].

Despite these measures, a long-term solution to empower wildlife managers in distinguishing Common Quail and Japanese Quail remains elusive. Morphological methods have proven inadequate, and no published method effectively addresses this challenge. Leveraging our recent publication of the complete mitogenomes of Common Quail and Japanese Quail, we propose utilizing mitochondrial genes as ideal candidates for species differentiation [13,17,18]. Therefore, we aimed to develop a reliable and rapid molecular test. Our method is designed to be accessible not only to expert wildlife researchers but also to wildlife managers and laboratories with limited resources. Over the past few decades, various rapid DNA-based identification techniques, such as polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), Random Amplified Polymorphic DNA polymerase chain reaction (RAPD-PCR), nucleotide sequencing, high-resolution melting analysis (HRM analysis), and real-time PCR based methods, have been employed for species identification [14,19,20]. Our goal was to develop a technique that is both reliable, cost effective, and user-friendly [21,22].

We followed two approaches to develop this novel method (Figure 1). The first approach involved mining species-specific short sequence repeats (SSRs or microsatellites) from the mitogenomes of Common Quail and Japanese Quail. These SSRs were screened using in silico tools to identify species-specific markers that would not cross-amplify. SSR markers are robust and reliable, making them suitable for a plethora of genetic studies [23,24,25,26]. The second approach involved designing a PCR-RFLP method targeting the most conserved gene in the Common Quail and Japanese Quail mitogenome, the COX1 gene. Previous studies have selected multiple mitochondrial genes for PCR-RFLP due to their multicopy nature and sequence variability [14,19,20]. However, we focused on the COX1 gene for its most conserved nature in both Coturnix species. In this study, we present these approaches to develop a novel molecular method for distinguishing Common Quail and Japanese Quail. Our aim is to provide a reliable, efficient, and rapid method to support conservation efforts and empower wildlife managers in regulating the illegal trade of Coturnix quails.

2. Materials and Methods

2.1. Specimen Sampling and DNA Extraction

Dead specimens of Common Quail (n = 2) were collected opportunistically during road-kill surveys with due permission from the Maharashtra Forest Department (Desk-22(8)/Research/CR-8(18-19)/875/2018-19). Species-level identification of specimens was performed in the field using the Birds of the Indian subcontinent field guide [27]. For Japanese Quail, commercially available individuals (n = 8) were sampled from the market and sacrificed under aseptic conditions. Various tissues (including gonads, muscle and liver) from the carcass were sampled and stored in DESS buffer (20% DMSO, 0.25 M tetra-sodium EDTA, Sodium Chloride till saturation, pH 7.5). Around ~20 mg of muscle tissue was digested using a tissue lysis buffer (10 mM Tris-pH 8.0, 10 mM EDTA-pH 8.0, and 100 mM NaCl; 0.35 mM SDS and 34 units Proteinase K) at 52 °C for 15 h. Genomic DNA was extracted from the lysate using a modified Phenol, Chloroform, and Isoamyl alcohol method [28], and stored at −20 °C freezers. Concentration and quality of the extracted DNA was assessed using a spectrophotometer (DeNovix, Wilmington, DE, USA) and a Qubit 4 Fluorometer (ThermoFisher Scientific, Waltham, MA, USA). Each DNA sample (n = 10) was normalized to a concentration of 20 ng/µL to be used for further processes.

2.2. SSR Mining and In Vitro Analysis

For the mining of SSRs, we utilized the mitogenomes of Common Quail and Japanese Quail, which were previously sequenced by our group (NCBI accession no. PP212854 and PP209356) [11]. Using the default settings of Krait, we initially mined these mitogenomes for SSRs [29]. Primer3 was then employed to design primers, and a further in silico evaluation of these SSR primers was conducted using FastPCR [30,31]. Initially, Krait identified 79 and 75 perfect SSR (pSSR) motifs in the mitogenomes of Common Quail and Japanese Quail, respectively. However, upon in silico validation, all pSSR primers exhibited cross-amplification in both species, rendering them unsuitable for further use. Consequently, we adjusted the input parameters in Krait to specifically mine compound SSRs (cSSRs) from each mitogenome. This approach yielded a total of 6 and 5 cSSRs from the mitogenomes of Common Quail and Japanese Quail, respectively. For Common Quail, 3 cSSRs were selected after in silico validation, and primers (named: CQ1, CQ2 and CQ3) were designed to avoid cross-amplification (

Table 1. Sequence of mitogenomic SSR primers developed in this study from flanking regions of SSR sequences and primer developed for PCR-RFLP method using the COX1 gene of Common Quail (Coturnix coturnix) and Japanese Quail (Coturnix japonica).

Primer Name	Direction	Primer Sequence (5′-3′)	Position on Respective Mitogenomes
			(Start–End)
CQ1	Forward	TCACAGCCCTCCTACTCTCC	5562–5582
	Reverse	TGCTAGTAGGGTGAGGAGGG
CQ2	Forward	GGCTTAGCTGGTATGCCCC	7898–7915
	Reverse	TGAGATTAAGGAGCCGATTGAGG
CQ3	Forward	CCTCCTTACCCCCATCATCC	13,065–13,087
	Reverse	AGGCGGTTTTAACGGTTTTGG
JQ1	Forward	TGCTTGCCGGACATATTTTTACC	911–946
	Reverse	GGTTTGAGGGTATTTGTGCGG
JQ2	Forward	CAGCACTTCCTAGGCCTAGC	7899–7916
	Reverse	ACTTTACGTTTTGCTGAGAAGGC
JQ3	Forward	TCCTCCTTACCCCCATTATCC	13,067–13,089
	Reverse	GGTAATGATGCTGTCTGTGCC
jqcqre_1	Forward	CAACCGATGACTATTTTCAACTAACCA	6583/6584–7412/7413
	Reverse	TCCTACTGTGAATATATGGTGGGC

). These primers were expected to amplify in Common Quail samples but not in Japanese Quail samples, with an estimated amplicon size of 80–101 bp. Similarly, for Japanese Quail, 3 cSSRs were selected, and primers (named JQ1, JQ2, and JQ3) were designed to avoid cross-amplification, which were anticipated to amplify in Japanese Quail samples but not in Common Quail samples, with an estimated amplicon size of 145–171 bp (Table 1). Furthermore, in silico validation of the newly designed cSSR primers was also conducted using three available Japanese Quail mitogenomes (NC003408, MW574361, KXY712089) and one Common Quail mitogenome (MW574359). The in silico validation confirmed successful amplification in the target species, with no evidence of cross-amplification.

While designing primer pairs, parameters regarding GC content were set at ‘low’, and the primer melting temperature (Tm) compatibility was set at a <1.5 °C difference for all 6 pairs. A PCR was performed for all the samples (n = 10) for each newly designed primer pair (n = 6). The PCR was performed at a 50 µL reaction volume with the following components: 25 µL Type-it Multiplex PCR Master Mix (Qiagen NV, Germany), 5 µL Q-solution (provided in Type-it kit), 1 pmol/µL of each oligonucleotide primer (5 µL total), ~40 ng (2 µL) of DNA template, and 13 µL ddH2O. A PCR was then carried out with the following parameters as advised in the Type-it kit, albeit with slight modifications: one cycle of initial denaturation at 95 °C for 5 min; 35 cycles of 95 °C for 30 s, 63.8 °C for 90 s, 72 °C for 40 s; one cycle of 60 °C for 30 min followed by holding at 4 °C. After completion of the cycles, the PCR products were run on 1.5% ethidium bromide stained agarose gel (0.5x TBE) at 170 volts for 55 min and the PCR product bands were visualized on a UV gel documentation system (ClinX Pvt. Ltd., Bangalore, India).

2.3. Development and Testing of PCR-RFLP Assay

In this study, we developed a PCR-RFLP assay to distinguish between Common Quail and Japanese Quail, following the unsuccessful application of the cSSR approach. To identify the most effective mitochondrial gene for species differentiation, we selected the COX1 gene based on its most conserved nature amongst all mito-genes from our previous research [11]. Using the NEBcutter v3.0 online tool (https://nc3.neb.com/NEBcutter/ (accessed on 17 July 2024)), we identified potential restriction sites and effective restriction endonucleases (REs) within the COX1 gene (length = 1551 bp) of both species. Among the identified REs, BsaBI (New England Biolabs, Ipswich, MA, USA) was selected for the assay. BsaBI cleaves Common Quail COX1 gene at a single site (637th position) but does not cleave Japanese Quail COX1 gene throughout its length. Further, BsaBI, a Type-II RE, cleaves precisely at the recognition site and can be heat-deactivated, facilitating storage post-digestion.

To target the recognition site, we designed a novel primer set using both Common Quail and Japanese Quail gene, named jqcqre_1f and jqcqre_1r which amplifies an ~850 bp fragment at position 1–850th site of the COX1 gene (Table 1). This combination of newly designed primers and BsaBI enzyme was expected to cleave the Common Quail COX1 amplicon at 637th site, producing fragments of ~637 bp and ~213 bp, while leaving the ~850 bp amplicon of Japanese Quail COX1 gene intact. The expected banding pattern on an agarose gel would thus be two bands (~637 bp, ~213 bp) for Common Quail and one band (~850 bp) for Japanese Quail. An in silico validation of the newly designed PCR-RFLP primers and enzymes was conducted using COX1 gene sequences from available Japanese Quail mitogenomes (NC003408, MW574361, KXY712089) and the Common Quail mitogenome (MW574359). The validation confirmed the successful targeted amplification and the presence of the BsaBI cleavage site in Common Quail but not in Japanese Quail.

The PCR-RFLP assay was tested on DNA samples from eight Japanese Quail and two Common Quail individuals, as mentioned previously (n = 10). PCR was performed using jqcqre_1f and jqcqre_1r primers in a 50 µL reaction volume with the following components: 25 µL Taq PCR Master Mix (Qiagen NV, Hilden, Germany), 1 pmol/µL of each oligonucleotide primer (5 µL total), ~60 ng (3 µL) of DNA template and 17 µL ddH2O. PCR was then carried out with the following conditions: one cycle of initial denaturation at 95 °C for 5 min; 35 cycles of 95 °C for 30 s, 57 °C for 90 s, 72 °C for 60 s; one cycle of 72 °C for 10 min followed by holding at 4 °C. PCR products (~850 bp) were resolved on a 1.5% ethidium bromide stained agarose gel (0.5x TBE) at 170 volts for 75 min. Bands were excised under UV light using a sterile blade, and PCR products were extracted using the Qiagen Gel Extraction Kit (Qiagen NV, Germany). The standardization of RE digestion with BsaBI involved varying amounts of the PCR product (20 ng, 40 ng, 60 ng, and 80 ng), RE units (2, 4, and 6) and digestion duration (80 min, 120 min, 180 min, and 220 min). The optimal digestion conditions were determined to be 7 units of BsaBI enzyme (7 µL), 50 ng of the PCR product (12 µL), 5 µL of rCutSmart buffer (New England Biolabs, USA), and 26 µL ddH₂O in a 50 µL reaction volume. Digestion reactions were incubated at 60 °C for 220 min, heat-inactivated at 80 °C for 20 min, and stored at −20 °C. Digested products were run on 2.5% ethidium bromide stained agarose gel (0.5x TBE) at 140 volts for 90 min, and bands were visualized on a UV gel documentation system.

3. Results

3.1. Compound SSR Analysis

Using in silico tools, we predicted species-specific uniqueness for the cSSR primer sets CQ1, CQ2, and CQ3 for Common Quail and JQ1, JQ2, and JQ3 for Japanese Quail, respectively, without any cross-species amplification. However, a PCR amplification with all six primer sets resulted in positive amplification across all samples, i.e., eight Japanese Quail and two Common Quail individuals (Figure 2). The observed amplicon sizes for the CQ1, CQ2, and CQ3 primers were approximately 100 bp, consistent with in silico predictions. Similarly, the JQ1, JQ2, and JQ3 primer sets also showed positive amplification for all samples, with band sizes estimated at approximately 170 bp. Agarose gel electrophoresis revealed a single band of either ~100 bp or ~170 bp for all samples across all primers. These results indicate that distinguishing between Common Quail and Japanese Quail using cSSR primers is not feasible. Our study demonstrates that the cSSR primers do not reliably differentiate between these two closely related bird species.

3.2. PCR-RFLP Assay

The novel PCR-RFLP assay developed in this study successfully distinguished between Common Quail and Japanese Quail, confirming the assay’s efficacy and reliability. The COX1 gene, selected for its conserved nature, served as the target gene for species differentiation. The BsaBI restriction enzyme, identified through in silico analysis, cleaved the Common Quail COX1 gene at a single site (637 bp), while leaving the Japanese Quail COX1 gene intact (Figure 3).

Upon testing the assay on DNA samples from eight Japanese Quail and two Common Quail individuals, the expected banding patterns were consistently observed. The primers jqcqre_1f and jqcqre_1r successfully amplified ~850 bp targeted region of the COX1 gene for all ten samples (Figure 3). For Common Quail, the COX1 amplicon was cleaved into two distinct fragments of ~637 bp and ~213 bp, as visualized on a 2.5% ethidium bromide-stained agarose gel (Figure 3). In contrast, the Japanese Quail samples exhibited a single band of ~850 bp, indicating the absence of BsaBI cleavage sites within the amplified region. The in silico validation of the PCR-RFLP primers and enzymes, using COX1 gene sequences from available mitogenomes, corroborated the experimental findings. The presence of the BsaBI cleavage site in Common Quail and its absence in Japanese Quail were confirmed, supporting the assay’s specificity. The optimisation of the restriction digestion conditions, including enzyme concentration, PCR product input, and digestion duration, ensured consistent and reproducible results. The optimal conditions were 7 units of BsaBI enzyme, 50 ng of the PCR product, and a 220 min incubation at 60 °C for achieving the desired banding patterns. Overall, the PCR-RFLP assay demonstrated high specificity and accuracy in differentiating between the two closely related Coturnix species. This method provides a robust tool for forensic and conservation applications, offering a reliable means of distinguishing both the species.

4. Discussion

SSR markers are commonly employed in population genetic studies, and their application in developing species-specific PCR-based markers from mitogenomes has been largely speculative [32,33]. In contrast, in silico analyses of mitogenomic SSR motifs, distribution, and genetic parameters have been explored in plants and fish, as documented in previous studies [34,35,36]. However, there are no published studies on the usage of mitogenomic SSR in birds to develop a test for species differentiation. Our study provides empirical evidence suggesting that mitogenomic SSR markers may not be a feasible option for developing species-specific markers in birds. This conclusion is based on our findings, and we acknowledge that further research is needed to explore this avenue comprehensively.

The selection of an appropriate marker–enzyme pair is crucial for developing a robust and reliable PCR-RFLP assay for distinguishing closely related species. Previous studies have demonstrated that an ideal molecular marker should exhibit minimal intraspecific variation while retaining significant interspecific variation at enzyme cut sites [22]. In this context, the PCR-RFLP assay developed in this study successfully distinguished Common Quail and Japanese Quail with distinct and consistent restriction fragment pattern across all tested specimens. Furthermore, the custom primer pair designed in this study consistently amplified the PCR product in all individuals, regardless of species, highlighting its potential utility and user-friendliness for future applications. Previous studies have successfully developed PCR-RFLP markers for a wide range of applications, including species identification, forensic analysis, and detection of food adulteration across various fields such as food technology, ecology, and biodiversity [13,14,18,19,22]. This technique has been effectively utilized to identify species from naturally shed bird feathers and economically valuable fish body parts [21,37]. Additionally, this method has been instrumental in criminal investigations, enabling the differentiation of human DNA from non-human sources [38]. More recently, PCR-RFLP has been applied to distinguish high-value edible swiftlet nests from those of low economic value [20].

Species identification using the PCR-RFLP method has frequently utilized genes such as 12 s rRNA, NADH2, COX1 and CYTB [14,18,21,22]. The efficiency and advantages of these genes in the development of PCR-RFLP methods have been compared and discussed extensively, though opinions vary among researchers [17]. In our previous work, we demonstrated the evolutionary conservation of the COX1 gene not only in Common Quail and Japanese Quail species, but also across other Coturnix species [11]. Consequently, we inferred that the COX1 gene may be the most efficient marker for distinguishing closely related Coturnix species. The Common Quail COX1 gene, contains a unique recognition site for the BsaBI enzyme, 5′..GATNN<>NNATC..3′, located at the 637th position, which is absent in Japanese Quail. This site is characterized by the presence of a “T” nucleotide in Common Quail, whereas Japanese Quail has “C” nucleotide at the same position (Figure 1). This single nucleotide difference allows BsaBI to cleave the Common Quail COX1 amplicon into two distinct fragments. Our in silico and in vitro analyses confirm that this technique is reliable and can be replicated by other researchers following the standardized protocol established in this study.

In Europe, farm-reared Japanese Quail individuals are frequently released into the wild in countries such as France, Spain, and Italy to support the quail hunting industry, a significant socio-economic activity in the region [39,40,41]. Such introductions have been reported to pose a threat to native Common Quail sub-species through the introgression of domestic Japanese Quail alleles potentially affecting migratory and reproductive behaviours in wild populations [41,42,43]. Additionally in regions like Mongolia, where Common Quail and Japanese Quail populations are sympatric, there are reports of hybridization occurring in the wild [44]. In these areas, it would be valuable to test the reliability and efficiency of the novel PCR-RFLP method developed in this study. The outcomes of this method could have significant economic implications.

While our PCR-RFLP assay demonstrated clear differentiation between the two species, we acknowledge that only two Common Quail specimens were tested, representing a small sample size. Future validation studies incorporating broader geographic sampling and larger sample sizes of Common Quail would strengthen confidence in the assay’s global reliability. Despite this limitation, the consistent results obtained and the clear molecular basis for the restriction site difference support the utility of this method for distinguishing between these morphologically similar species.

5. Conclusions

This study presents a novel PCR-RFLP assay as a reliable and cost effective method for distinguishing between Common Quail and Japanese Quail. The assay’s specificity and reproducibility are validated through in silico and in vitro analyses, confirming its potential for widespread application in species identification, conservation and forensic contexts. The PCR-RFLP method developed in this study addresses the critical need for accurate species identification, particularly in regions where illegal trade poses significant threats to native quail populations. This new method has the potential of solving the long-lasting issue of identification ambiguity between Common Quail and Japanese Quail.