Next Article in Journal
Bridging Continents: The Expansion and Establishment of the House Bunting (Emberiza sahari) from North Africa to Europe
Previous Article in Journal
Ecological Trap Effects in Migratory European Pied Flycatchers (Ficedula hypoleuca) Nesting in Pest Outbreak-Affected Forests
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

A PCR-RFLP Method for Distinguishing Closely Related Common Quail (Coturnix coturnix) and Japanese Quail (Coturnix japonica): Forensics and Conservation Implications

by
Prateek Dey
1,2,
Kochiganti Venkata Hanumat Sastry
3 and
Ram Pratap Singh
4,*
1
Salim Ali Centre for Ornithology and Natural History, Coimbatore 641108, India
2
Bharathiar University, Coimbatore 641046, India
3
National Institute of Animal Nutrition and Physiology, Bengaluru 560030, India
4
Department of Life Science, Central University of South Bihar, Gaya 824236, India
*
Author to whom correspondence should be addressed.
Birds 2025, 6(2), 28; https://doi.org/10.3390/birds6020028
Submission received: 23 March 2025 / Revised: 20 May 2025 / Accepted: 21 May 2025 / Published: 4 June 2025

Simple Summary

Farmed Japanese Quail and wild Common Quail are considered symplesiomorphic due to an uncanny similarity in their feather and overall morphology. These two birds are indistinguishable even to the eyes of a trained ornithologist. Such a conundrum has led to the illegal trade of wild Common Quail in the guise of farmed Japanese Quail, leading to biodiversity losses and increased anthropogenic pressures on the species of wild Common Quail. Further, wildlife crime control bureaus and forest departments of India are shorthanded in handling perpetrators who indulge in the illegal trade of wild Common Quail, as basic genetic techniques might not be efficient enough to differentiate between such closely related species. Hence, we designed an efficient and reliable test to distinguish between these two species, which we present in this study.

Abstract

The genus Coturnix, comprising migratory Old World quails, includes Common Quail (Coturnix coturnix) and Japanese Quail (Coturnix japonica), which are nearly indistinguishable morphologically. This similarity poses challenges in species identification, leading to conservation issues such as the illegal trade of wild Common Quail in the name of farmed Japanese Quail. To address this issue, we employed two approaches: (1) mining species-specific short sequence repeats (SSRs) and (2) designing a PCR-restriction fragment length polymorphism (PCR-RFLP) assay targeting the COX1 gene to distinguish these species. While SSR markers proved unreliable, the PCR-RFLP assay successfully distinguished between Common Quail and Japanese Quail, leveraging the unique BsaBI restriction site in the Common Quail COX1 gene. This method demonstrated high specificity and reproducibility, offering a robust tool for forensic and conservation applications. Our findings provide a reliable, efficient, and accessible technique for wildlife managers and researchers to regulate the illegal trade of Coturnix quails and support conservation efforts.

Graphical Abstract

1. Introduction

The genus Coturnix, within the family Phasianidae, comprises migratory Old World quails found across Asia, Africa, Australia, and Europe [1]. Among these, Common Quail (Coturnix coturnix) and Japanese Quail (Coturnix japonica) are extensively studied for their roles in agriculture and conservation, and as model organisms [2,3,4,5,6]. Intriguingly, Common Quail and Japanese Quail are conspicuously similarly in their appearance, and for all practical purposes are considered indistinguishable in field conditions [1,7,8]. Historically, vocalizations served as the primary method for differentiating these species [1,7,8]. In recent years phylogenetic, evolutionary, and biogeographic studies have shown that Common Quail and Japanese Quail are closely related and follow similar evolutionary trajectory [9,10,11].
Such splitting similarity in appearances has conservation implications, as it facilitates the illegal trade of wild Common Quail, often misrepresented as legally farmed Japanese Quail in India [6,12]. India has both wild Common Quail and farmed Japanese Quail populations, and permits the legal farming of Japanese Quail. The falsification of meat and meat products is a common issue in illegal trades worldwide, driven by financial incentives, which exerts negative anthropogenic pressure on wildlife [13,14]. Responding to the illegal trade, the Ministry of Environment, Forests, and Climate Change (MoEFCC), Government of India, initially prohibited the farming and sale of Japanese Quail [15]. After a thorough evaluation, this prohibition was lifted, allowing the resumption of Japanese Quail farming, albeit with significant financial losses incurred during the interim [16].
Despite these measures, a long-term solution to empower wildlife managers in distinguishing Common Quail and Japanese Quail remains elusive. Morphological methods have proven inadequate, and no published method effectively addresses this challenge. Leveraging our recent publication of the complete mitogenomes of Common Quail and Japanese Quail, we propose utilizing mitochondrial genes as ideal candidates for species differentiation [13,17,18]. Therefore, we aimed to develop a reliable and rapid molecular test. Our method is designed to be accessible not only to expert wildlife researchers but also to wildlife managers and laboratories with limited resources. Over the past few decades, various rapid DNA-based identification techniques, such as polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), Random Amplified Polymorphic DNA polymerase chain reaction (RAPD-PCR), nucleotide sequencing, high-resolution melting analysis (HRM analysis), and real-time PCR based methods, have been employed for species identification [14,19,20]. Our goal was to develop a technique that is both reliable, cost effective, and user-friendly [21,22].
We followed two approaches to develop this novel method (Figure 1). The first approach involved mining species-specific short sequence repeats (SSRs or microsatellites) from the mitogenomes of Common Quail and Japanese Quail. These SSRs were screened using in silico tools to identify species-specific markers that would not cross-amplify. SSR markers are robust and reliable, making them suitable for a plethora of genetic studies [23,24,25,26]. The second approach involved designing a PCR-RFLP method targeting the most conserved gene in the Common Quail and Japanese Quail mitogenome, the COX1 gene. Previous studies have selected multiple mitochondrial genes for PCR-RFLP due to their multicopy nature and sequence variability [14,19,20]. However, we focused on the COX1 gene for its most conserved nature in both Coturnix species. In this study, we present these approaches to develop a novel molecular method for distinguishing Common Quail and Japanese Quail. Our aim is to provide a reliable, efficient, and rapid method to support conservation efforts and empower wildlife managers in regulating the illegal trade of Coturnix quails.

2. Materials and Methods

2.1. Specimen Sampling and DNA Extraction

Dead specimens of Common Quail (n = 2) were collected opportunistically during road-kill surveys with due permission from the Maharashtra Forest Department (Desk-22(8)/Research/CR-8(18-19)/875/2018-19). Species-level identification of specimens was performed in the field using the Birds of the Indian subcontinent field guide [27]. For Japanese Quail, commercially available individuals (n = 8) were sampled from the market and sacrificed under aseptic conditions. Various tissues (including gonads, muscle and liver) from the carcass were sampled and stored in DESS buffer (20% DMSO, 0.25 M tetra-sodium EDTA, Sodium Chloride till saturation, pH 7.5). Around ~20 mg of muscle tissue was digested using a tissue lysis buffer (10 mM Tris-pH 8.0, 10 mM EDTA-pH 8.0, and 100 mM NaCl; 0.35 mM SDS and 34 units Proteinase K) at 52 °C for 15 h. Genomic DNA was extracted from the lysate using a modified Phenol, Chloroform, and Isoamyl alcohol method [28], and stored at −20 °C freezers. Concentration and quality of the extracted DNA was assessed using a spectrophotometer (DeNovix, Wilmington, DE, USA) and a Qubit 4 Fluorometer (ThermoFisher Scientific, Waltham, MA, USA). Each DNA sample (n = 10) was normalized to a concentration of 20 ng/µL to be used for further processes.

2.2. SSR Mining and In Vitro Analysis

For the mining of SSRs, we utilized the mitogenomes of Common Quail and Japanese Quail, which were previously sequenced by our group (NCBI accession no. PP212854 and PP209356) [11]. Using the default settings of Krait, we initially mined these mitogenomes for SSRs [29]. Primer3 was then employed to design primers, and a further in silico evaluation of these SSR primers was conducted using FastPCR [30,31]. Initially, Krait identified 79 and 75 perfect SSR (pSSR) motifs in the mitogenomes of Common Quail and Japanese Quail, respectively. However, upon in silico validation, all pSSR primers exhibited cross-amplification in both species, rendering them unsuitable for further use. Consequently, we adjusted the input parameters in Krait to specifically mine compound SSRs (cSSRs) from each mitogenome. This approach yielded a total of 6 and 5 cSSRs from the mitogenomes of Common Quail and Japanese Quail, respectively. For Common Quail, 3 cSSRs were selected after in silico validation, and primers (named: CQ1, CQ2 and CQ3) were designed to avoid cross-amplification (Table 1). These primers were expected to amplify in Common Quail samples but not in Japanese Quail samples, with an estimated amplicon size of 80–101 bp. Similarly, for Japanese Quail, 3 cSSRs were selected, and primers (named JQ1, JQ2, and JQ3) were designed to avoid cross-amplification, which were anticipated to amplify in Japanese Quail samples but not in Common Quail samples, with an estimated amplicon size of 145–171 bp (Table 1). Furthermore, in silico validation of the newly designed cSSR primers was also conducted using three available Japanese Quail mitogenomes (NC003408, MW574361, KXY712089) and one Common Quail mitogenome (MW574359). The in silico validation confirmed successful amplification in the target species, with no evidence of cross-amplification.
While designing primer pairs, parameters regarding GC content were set at ‘low’, and the primer melting temperature (Tm) compatibility was set at a <1.5 °C difference for all 6 pairs. A PCR was performed for all the samples (n = 10) for each newly designed primer pair (n = 6). The PCR was performed at a 50 µL reaction volume with the following components: 25 µL Type-it Multiplex PCR Master Mix (Qiagen NV, Germany), 5 µL Q-solution (provided in Type-it kit), 1 pmol/µL of each oligonucleotide primer (5 µL total), ~40 ng (2 µL) of DNA template, and 13 µL ddH2O. A PCR was then carried out with the following parameters as advised in the Type-it kit, albeit with slight modifications: one cycle of initial denaturation at 95 °C for 5 min; 35 cycles of 95 °C for 30 s, 63.8 °C for 90 s, 72 °C for 40 s; one cycle of 60 °C for 30 min followed by holding at 4 °C. After completion of the cycles, the PCR products were run on 1.5% ethidium bromide stained agarose gel (0.5x TBE) at 170 volts for 55 min and the PCR product bands were visualized on a UV gel documentation system (ClinX Pvt. Ltd., Bangalore, India).

2.3. Development and Testing of PCR-RFLP Assay

In this study, we developed a PCR-RFLP assay to distinguish between Common Quail and Japanese Quail, following the unsuccessful application of the cSSR approach. To identify the most effective mitochondrial gene for species differentiation, we selected the COX1 gene based on its most conserved nature amongst all mito-genes from our previous research [11]. Using the NEBcutter v3.0 online tool (https://nc3.neb.com/NEBcutter/ (accessed on 17 July 2024)), we identified potential restriction sites and effective restriction endonucleases (REs) within the COX1 gene (length = 1551 bp) of both species. Among the identified REs, BsaBI (New England Biolabs, Ipswich, MA, USA) was selected for the assay. BsaBI cleaves Common Quail COX1 gene at a single site (637th position) but does not cleave Japanese Quail COX1 gene throughout its length. Further, BsaBI, a Type-II RE, cleaves precisely at the recognition site and can be heat-deactivated, facilitating storage post-digestion.
To target the recognition site, we designed a novel primer set using both Common Quail and Japanese Quail gene, named jqcqre_1f and jqcqre_1r which amplifies an ~850 bp fragment at position 1–850th site of the COX1 gene (Table 1). This combination of newly designed primers and BsaBI enzyme was expected to cleave the Common Quail COX1 amplicon at 637th site, producing fragments of ~637 bp and ~213 bp, while leaving the ~850 bp amplicon of Japanese Quail COX1 gene intact. The expected banding pattern on an agarose gel would thus be two bands (~637 bp, ~213 bp) for Common Quail and one band (~850 bp) for Japanese Quail. An in silico validation of the newly designed PCR-RFLP primers and enzymes was conducted using COX1 gene sequences from available Japanese Quail mitogenomes (NC003408, MW574361, KXY712089) and the Common Quail mitogenome (MW574359). The validation confirmed the successful targeted amplification and the presence of the BsaBI cleavage site in Common Quail but not in Japanese Quail.
The PCR-RFLP assay was tested on DNA samples from eight Japanese Quail and two Common Quail individuals, as mentioned previously (n = 10). PCR was performed using jqcqre_1f and jqcqre_1r primers in a 50 µL reaction volume with the following components: 25 µL Taq PCR Master Mix (Qiagen NV, Hilden, Germany), 1 pmol/µL of each oligonucleotide primer (5 µL total), ~60 ng (3 µL) of DNA template and 17 µL ddH2O. PCR was then carried out with the following conditions: one cycle of initial denaturation at 95 °C for 5 min; 35 cycles of 95 °C for 30 s, 57 °C for 90 s, 72 °C for 60 s; one cycle of 72 °C for 10 min followed by holding at 4 °C. PCR products (~850 bp) were resolved on a 1.5% ethidium bromide stained agarose gel (0.5x TBE) at 170 volts for 75 min. Bands were excised under UV light using a sterile blade, and PCR products were extracted using the Qiagen Gel Extraction Kit (Qiagen NV, Germany). The standardization of RE digestion with BsaBI involved varying amounts of the PCR product (20 ng, 40 ng, 60 ng, and 80 ng), RE units (2, 4, and 6) and digestion duration (80 min, 120 min, 180 min, and 220 min). The optimal digestion conditions were determined to be 7 units of BsaBI enzyme (7 µL), 50 ng of the PCR product (12 µL), 5 µL of rCutSmart buffer (New England Biolabs, USA), and 26 µL ddH2O in a 50 µL reaction volume. Digestion reactions were incubated at 60 °C for 220 min, heat-inactivated at 80 °C for 20 min, and stored at −20 °C. Digested products were run on 2.5% ethidium bromide stained agarose gel (0.5x TBE) at 140 volts for 90 min, and bands were visualized on a UV gel documentation system.

3. Results

3.1. Compound SSR Analysis

Using in silico tools, we predicted species-specific uniqueness for the cSSR primer sets CQ1, CQ2, and CQ3 for Common Quail and JQ1, JQ2, and JQ3 for Japanese Quail, respectively, without any cross-species amplification. However, a PCR amplification with all six primer sets resulted in positive amplification across all samples, i.e., eight Japanese Quail and two Common Quail individuals (Figure 2). The observed amplicon sizes for the CQ1, CQ2, and CQ3 primers were approximately 100 bp, consistent with in silico predictions. Similarly, the JQ1, JQ2, and JQ3 primer sets also showed positive amplification for all samples, with band sizes estimated at approximately 170 bp. Agarose gel electrophoresis revealed a single band of either ~100 bp or ~170 bp for all samples across all primers. These results indicate that distinguishing between Common Quail and Japanese Quail using cSSR primers is not feasible. Our study demonstrates that the cSSR primers do not reliably differentiate between these two closely related bird species.

3.2. PCR-RFLP Assay

The novel PCR-RFLP assay developed in this study successfully distinguished between Common Quail and Japanese Quail, confirming the assay’s efficacy and reliability. The COX1 gene, selected for its conserved nature, served as the target gene for species differentiation. The BsaBI restriction enzyme, identified through in silico analysis, cleaved the Common Quail COX1 gene at a single site (637 bp), while leaving the Japanese Quail COX1 gene intact (Figure 3).
Upon testing the assay on DNA samples from eight Japanese Quail and two Common Quail individuals, the expected banding patterns were consistently observed. The primers jqcqre_1f and jqcqre_1r successfully amplified ~850 bp targeted region of the COX1 gene for all ten samples (Figure 3). For Common Quail, the COX1 amplicon was cleaved into two distinct fragments of ~637 bp and ~213 bp, as visualized on a 2.5% ethidium bromide-stained agarose gel (Figure 3). In contrast, the Japanese Quail samples exhibited a single band of ~850 bp, indicating the absence of BsaBI cleavage sites within the amplified region. The in silico validation of the PCR-RFLP primers and enzymes, using COX1 gene sequences from available mitogenomes, corroborated the experimental findings. The presence of the BsaBI cleavage site in Common Quail and its absence in Japanese Quail were confirmed, supporting the assay’s specificity. The optimisation of the restriction digestion conditions, including enzyme concentration, PCR product input, and digestion duration, ensured consistent and reproducible results. The optimal conditions were 7 units of BsaBI enzyme, 50 ng of the PCR product, and a 220 min incubation at 60 °C for achieving the desired banding patterns. Overall, the PCR-RFLP assay demonstrated high specificity and accuracy in differentiating between the two closely related Coturnix species. This method provides a robust tool for forensic and conservation applications, offering a reliable means of distinguishing both the species.

4. Discussion

SSR markers are commonly employed in population genetic studies, and their application in developing species-specific PCR-based markers from mitogenomes has been largely speculative [32,33]. In contrast, in silico analyses of mitogenomic SSR motifs, distribution, and genetic parameters have been explored in plants and fish, as documented in previous studies [34,35,36]. However, there are no published studies on the usage of mitogenomic SSR in birds to develop a test for species differentiation. Our study provides empirical evidence suggesting that mitogenomic SSR markers may not be a feasible option for developing species-specific markers in birds. This conclusion is based on our findings, and we acknowledge that further research is needed to explore this avenue comprehensively.
The selection of an appropriate marker–enzyme pair is crucial for developing a robust and reliable PCR-RFLP assay for distinguishing closely related species. Previous studies have demonstrated that an ideal molecular marker should exhibit minimal intraspecific variation while retaining significant interspecific variation at enzyme cut sites [22]. In this context, the PCR-RFLP assay developed in this study successfully distinguished Common Quail and Japanese Quail with distinct and consistent restriction fragment pattern across all tested specimens. Furthermore, the custom primer pair designed in this study consistently amplified the PCR product in all individuals, regardless of species, highlighting its potential utility and user-friendliness for future applications. Previous studies have successfully developed PCR-RFLP markers for a wide range of applications, including species identification, forensic analysis, and detection of food adulteration across various fields such as food technology, ecology, and biodiversity [13,14,18,19,22]. This technique has been effectively utilized to identify species from naturally shed bird feathers and economically valuable fish body parts [21,37]. Additionally, this method has been instrumental in criminal investigations, enabling the differentiation of human DNA from non-human sources [38]. More recently, PCR-RFLP has been applied to distinguish high-value edible swiftlet nests from those of low economic value [20].
Species identification using the PCR-RFLP method has frequently utilized genes such as 12 s rRNA, NADH2, COX1 and CYTB [14,18,21,22]. The efficiency and advantages of these genes in the development of PCR-RFLP methods have been compared and discussed extensively, though opinions vary among researchers [17]. In our previous work, we demonstrated the evolutionary conservation of the COX1 gene not only in Common Quail and Japanese Quail species, but also across other Coturnix species [11]. Consequently, we inferred that the COX1 gene may be the most efficient marker for distinguishing closely related Coturnix species. The Common Quail COX1 gene, contains a unique recognition site for the BsaBI enzyme, 5′..GATNN<>NNATC..3′, located at the 637th position, which is absent in Japanese Quail. This site is characterized by the presence of a “T” nucleotide in Common Quail, whereas Japanese Quail has “C” nucleotide at the same position (Figure 1). This single nucleotide difference allows BsaBI to cleave the Common Quail COX1 amplicon into two distinct fragments. Our in silico and in vitro analyses confirm that this technique is reliable and can be replicated by other researchers following the standardized protocol established in this study.
In Europe, farm-reared Japanese Quail individuals are frequently released into the wild in countries such as France, Spain, and Italy to support the quail hunting industry, a significant socio-economic activity in the region [39,40,41]. Such introductions have been reported to pose a threat to native Common Quail sub-species through the introgression of domestic Japanese Quail alleles potentially affecting migratory and reproductive behaviours in wild populations [41,42,43]. Additionally in regions like Mongolia, where Common Quail and Japanese Quail populations are sympatric, there are reports of hybridization occurring in the wild [44]. In these areas, it would be valuable to test the reliability and efficiency of the novel PCR-RFLP method developed in this study. The outcomes of this method could have significant economic implications.
While our PCR-RFLP assay demonstrated clear differentiation between the two species, we acknowledge that only two Common Quail specimens were tested, representing a small sample size. Future validation studies incorporating broader geographic sampling and larger sample sizes of Common Quail would strengthen confidence in the assay’s global reliability. Despite this limitation, the consistent results obtained and the clear molecular basis for the restriction site difference support the utility of this method for distinguishing between these morphologically similar species.

5. Conclusions

This study presents a novel PCR-RFLP assay as a reliable and cost effective method for distinguishing between Common Quail and Japanese Quail. The assay’s specificity and reproducibility are validated through in silico and in vitro analyses, confirming its potential for widespread application in species identification, conservation and forensic contexts. The PCR-RFLP method developed in this study addresses the critical need for accurate species identification, particularly in regions where illegal trade poses significant threats to native quail populations. This new method has the potential of solving the long-lasting issue of identification ambiguity between Common Quail and Japanese Quail.

Author Contributions

Conceptualization: R.P.S. and K.V.H.S.; Data curation: P.D. and R.P.S.; Formal analysis: P.D. and R.P.S.; Funding acquisition: R.P.S.; Investigation: P.D. and R.P.S.; Methodology: R.P.S. and K.V.H.S.; Project administration: R.P.S. and K.V.H.S.; Resources: P.D. and K.V.H.S.; Software Supervision: P.D. and R.P.S.; Validation: P.D. and R.P.S.; Visualization: P.D. and R.P.S.; Writing—original draft: P.D., R.P.S. and K.V.H.S.; Writing—review and editing: P.D., R.P.S., and K.V.H.S. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported and funded by the Ministry of Environment, Forests, and Climate Change, Government of India.

Institutional Review Board Statement

Not applicable.

Data Availability Statement

All data presented in this study are freely available.

Acknowledgments

The necessary permission from respective forest departments (Maharashtra Forest Department permission no.: Desk-22(8)/Research/CR-8(18-19)/875/2018-19) was obtained for tissue collection efforts from road-killed animals. We are grateful to the three anonymous reviewers whose insightful comments and suggestions substantially improved the quality and clarity of this manuscript.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Johnsgard, P.A. The Quails, Partridges, and Francolins of the World; Oxford University Press: Oxford, UK, 1988; ISBN 978-0-19-857193-3. [Google Scholar]
  2. Minvielle, F. The Future of Japanese Quail for Research and Production. World’s Poult. Sci. J. 2004, 60, 500–507. [Google Scholar] [CrossRef] [Scilit]
  3. Kawahara-Miki, R.; Sano, S.; Nunome, M.; Shimmura, T.; Kuwayama, T.; Takahashi, S.; Kawashima, T.; Matsuda, Y.; Yoshimura, T.; Kono, T. Next-Generation Sequencing Reveals Genomic Features in the Japanese Quail. Genomics 2013, 101, 345–353. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Wu, Y.; Zhang, Y.; Hou, Z.; Fan, G.; Pi, J.; Sun, S.; Chen, J.; Liu, H.; Du, X.; Shen, J.; et al. Population Genomic Data Reveal Genes Related to Important Traits of Quail. GigaScience 2018, 7, giy049. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Morris, K.M.; Hindle, M.M.; Boitard, S.; Burt, D.W.; Danner, A.F.; Eory, L.; Forrest, H.L.; Gourichon, D.; Gros, J.; Hillier, L.W.; et al. The Quail Genome: Insights into Social Behaviour, Seasonal Biology and Infectious Disease Response. BMC Biol. 2020, 18, 14. [Google Scholar] [CrossRef] [Scilit]
  6. Dey, P.; Ray, S.D.; Manchi, S.; Pramod, P.; Kochiganti, V.H.S.; Singh, R.P. Whole Genome Sequencing and Microsatellite Motif Discovery of Farmed Japanese Quail (Coturnix japonica): A First Record from India. Proc. Indian Natl. Sci. Acad. 2022, 88, 688–695. [Google Scholar] [CrossRef] [Scilit]
  7. McGowan, P.J.K.; Kirwan, G.M. Japanese Quail (Coturnix japonica), Version 1.0. Birds of the World 2020. Available online: https://birdsoftheworld.org/bow/species/japqua/1.0/introduction (accessed on 22 May 2025).
  8. McGowan, P.J.K.; Kirwan, G.M.; de Juana, E.; Boesman, P.F.D. Common Quail (Coturnix coturnix), Version 1.1. Birds of the World 2023. Available online: https://birdsoftheworld.org/bow/species/comqua1/1.1/introduction (accessed on 22 May 2025).
  9. Stein, R.W.; Brown, J.W.; Mooers, A.Ø. A Molecular Genetic Time Scale Demonstrates Cretaceous Origins and Multiple Diversification Rate Shifts within the Order Galliformes (Aves). Mol. Phylogenet. Evol. 2015, 92, 155–164. [Google Scholar] [CrossRef] [Scilit]
  10. Wang, N.; Kimball, R.T.; Braun, E.L.; Liang, B.; Zhang, Z. Ancestral Range Reconstruction of Galliformes: The Effects of Topology and Taxon Sampling. J. Biogeogr. 2017, 44, 122–135. [Google Scholar] [CrossRef] [Scilit]
  11. Dey, P.; Ray, S.D.; Kochiganti, V.H.S.; Pukazhenthi, B.S.; Koepfli, K.-P.; Singh, R.P. Mitogenomic Insights into the Evolution, Divergence Time, and Ancestral Ranges of Coturnix Quails. Genes 2024, 15, 742. [Google Scholar] [CrossRef] [Scilit]
  12. Ahmed, A. Live Bird Trade in Northern India; TRAFFIC-India: New Delhi, India, 1997. [Google Scholar]
  13. Wolf, C.; Rentsch, J.; Hübner, P. PCR−RFLP Analysis of Mitochondrial DNA: A Reliable Method for Species Identification. J. Agric. Food Chem. 1999, 47, 1350–1355. [Google Scholar] [CrossRef] [Scilit]
  14. Rojas, M.; González, I.; Fajardo, V.; Martín, I.; Hernández, P.E.; garcía, T.; Martín, R. Polymerase Chain Reaction-Restriction Fragment Length Polymorphism Authentication of Raw Meats from Game Birds. J. Aoac Int. 2008, 91, 1416–1422. [Google Scholar] [CrossRef] [Scilit]
  15. Government of India. Prohibition of Farming of Japanese Quails (F. No. 3-3/2011/WL-1). Available online: https://sansad.in/getFile/debatestextmk/15/IX/2012-Final.pdf?source=loksabhadocs (accessed on 22 May 2025).
  16. Government of India. Removal of Farm Bred Variety of Japanese Quail (F.No.1-15/2013-WL, 2013). Available online: https://forest.kerala.gov.in/kfstorage/2024/11/gazette27032014-22.pdf (accessed on 22 May 2025).
  17. Boonseub, S.; Tobe, S.S.; Linacre, A.M.T. The Use of Mitochondrial DNA Genes to Identify Closely Related Avian Species. Forensic Sci. Int. Genet. Suppl. Ser. 2009, 2, 275–277. [Google Scholar] [CrossRef] [Scilit]
  18. Elyasi Gorji, Z.; Izadpanah, M.; Hadi, F.; Zare, M. Mitochondrial Genes as Strong Molecular Markers for Species Identification. Nucleus 2022, 66, 81–93. [Google Scholar] [CrossRef] [Scilit]
  19. He, H.; Wang, Y.; Qing, Y.; Li, D.; Zhao, X.; Zhu, Q.; Yin, H. Molecular Authentication of Meats from Three Terrestrial Birds Based on Pcr-Rflp Analysis of the Mitochondrial 12S rRNA Gene. Braz. J. Poult. Sci. 2018, 20, 651–656. [Google Scholar] [CrossRef] [Scilit]
  20. Liu, K.; Wu, M.; Lin, X.; Lonan, P.; Chen, S.; Wu, Y.; Lai, X.; Yu, L.; Zhou, X.; Li, G. Molecular Analysis of Edible Bird’s Nest and Rapid Authentication of Aerodramus fuciphagus from Its Subspecies by PCR-RFLP Based on the Cytb Gene. Anal. Methods 2020, 12, 2710–2717. [Google Scholar] [CrossRef] [Scilit]
  21. Aranishi, F.; Okimoto, T.; Izumi, S. Identification of Gadoid Species (Pisces, Gadidae) by PCR-RFLP Analysis. J. Appl. Genet. 2005, 46, 69–73. [Google Scholar]
  22. Canfield, S.; Bowen, B. A Rapid PCR-RFLP Method for Species Identification of the Eastern Pacific Horn Sharks (Genus Heterodontus). Conserv. Genet. Resour. 2021, 13, 79–84. [Google Scholar] [CrossRef] [Scilit]
  23. Ellegren, H. Microsatellites: Simple Sequences with Complex Evolution. Nat. Rev. Genet. 2004, 5, 435–445. [Google Scholar] [CrossRef] [Scilit]
  24. Davey, J.W.; Hohenlohe, P.A.; Etter, P.D.; Boone, J.Q.; Catchen, J.M.; Blaxter, M.L. Genome-Wide Genetic Marker Discovery and Genotyping Using next-Generation Sequencing. Nat. Rev. Genet. 2011, 12, 499–510. [Google Scholar] [CrossRef] [Scilit]
  25. Castoe, T.A.; Poole, A.W.; de Koning, A.P.J.; Jones, K.L.; Tomback, D.F.; Oyler-McCance, S.J.; Fike, J.A.; Lance, S.L.; Streicher, J.W.; Smith, E.N.; et al. Rapid Microsatellite Identification from Illumina Paired-End Genomic Sequencing in Two Birds and a Snake. PLoS ONE 2012, 7, e30953. [Google Scholar] [CrossRef] [Scilit]
  26. Mondal, T.; Dey, P.; Kumari, D.; Ray, S.D.; Quadros, G.; Sastry Kochiganti, V.H.; Singh, R.P. Genome Survey Sequencing and Mining of Genome-Wide Microsatellite Markers in Yellow-Billed Babbler (Turdoides affinis). Heliyon 2023, 9, e12735. [Google Scholar] [CrossRef] [Scilit]
  27. Grimmett, R.; Inskipp, C.; Inskipp, T. Birds of the Indian Subcontinent: India, Pakistan, Sri Lanka, Nepal, Bhutan, Bangladesh and the Maldives; Bloomsbury Publishing: New Delhi, India, 2016; ISBN 978-1-4081-6265-1. [Google Scholar]
  28. Sambrook, J. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor: New York, NY, USA, 1989; Volume 3, ISBN 978-0-87969-577-4. [Google Scholar]
  29. Du, L.; Zhang, C.; Liu, Q.; Zhang, X.; Yue, B. Krait: An Ultrafast Tool for Genome-Wide Survey of Microsatellites and Primer Design. Bioinformatics 2018, 34, 681–683. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  30. Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3—New Capabilities and Interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  31. Kalendar, R.; Lee, D.; Schulman, A.H. FastPCR Software for PCR, in Silico PCR, and Oligonucleotide Assembly and Analysis. Methods Mol. Biol. 2014, 1116, 271–302. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Rajendrakumar, P.; Biswal, A.K.; Balachandran, S.M.; Srinivasarao, K.; Sundaram, R.M. Simple Sequence Repeats in Organellar Genomes of Rice: Frequency and Distribution in Genic and Intergenic Regions. Bioinformatics 2007, 23, 1–4. [Google Scholar] [CrossRef] [Scilit]
  33. Nagpure, N.S.; Rashid, I.; Pathak, A.K.; Singh, M.; Singh, S.P.; Sarkar, U.K. In Silico Analysis of SSRs in Mitochondrial Genomes of Fishes. 2015. Available online: https://pubmed.ncbi.nlm.nih.gov/24660911/ (accessed on 22 May 2025).
  34. Kuntal, H.; Sharma, V. In Silico Analysis of SSRs in Mitochondrial Genomes of Plants. OMICS 2011, 15, 783–789. [Google Scholar] [CrossRef] [Scilit]
  35. Filiz, E. SSRs Mining of Brassica Species in Mitochondrial Genomes: Bioinformatic Approaches. Hortic. Environ. Biotechnol. 2013, 54, 548–553. [Google Scholar] [CrossRef] [Scilit]
  36. Kumar, S.; Kumari, S.; Shanker, A. In Silico Mining of Simple Sequence Repeats in Mitochondrial Genomes of Genus Orthotrichum. J. Sci. Res. 2020, 64, 179–182. [Google Scholar] [CrossRef] [Scilit]
  37. Rudnick, J.A.; Katzner, T.E.; Bragin, E.A.; DeWOODY, J.A. Species Identification of Birds through Genetic Analysis of Naturally Shed Feathers. Mol. Ecol. Notes 2007, 7, 757–762. [Google Scholar] [CrossRef] [Scilit]
  38. Zehner, R.; Zimmermann, S.; Mebs, D. RFLP and Sequence Analysis of the Cytochrome b Gene of Selected Animals and Man: Methodology and Forensic Application. Int. J. Leg. Med. 1998, 111, 323–327. [Google Scholar] [CrossRef] [Scilit]
  39. Derégnaucourt, S.; Guyomarc’h, J.-C.; Spanò, S. Behavioural Evidence of Hybridization (Japanese × European) in Domestic Quail Released as Game Birds. Appl. Anim. Behav. Sci. 2005, 94, 303–318. [Google Scholar] [CrossRef] [Scilit]
  40. Puigcerver, M.; Vinyoles, D.; Rodríguez-Teijeiro, J.D. Does Restocking with Japanese Quail or Hybrids Affect Native Populations of Common Quail Coturnix Coturnix? Biol. Conserv. 2007, 136, 628–635. [Google Scholar] [CrossRef] [Scilit]
  41. Smith, S.; Fusani, L.; Boglarka, B.; Sanchez-Donoso, I.; Marasco, V. Lack of Introgression of Japanese Quail in a Captive Population of Common Quail. Eur. J. Wildl. Res. 2018, 64. [Google Scholar] [CrossRef] [Scilit]
  42. Sanchez-Donoso, I.; Vilà, C.; Puigcerver, M.; Butkauskas, D.; de la Calle, J.R.C.; Morales-Rodríguez, P.A.; Rodríguez-Teijeiro, J.D. Are Farm-Reared Quails for Game Restocking Really Common Quails (Coturnix coturnix)?: A Genetic Approach. PLoS ONE 2012, 7, e39031. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Sanchez-Donoso, I.; Ravagni, S.; Rodríguez-Teijeiro, J.D.; Christmas, M.J.; Huang, Y.; Maldonado-Linares, A.; Puigcerver, M.; Jiménez-Blasco, I.; Andrade, P.; Gonçalves, D.; et al. Massive Genome Inversion Drives Coexistence of Divergent Morphs in Common Quails. Curr. Biol. 2022, 32, 462–469.e6. [Google Scholar] [CrossRef] [Scilit]
  44. Barilani, M.; Deregnaucourt, S.; Gallego, S.; Galli, L.; Mucci, N.; Piombo, R.; Puigcerver, M.; Rimondi, S.; Rodríguez-Teijeiro, J.D.; Spanò, S.; et al. Detecting Hybridization in Wild (Coturnix c. Coturnix) and Domesticated (Coturnix c. Japonica) Quail Populations. Biol. Conserv. 2005, 126, 445–455. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Schematic representation of the two strategies adopted to design a reliable molecular method to distinguish Common Quail (Coturnix coturnix) and Japanese Quail (Coturnix japonica) individuals in this study. (A) The approach adopted to utilizing mitogenomic SSR-based markers. (B) Strategy adopted to validate novel PCR-restriction fragment length polymorphism method. The oligonucleotide sequences shown span positions 7192–7201 in the Common Quail mitogenome and positions 7193–7202 in the Japanese Quail mitogenome. The nucleotide polymorphism highlighted demonstrates the species-specific BsaBI restriction site present at position 7200 in Common Quail (total mitogenome length: 16,696 bp) but absent in Japanese Quail due to a single nucleotide difference at the corresponding position 7201 (total mitogenome length: 16,698 bp).
Figure 1. Schematic representation of the two strategies adopted to design a reliable molecular method to distinguish Common Quail (Coturnix coturnix) and Japanese Quail (Coturnix japonica) individuals in this study. (A) The approach adopted to utilizing mitogenomic SSR-based markers. (B) Strategy adopted to validate novel PCR-restriction fragment length polymorphism method. The oligonucleotide sequences shown span positions 7192–7201 in the Common Quail mitogenome and positions 7193–7202 in the Japanese Quail mitogenome. The nucleotide polymorphism highlighted demonstrates the species-specific BsaBI restriction site present at position 7200 in Common Quail (total mitogenome length: 16,696 bp) but absent in Japanese Quail due to a single nucleotide difference at the corresponding position 7201 (total mitogenome length: 16,698 bp).
Birds 06 00028 g001
Figure 2. Agarose gel showing band patterns of PCR amplification for primers CQ1, CQ2, CQ3, JQ1, JQ2, and JQ3 in the photo plates (AF), respectively. Japanese Quail (Coturnix japonica) samples are represented by numbers 1–8 and Common Quail (Coturnix coturnix) individuals are represented by number 9–10. NTC represents non-template control. DNA ladder used is GelPilot 100 bp plus ladder with size fragments mentioned in the image (Qiagen NV, Germany). Amplification for all the samples for all six primers are visible.
Figure 2. Agarose gel showing band patterns of PCR amplification for primers CQ1, CQ2, CQ3, JQ1, JQ2, and JQ3 in the photo plates (AF), respectively. Japanese Quail (Coturnix japonica) samples are represented by numbers 1–8 and Common Quail (Coturnix coturnix) individuals are represented by number 9–10. NTC represents non-template control. DNA ladder used is GelPilot 100 bp plus ladder with size fragments mentioned in the image (Qiagen NV, Germany). Amplification for all the samples for all six primers are visible.
Birds 06 00028 g002
Figure 3. PCR-RFLP banding pattern visualized on agarose gel. (A) After digestion of jqcqre_1 PCR amplicon with BsaBI enzyme, Japanese Quail (Coturnix japonica) individuals show undigested single ~850 bp band (samples 1–8), whereas Common Quail (Coturnix coturnix) individuals (samples 9–10) after restriction digestion show two bands of ~637 bp and ~213 bp. (B) Under optimized conditions (7 units of BsaBI enzyme, 50 ng of PCR product, and a 220 min incubation at 60 °C), after restriction digestion of jqcqre_1 PCR amplicon (samples 9–10), Common Quail show complete digestion of ~850 bp amplicon into ~637 bp and ~213 bp fragments.
Figure 3. PCR-RFLP banding pattern visualized on agarose gel. (A) After digestion of jqcqre_1 PCR amplicon with BsaBI enzyme, Japanese Quail (Coturnix japonica) individuals show undigested single ~850 bp band (samples 1–8), whereas Common Quail (Coturnix coturnix) individuals (samples 9–10) after restriction digestion show two bands of ~637 bp and ~213 bp. (B) Under optimized conditions (7 units of BsaBI enzyme, 50 ng of PCR product, and a 220 min incubation at 60 °C), after restriction digestion of jqcqre_1 PCR amplicon (samples 9–10), Common Quail show complete digestion of ~850 bp amplicon into ~637 bp and ~213 bp fragments.
Birds 06 00028 g003
Table 1. Sequence of mitogenomic SSR primers developed in this study from flanking regions of SSR sequences and primer developed for PCR-RFLP method using the COX1 gene of Common Quail (Coturnix coturnix) and Japanese Quail (Coturnix japonica).
Table 1. Sequence of mitogenomic SSR primers developed in this study from flanking regions of SSR sequences and primer developed for PCR-RFLP method using the COX1 gene of Common Quail (Coturnix coturnix) and Japanese Quail (Coturnix japonica).
Primer NameDirectionPrimer Sequence (5′-3′)Position on Respective Mitogenomes
(Start–End)
CQ1ForwardTCACAGCCCTCCTACTCTCC5562–5582
ReverseTGCTAGTAGGGTGAGGAGGG
CQ2ForwardGGCTTAGCTGGTATGCCCC7898–7915
ReverseTGAGATTAAGGAGCCGATTGAGG
CQ3ForwardCCTCCTTACCCCCATCATCC13,065–13,087
ReverseAGGCGGTTTTAACGGTTTTGG
JQ1ForwardTGCTTGCCGGACATATTTTTACC911–946
ReverseGGTTTGAGGGTATTTGTGCGG
JQ2ForwardCAGCACTTCCTAGGCCTAGC7899–7916
ReverseACTTTACGTTTTGCTGAGAAGGC
JQ3ForwardTCCTCCTTACCCCCATTATCC13,067–13,089
ReverseGGTAATGATGCTGTCTGTGCC
jqcqre_1ForwardCAACCGATGACTATTTTCAACTAACCA6583/6584–7412/7413
ReverseTCCTACTGTGAATATATGGTGGGC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Dey, P.; Sastry, K.V.H.; Singh, R.P. A PCR-RFLP Method for Distinguishing Closely Related Common Quail (Coturnix coturnix) and Japanese Quail (Coturnix japonica): Forensics and Conservation Implications. Birds 2025, 6, 28. https://doi.org/10.3390/birds6020028

AMA Style

Dey P, Sastry KVH, Singh RP. A PCR-RFLP Method for Distinguishing Closely Related Common Quail (Coturnix coturnix) and Japanese Quail (Coturnix japonica): Forensics and Conservation Implications. Birds. 2025; 6(2):28. https://doi.org/10.3390/birds6020028

Chicago/Turabian Style

Dey, Prateek, Kochiganti Venkata Hanumat Sastry, and Ram Pratap Singh. 2025. "A PCR-RFLP Method for Distinguishing Closely Related Common Quail (Coturnix coturnix) and Japanese Quail (Coturnix japonica): Forensics and Conservation Implications" Birds 6, no. 2: 28. https://doi.org/10.3390/birds6020028

APA Style

Dey, P., Sastry, K. V. H., & Singh, R. P. (2025). A PCR-RFLP Method for Distinguishing Closely Related Common Quail (Coturnix coturnix) and Japanese Quail (Coturnix japonica): Forensics and Conservation Implications. Birds, 6(2), 28. https://doi.org/10.3390/birds6020028

Article Metrics

Back to TopTop