Abstract
Dairy cows rely on their complex rumen microbial community to convert host-indigestible feed into nutrients usable for host growth, maintenance, and milk production. Previous work by our group found that the rumen bacterial community is dynamic over the course of two lactations and that cows with high and low milk production efficiency (MPE) have different taxa associated with either phenotype. Here, we characterized the ruminal fungal and archaeal communities to determine if these microbial populations exhibit properties similar to that of the rumen bacteria with respect to MPE over time. Our results show a decrease in fungal diversity over the course of both lactation cycles with an increase during the transition period. The fungal community had only a few taxa associated with efficiency. For the ruminal archaea, we found no change in diversity across both lactation cycles and only taxa in the genus Methanospera were found to be more abundant in high-MPE cows. Given that our previous study used 454 pyrosequencing, we also sought to determine if a resequencing of these communities using Illumina-based technology would alter our previous findings. We found that resequencing showed no significant deviation from our original broad conclusions, with the exception of some minor taxonomic associations.
1. Introduction
The dairy sector is a significant contributor to the agricultural industry worldwide [1]. Through breeding and management practices, milk production efficiency (MPE) in dairy cows has improved markedly over the last few decades, but these practices have resulted in decreased animal health and longevity [2]. As a result, there is a need for additional strategies to improve MPE that would minimize negative animal health impacts, and recent studies have suggested that the rumen microbiome is an attractive target with little to no cost to the host [3].
This idea is in line with our understanding that ruminants rely solely on the microbes in their rumen for the degradation and conversion of feed substrates into host-accessible nutrients in the form of volatile fatty acids (VFAs) [4]. Importantly, the rumen contains a diverse microbial community containing all three domains of life. Bacteria are the primary fermenters of feed-derived polysaccharides, which they convert into VFAs that are absorbed by the host for energy [4]. Fungi also play an important role in plant fiber degradation and fermentation as physical and molecular drivers of recalcitrant polysaccharide conversion that make available substrates fermentable by the bacteria [5]. The archaeal community consists almost exclusively of methanogens, which rely on the H2 produced by other ruminal microorganisms to produce methane [6]. Finally, protozoa help maintain a host-favorable rumen environment through their cellulolytic and bacterial predatory activity, while producing significant amounts of H2 for archaeal consumption [4].
Of these four groups, bacteria are arguably the most studied and their community composition and dynamics have been correlated with a number of phenotypes such as increases or decreases in MPE [7,8,9]. Much less work has been performed on the fungi and archaea, given that they are known to be significantly lower in both diversity and biomass, relative to the bacteria, and due to the difficulty in accurately characterizing their members [6,10]. As such, most studies on these taxa are focused on the evaluation of fungal by-products to improve digestibility [11,12] or on feed additives capable of modulating methane production [6,13]. To date, there have been relatively few investigations on the native fungal and archaeal communities as they relate to MPE in Holstein dairy cows.
In a previous study by our group [8] on 13 parity-matched cannulated Holstein cows, we associated changes in the ruminal bacterial microbiota across two lactation cycles with MPE. Over the course of that study, feed consumption and milk production data along with ruminal solid and liquids during the early (76 to 82 days in milk [DIM]), middle (151 to 157 DIM), and late (251 to 257 DIM) periods of each lactation cycle were collected. We found that the ruminal microbiota is dynamic over the course of lactation and that high- and low-MPE cows had distinct bacterial microbiotas. Moreover, our analyses identified specific taxa associated with either high- or low-MPE cows.
While that study, and others, have shaped our understanding of the role of the rumen microbiome in MPE, what is lacking is a consideration of the role of the fungal and archaeal ruminal microbes. As such, the objective of this study is to determine if the fungal and archaeal ruminal communities are different with respect to MPE over time, as we previously observed for the ruminal bacteria. Moreover, we note that our previous study was published over a decade ago using 454-based pyrosequencing, and the intervening period has seen significant improvements in both sequencing technology and analysis techniques, such as the transition of taxonomic classification systems from operational taxonomic units (OTUs) to amplicon sequencing variants (ASVs). To address these gaps in knowledge, we characterized the fungal and archaeal ruminal microbiotas from our original study and further resequenced the bacterial communities using Illumina sequencing technology. We hypothesized that the rumen fungal and archaeal communities would be similar to our findings for the rumen bacteria, in that they would be dynamic over the course of both lactation cycles, with high- and low-MPE cows harboring distinct rumen microbiotas. Finally, we also hypothesized that our resequencing of the ruminal bacterial communities would not alter our original findings obtained using 454 pyrosequencing.
2. Materials and Methods
2.1. Sample Collection
Samples used in this study were collected as part of a previous study [8] and the extracted DNA of each sample was stored at −80 °C from their initial usage. Briefly, 13 lactating cannulated Holstein dairy cows of similar age and parity were fed a total mixed ration (TMR) [14] after morning milking during the course of the study. Feed intake, refusal weights, and feed samples were collected over 7 consecutive days within three periods (early: 76 to 82 DIM; middle: 151 to 157 DIM; and late: 251 to 257 DIM) over their first and second lactation cycles. Dry matter intake and energy corrected milk (ECM = kilograms of milk × [0.0327 + (0.1296 × percent fat) + (0.072 × percent true protein)]) were calculated and plotted as residual feed intake (RFI). Cows were classified as high- or low-efficiency based on pairs of positive and negative RFI cows. Rumen samples were collected through the cannula just prior to once-daily feeding for three consecutive days within each lactation period and cycle. The mixed samples were strained through four layers of cheese-cloth, followed by squeezing to remove the remaining rumen liquid from the solids. Solid and liquid samples were stored at −80 °C until DNA extraction was performed. Of note, cows were maintained on Total Mixed Rations (TMR) throughout both lactation cycles, with slight changes in ingredient composition due to component availability and price. The complete breakdown of the components in the TMR are available in Supplementary Table S1 of our previous publication by Jewell et al. [8].
2.2. DNA Extraction, PCR Amplification, and Sequencing
Total genomic DNA was previously extracted using a mechanical cellular disruption method and a hot/cold phenol extraction protocol, as described [8]. DNA was quantified using a Qubit fluorometer reagent (Invitrogen, Waltham, MA, USA) and a Synergy 2 microplate reader (BioTek, Winooksi, VT, USA). Bacterial community sequencing was performed via the amplification of the V4 region of the 16S rRNA gene using one-step universal barcoded bacterial primers (F-GTGCCAGCMGCCGCGGTAA; R-GGACTACHVGGGTWTCTAAT), as described [15]. Fungal sequences were amplified using the internal transcribed spacer 4 (ITS4) region [16] with one-step custom barcoded primers (ITS4 5′-AATGATACGGCGACCACCGAGATCTACACTATGGTAATTAAAGCCTCCGCTTA TTGATATGCTTAART-3′), as previously described [15]. The V6–V8 region of the archaeal 16S rRNA gene was amplified using two-step primers (Ar915aF-AGGAATTGGCGGGGGAGC AC, Ar1386R-GCGGTGTGTGCAAGGAGC) [17]. PCR was conducted using the described barcoded primers for bacteria, fungi, and archaea for each sample, as follows. A total of 25–50 ng of DNA and 0.2 μmol/L of primer were combined in a 25 μL reaction with 2× KAPA HiFi HotStart ReadyMix (KAPA Biosystems, Wilmington, MA, USA). PCR reactions were run on a Bio-Rad C1000 touch thermocycler (Bio-Rad Laboratories, Hercules, CA, USA) with the following conditions, 95 °C for 3 min, 25 cycles (fungal and archaea: 35 cycles) of 95 °C for 30 s, 55 °C for 30 s, and 72 °C for 30 s, followed by a final extension at 72 °C for 5 min. The archaeal PCR products were column-purified using the PureLink Pro 96 PCR Purification kit (Invitrogen, Waltham, MA, USA). A second PCR was performed under the same conditions with 5 μL of cleaned product for 8 cycles to attach both Illumina sequencing adapters and unique barcodes for multiplexing.
PCR products were run on a 1% (w/v) AquaPor low-melt agarose gel (National Diagnostics, Atlanta, GA, USA) and amplified bands were extracted from the gel using the ZR-96 Zymoclean Gel DNA Recovery Kit (Zymo Research, Irvine, CA, USA). The purified extracts were then quantified on a Qubit fluorometer or a 96-well plate spectrophotometer and a library of each amplicon type was created using a 4 nmol/L equimolar pool of all PCR products. The bacterial library was then sequenced on an Illumina MiSeq (Illumina, Inc., San Diego, CA, USA) following standard Illumina sequencing protocols using a MiSeq v2 2 × 250 bp sequencing kit at 10 pmol/L and with a 10% PhiX control. Fungal and archaeal sequencing was similarly performed on an Illumina MiSeq using a MiSeq v3 2 × 300 bp sequencing kit. Sequences from this project are deposited in the National Center for Biotechnology Information (NCBI) Short Read Archive (SRA) under Bioproject Accession PRJNA1048886.
2.3. Sequence Analysis
Bacterial sequences from the first lactation cycle have previously been reported [18] and were obtained via the NCBI’s SRA under Bioproject Accesssion PRJNA156883. The second-lactation bacterial sequences, and fungal sequences from both lactation cycles, were generated in this study and were processed with the software QIIME 2 v2023.2 [19]. Demultiplexed raw sequences were imported using the Casava 1.8 format and denoised using DADA2 (via qiime-dada2 plugin) [20] to generate a feature table containing ASVs. Bacterial taxonomy was classified using the classify-sklearn naive Bayes taxonomy classifier [21] against the SILVA (v138.1) 16S rRNA gene database [22], and fungal taxonomy was determined using the UNITE v9.0 database for ITS-based genes [23]. The features and a taxonomy table were generated and were then imported into R as a phyloseq object [24] for further analysis.
Due to poor classification with ASVs in QIIME, archaeal sequences from both lactation cycles were processed using mothur v.1.44.0 [25], as previously described [26]. Briefly, paired-end sequences were combined into contigs, and poor-quality sequences were removed, followed by clustering using the OptiClust algorithm. Sequences were subsequently aligned against the SILVA 16S rRNA gene database and contigs that did not align were removed. Sequences were pre-clustered to reduce sequencing error and chimera detection and removal was performed. The sequences were classified to the SILVA (v138.1) database and assigned to OTUs at a 97% sequence similarity. Sample coverage was assessed by Good’s index [27] in mothur. Finally, samples were normalized by total group (relative abundance × lowest number of sequences per sample). The resulting OTU and taxonomy tables were then imported into R as a phyloseq object for further analysis.
2.4. Statistical Analysis
All statistical analyses were performed in R version 4.3.1 (16 June 2023) using the phyloseq package. Phenotype data for all cows in this study were obtained from our previous study, including the delineation of cows into either low- or high-efficiency groups [8]. The focus of this study was to compare cows of similar dry matter intake but with differing energy-corrected milk production. Due to the cows being fed the same diet, dietary parameters were not evaluated. Alpha diversity metrics were calculated and assessed using the Kruskal–Wallis rank-sum test and further pairwise comparisons between groups were performed using the Wilcoxon rank-sum test. Beta diversity was calculated as Bray–Curtis dissimilarity [28] and visualized by principal coordinate analysis (PCoA) plots using the MicrobiotaProcess package [29]. Distances in the PCoA values within groups were calculated by permutation tests of multivariate homogeneity of group dispersions (PERMDISP) using the vegan package (version 2.6-4 (11 October 2022)). To determine if beta-diversity varied by period and ruminal fraction, we first evaluated the data for normalcy using PERMDISP. Based on these results, we used permutational analysis of variance (PERMANOVA, number of permutation = 10,000) to evaluate significance. If PERMANOVA was significant (p < 0.05), we evaluated the specific periods that were significant via the pairwiseAdonis package (version 0.4 (28 April 2020)). Differences in the composition of ASVs at the genus level according to MPE group were assessed by DESeq2 [30]. All tests were assessed at significance p < 0.05 using false discovery rate (FDR) correction.
3. Results
3.1. Experimental Design and Production Data
The data reported here are based on a previous study from our group that investigated 14 cannulated cows over the course of two lactation cycles [8]. All production data for these cows have been previously reported, and definitions of high and low efficiency were retained from that study.
3.2. The Ruminal Bacterial Community Is Distinct Between Fractions but Only Slightly Different in Terms of Periodicity and Efficiency
Overall bacterial sequencing yielded 24,460,966 high-quality, filtered reads that clustered into 9382 ASVs that classified into 25 phyla, 139 families, and 290 genera. Bacterial communities were predominantly composed of taxa within the phyla Bacteroidota, Firmicutes, and Proteobacteria. Within these phyla, the most abundant families included Prevotellaceae and Succinivibrionaceae with smaller contributions from Lachnospiraceae, and Acidaminococcaceae (Supplementary Figure S1A2).
Alpha diversity was measured using Chao1 richness and Shannon’s diversity indices, and showed that the bacterial community differs significantly (Kruskal–Wallis: p = 4.2 × 10−6 and p = 8.5 × 10−8, respectively) between the rumen solid and liquid fractions (Table 1). However, richness and diversity did not differ between high- and low-efficiency bacterial communities in either ruminal fraction. When evaluated by period (early, middle, and late) across both lactation cycles, there was a steady increase in diversity and richness in ruminal liquids over the course of a single lactation cycle (Supplementary Figure S2A). The ruminal solids had a slight decrease in diversity during the second lactation cycle and uneven decreases in richness over both lactation cycles.
Table 1.
Mean alpha diversity values ± SEM.
Beta diversity was visualized using faceted PCoA plots between both lactation cycles (Figure 1A). A Bray–Curtis dissimilarity analysis exhibited a significant difference between the solid and liquid fractions (PERMANOVA, p = 1 × 10−4). For the liquid fraction bacterial communities, there were significant changes between the early period of the first lactation cycle and the late period of the first lactation cycle (PERMANOVA, p = 0.03), the middle period of the second lactation cycle (PERMANOVA, p = 0.03), and the late period of the second lactation cycle (PERMANOVA, p = 0.04). There were no significant differences between periods for the solid fraction communities. Similarly, there was no difference in beta diversity when evaluated by efficiency.
Figure 1.
Principal coordinate analysis (PCoA) plot of the Bray–Curtis dissimilarity index for the rumen bacterial (A), fungal (B), and archaeal (C) communities. Plots are split by lactation cycle, with individual points representing rumen samples, different colors showing period in lactation cycle, and different shapes showing ruminal phase.
Bacterial taxa found to be differentially abundant in high-efficiency cows belonged primarily to the families Lachnospiraceae and Prevotellaceae (Table 2). Unique to the high efficiency group were members of the families Acidaminococcaceae, Selenomonadaceae, Succinivibrionaceae, Anaerovoracaceae, Desulfovibrionaceae, Erysipelotrichaceae, candidate family F082, Oscillospiraceae and Veillonellaceae. A total of 11 and 17 genera were found to be highly abundant in the solid and liquid communities of high-efficiency cows, respectively. Of these, three distinct genera were found in both the solid and liquid fractions, with one distinct to the solid and ten to the liquid fractions. Similarly, low-efficiency cows primarily featured taxa in the families Lachnospiraceae and Prevotellaceae but had less uniquely abundant taxa. Specifically, taxa within the families Muribaculaceae, Spirochaetaceae, and Ruminococcaceae were abundant and distinct in low-efficiency cows and were composed of members of Muribaculaceae, Treponema, and Ruminococcus. Notably, there were no differentially abundant taxa found between high- and low-efficiency cows during the first lactation cycle.
Table 2.
Genera which changed significantly between at least one pairwise efficiency–lactation period comparison (DESeq2. p < 0.05). Fungal and archaeal kingdoms are grouped into rumen solid and liquid samples due to their low diversity in the rumen. Taxonomic identities may represent multiple ASVs or OTUs identified as significant. Closed circles (•) indicate that the genus is found only in that lactation period for either high- or low-efficiency cows. Open squares (□) identify genera that are found in both efficiencies for that period but differ by ASV or OTU identification. The absence of a symbol indicates that there were no differences.
3.3. The Rumen Fungal Community Varies Across Lactation Periods
Fungal sequencing yielded a total of 7,796,986 high-quality, filtered reads that clustered into 1496 ASVs that classified into 9 phyla, 109 families and 184 genera. The rumen fungal community was dominated by members of the phylum Neocallimastigomycota and the family Neocallimastigaceae (Supplementary Figure S1B2).
Alpha diversity was determined using Chao1 richness and Shannon’s diversity indices and demonstrated that the fungal community differs significantly (Kruskal–Wallis: p = 2.2 × 10−16 and p = 0.001, respectively) between the rumen solid and liquid fractions (Table 1). Richness and diversity did not differ significantly when compared between efficiency and ruminal phase. The ruminal solids showed a significant decrease in diversity over both lactation cycles, with a notable increase from the late period of the first lactation to the early period of the second (Supplementary Figure S2B). Comparably, there was a decrease in diversity in the liquid fraction, although to a lesser extent. There was a similar decrease in richness in the solid fraction but an uneven change in the richness of the liquid fraction.
Beta diversity analysis showed that the Bray–Curtis dissimilarities of the fungal communities did not differ by ruminal fraction (Figure 1B). In the liquid fraction, the early period of the first lactation cycle was distinct from all other periods (PERMANOVA, p = 0.001). Similarly, the early period of the second lactation cycle was significantly different from the late period of the second lactation (PERMANOVA, p = 0.001). The middle period of the first lactation was significantly different (PERMANOVA, p = 0.04) from the late period of the first lactation. There were no significant changes in the solid fraction across all periods in both lactation cycles. Additionally, there was no difference in beta diversity when evaluated by efficiency.
Due to the low diversity of the fungal community, rumen solids and liquids were pooled for the identification of differentially abundant taxa. We found that distinct members of the family Neocallimastigaceae were differentially abundant in both efficiency groups (Table 2). The genus Caecomyces was found to be distinct in high-efficiency cows across all three periods of the second lactation cycle, whereas members of the genus Piromyces were found to be distinct in low-efficiency cows across all three periods of the first lactation cycle. Different ASVs of the genus Neocallimastix were also found to be distinct in the first lactation cycle of both efficiencies.
3.4. The Diversity of the Rumen Archaeal Community Varies Little Across Periodicity and Efficiency
Archaeal sequencing yielded 159,397 high-quality, filtered reads that clustered into 399 OTUs belonging to four phyla, seven families, and nine genera. The phylum Euryarchaeota was the most abundant, followed by Thermoplasmatota. The most dominant archaeal family was Methanobacteriaceae in the Euryarchaeota (Supplementary Figure S1C2).
Alpha diversity indices demonstrated that the archaeal community did not differ significantly between the rumen solid and liquid fractions (Table 1). Both richness and diversity did not differ across lactation cycles (Supplementary Figure S2C). Bray–Curtis dissimilarity did not differ significantly by ruminal phase, period, or lactation (Figure 1C). Due to the low diversity of the rumen archaeal community, the solid and liquid fractions were pooled for differential analysis. Only members in the genus Methanosphaera (family Methanobacteriaceae) were found to be differentially abundant in high-efficiency cows, and there were no differentially abundant taxa found in low-efficiency cows.
4. Discussion
Here, we expand upon our understanding of the ruminal microbiome as it pertains to MPE by showing that, when compared to bacteria, there are fewer fungal and archaeal compositional differences between high- and low-MPE animals. Our data do not support our initial hypothesis that these communities would follow the same pattern exhibited by the ruminal bacterial community in our original study. This suggests that the bacterial community composition is a more likely indicator of MPE compared to the fungal and archaeal communities. In addition, our study also tested whether previous findings from our group on the rumen bacterial community using 454 pyrosequencing were upheld using Illumina-based sequencing.
With the shift in next-generation sequencing from 454- to Illumina-based sequencing (and other newer technologies), an outstanding question in microbiome studies, in general, is whether the conclusions made using 454-based sequencing are repeatably independent of the technological platform used. We sought to address this and found that the general bacterial taxonomy conforms to what is known for the rumen microbiome [7,8,31]. Previously, we found a steady increase in alpha diversity in the ruminal liquid fraction and a decrease in richness in the solid fraction, suggesting that the rumen bacterial community is dynamic over the course of a lactation cycle [8]. Here, we also observed an increase in alpha diversity in the liquid fraction from the first to the last periods of both lactation cycles (Supplementary Figure S2A). This supports our previous conclusions that the rumen bacterial community is dynamic and cannot be assumed to be stable over time.
This study also identified numerous bacterial taxa associated with either high- or low-efficiency cows. There were no differentially abundant taxa in the first lactation, which we posit is likely due to the rumen still maturing [32,33]. Of the bacterial families identified as unique to high-efficiency cows, different genera within the Succinivibrionaceae and Erysipelotrichaceae have previously been reported to be positively associated with milk yield [8,34]. In our previous study, members of the Succinivibrionaceae had the largest positive correlation with efficiency [8], and this study also identified members of the Butyvibrio and Ruminococcaceae as being associated with low-efficiency cows. Various genera within the families Lachnospiraceae and Prevotellaceae were identified in both high- and low-efficiency cows. These taxa are dominant in the rumen and have been previously associated with MPE [7,35,36]. Of note, there were changes in the identification of the ASVs associated with high- and low-efficiency cows in our study, as compared to the OTUs previously identified. For example, Coprococcus and members of Clostridiaceae were not identified as significantly different between high- and low-efficiency groups in this study. One possible explanation for this difference is due to known differences in the occurrence and relative abundance of taxa when comparing ASVs and OTUs within the same dataset [37,38]. However, both of our studies found different members of Lachnospiraceae and Prevotellaceae to be the most numerous taxa identified in either high- or low-efficiency cows (Table 2). As such, our shift from 454 pyrosequencing to Illumina-based sequencing did not result in any changes in diversity, although the identification of taxa at lower taxonomic levels (e.g., genus) associated with MPE differed between the two sequencing methodologies. This is likely due to the significant advances in bacterial taxonomy that have occurred over the last decade, with greater identification and refinement of our known classification schema in current bacterial taxonomy databases.
A deficiency in many ruminal microbiome studies is the focus on the bacterial community, with little to no consideration of the fungal or archaeal communities. This was particularly true in our previous study, and we sought to address this with our current study. The rumen fungal community plays an important functional role in the degradation of fiber, and fungi are thought to be some of the first colonizers of the rumen during the weaning transition [26]. Similar to previous reports, the ruminal fungal communities characterized in this study were composed primarily of taxa within the family Neocallimastigaceae [7,26]. We found that fungal diversity decreased significantly in the solid fraction over the course of both lactation cycles, with a brief increase between the first and second lactation, and less so in the liquid fraction (Supplementary Figure S2B). These data suggest that there may be two distinct stages in the fungal community of the rumen. Under this model, a more diverse community establishes itself during the transition period prior to starting lactation and the community slowly becomes less diverse over the course of lactation. This is supported by the transition period diet, where cows are fed rations that are relatively higher in fiber but lower in energy density, thereby creating a more favorable ruminal environment for fibrolytic fungi [39,40]. During lactation, the fiber content of feed can be reduced by up to 50%, with concomitant increases in energy density, which would allow for faster-growing amylolytic bacteria to outcompete slower-growing fungi [11,39,41]. Finally, we found few differentially abundant fungal taxa between high- and low-efficiency cows. Taking into consideration their relatively low diversity and functional redundancy in the rumen, this suggests that the fungal community may have a lesser impact on efficiency. However, the rumen fungal community is much less understood, compared to the bacteria, and this work emphasizes the need for a deeper analysis of the rumen fungal community.
Studies on the rumen archaeal community have primarily been focused on reduction in enteric methane production from methanogens. Importantly, rumen archaea can also impact efficiency, as there is a net carbon loss with methane production [13]. Similar to other studies [9,26], the ruminal archaeal community in this study was dominated by taxa in the family Methanobacteriaceae. There were no differences in diversity, and only OTUs in the genus Methanosphaera were found to be differentially abundant in high-efficiency cows (Table 2). As such, the relationship between methane production and efficiency may not be reflected by the diversity of methanogens in the rumen, but rather of other microbial members. For example, previous work has found that certain bacterial taxa such as those in the genus Butyrivibrio and Fibrobacter are associated with either increased or decreased methane production, with shifts in VFA production driving methanogenesis [42,43,44]. Taken together, our data indicate that the diversity of the archaea, as determined using next-generation sequencing, likely plays a minimal role as a driver of MPE.
We acknowledge that the ruminal protozoal community has also been shown to play a role in efficiency, but that was not investigated here due to the difficulty in adequately enumerating these microbes using sequence-based approaches [45,46]. We also note that our samples were stored for 8 years at −80 °C prior to re-analysis, and there may have been some background activity during that time that may have affected the relative abundances of organisms compared to the original study. Although we did not directly compare both datasets using ASVs and the SILVA classifier, our analysis shows that the major diversity trends found in our previous studies remain the same. Moreover, we were able to recapitulate our previous findings of taxa associated with either high- or low-MPE cows at the broad taxonomic level, with differences in lower taxonomic classifications likely due to advances in phylogenetic databases.
5. Conclusions
In conclusion, our study found that there were minimal differences in the ruminal bacterial community when comparing 454 pyrosequencing and Illumina sequencing. We also found that the ruminal fungal and archaeal communities do not differ significantly with respect to lactation period or MPE, implicating the rumen bacteria as a major contributor to MPE in dairy cattle. However, there may be functional differences between high- and low-efficiency cows. Our findings further highlight the need to evaluate the functional roles of individual species beyond taxonomic identification to better understand how they contribute to efficiency in dairy cows.
Supplementary Materials
The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/dairy6010008/s1, Figure S1: Relative abundance charts of bacterial, fungal, and archaeal taxonomic identities, Figure S2: Alpha and beta diversity plots of bacteria, fungi, and archaea over two lactation cycles.
Author Contributions
Conceptualization, A.J.S. and G.S.; methodology, A.J.S. and G.S.; software, A.J.S. and J.H.S.; validation, A.J.S. and G.S.; formal analysis, A.J.S. and J.H.S.; investigation, A.J.S. and K.A.J.; resources, G.S.; data curation, A.J.S., K.A.J. and J.H.S.; writing—original draft preparation, A.J.S.; writing—review and editing, A.J.S., J.H.S., K.A.J. and G.S.; visualization, A.J.S.; supervision, G.S.; project administration, A.J.S. and G.S.; funding acquisition, G.S. All authors have read and agreed to the published version of the manuscript.
Funding
This research received no external funding.
Institutional Review Board Statement
Not applicable.
Informed Consent Statement
Not applicable.
Data Availability Statement
The original contributions presented in this study are included in the article/Supplementary Materials. Further inquiries can be directed to the corresponding author(s).
Acknowledgments
We would like to thank all members of the Suen, Mantovani, and Ricke laboratories (UW-Madison) for their support, insightful discussions, and careful reading of the manuscript.
Conflicts of Interest
The authors declare no conflicts of interest.
References
- FAO: Food and Agriculture Organization of the United Nations. Crops and Livestock Products. 2021. Available online: https://www.fao.org/faostat/en/#data/TCL (accessed on 30 July 2023).
- Knaus, W. Dairy cows trapped between performance demands and adaptability. J. Sci. Food Agric. 2009, 89, 1107–1114. [Google Scholar] [CrossRef]
- Matthews, C.; Crispie, F.; Lewis, E.; Reid, M.; O’Toole, P.W.; Cotter, P.D. The rumen microbiome: A crucial consideration when optimising milk and meat production and nitrogen utilisation efficiency. Gut Microbes 2018, 10, 115–132. [Google Scholar] [CrossRef] [PubMed]
- Cammack, K.M.; Austin, K.J.; Lamberson, W.R.; Conant, G.C.; Cunningham, H.C. Ruminant Nutrition Symposium: Tiny but mighty: The role of the rumen microbes in livestock production. J. Anim. Sci. 2018, 96, 752–770. [Google Scholar] [CrossRef] [PubMed]
- Akin, D.E.; Borneman, W.S. Role of rumen fungi in fiber degradation. J. Dairy Sci. 1990, 73, 3023–3032. [Google Scholar] [CrossRef]
- Huuki, H.; Tapio, M.; Mäntysaari, P.; Negussie, E.; Ahvenjärvi, S.; Vilkki, J.; Vanhatalo, A.; Tapio, I. Long-term effects of early-life rumen microbiota modulation on dairy cow production performance and methane emissions. Front. Microbiol. 2022, 13, 983823. [Google Scholar] [CrossRef]
- Cox, M.S.; Deblois, C.L.; Suen, G. Assessing the response of ruminal bacterial and fungal microbiota to whole-rumen contents exchange in dairy cows. Front. Microbiol. 2021, 12, 665–776. [Google Scholar] [CrossRef]
- Jewell, K.A.; McCormick, C.A.; Odt, C.L.; Weimer, P.J.; Suen, G. Ruminal bacterial community composition in dairy cows is dynamic over the course of two lactations and correlates with feed efficiency. Appl. Environ. Microbiol. 2015, 81, 4697–4710. [Google Scholar] [CrossRef]
- Lopes, D.R.G.; de Souza Duarte, M.; La Reau, A.J.; Chaves, I.Z.; de Oliveira Mendes, T.A.; Detmann, E.; Bento, C.B.P.; Mercadante, M.E.Z.; Bonilha, S.F.M.; Suen, G.; et al. Assessing the relationship between the rumen microbiota and feed efficiency in Nellore steers. J. Anim. Sci. Biotechnol. 2021, 12, 79. [Google Scholar] [CrossRef]
- Gordon, G.L.; Phillips, M.W. The role of anaerobic gut fungi in ruminants. Nutr. Res. Rev. 1998, 11, 133–168. [Google Scholar] [CrossRef]
- Bach, A.; López-García, A.; González-Recio, O.; Elcoso, G.; Fàbregas, F.; Chaucheyras-Durand, F.; Castex, M. Changes in the rumen and colon microbiota and effects of live yeast dietary supplementation during the transition from the dry period to lactation of dairy cows. J. Dairy Sci. 2019, 102, 6180–6198. [Google Scholar] [CrossRef]
- Zhou, Y.; Jin, W.; Xie, F.; Mao, S.; Cheng, Y.; Zhu, W. The role of Methanomassiliicoccales in trimethylamine metabolism in the rumen of dairy cows. Animal 2021, 15, 100259. [Google Scholar] [CrossRef] [PubMed]
- Tapio, I.; Snelling, T.J.; Strozzi, F.; Wallace, R.J. The ruminal microbiome associated with methane emissions from ruminant livestock. J. Anim. Sci. Biotechnol. 2017, 8, 7. [Google Scholar] [CrossRef]
- Weimer, P.J.; Stevenson, D.M.; Mertens, D.R.; Thomas, E.E. Effect of monensin feeding and withdrawal on populations of individual bacterial species in the rumen of lactating dairy cows fed high-starch rations. Appl. Environ. Microbiol. 2008, 80, 135–145. [Google Scholar] [CrossRef] [PubMed]
- Kozich, J.J.; Westcott, S.L.; Baxter, N.T.; Highlander, S.K.; Schloss, P.D. Development of a dual-index sequencing strategy and curation pipeline for analyzing amplicon sequence data on the MiSeq Illumina sequencing platform. Appl. Environ. Microbiol. 2013, 79, 5112–5120. [Google Scholar] [CrossRef]
- Taylor, D.L.; Walters, W.A.; Lennon, N.J.; Bochicchio, J.; Krohn, A.; Caporaso, J.G.; Pennanen, T. Accurate estimation of fungal diversity and abundance through improved lineage-specific primers optimized for Illumina amplicon sequencing. Appl. Environ. Microbiol. 2016, 82, 7217–7226. [Google Scholar] [CrossRef]
- Kittelmann, S.; Seedorf, H.; Walters, W.A.; Clemente, J.C.; Knight, R.; Gordon, J.I.; Janssen, P.H. Simultaneous amplicon sequencing to explore co-occurrence patterns of bacterial, archaeal and eukaryotic microorganisms in rumen microbial communities. PLoS ONE 2013, 8, e47879. [Google Scholar] [CrossRef]
- Skarlupka, J.H.; Kamenetsky, M.E.; Jewell, K.A.; Suen, G. The ruminal bacterial community in lactating dairy cows has limited variation on a day-to-day basis. J. Anim. Sci. Biotechnol. 2019, 10, 66. [Google Scholar] [CrossRef]
- Bolyen, E.; Rideout, J.R.; Dillon, M.R.; Bokulich, N.A.; Abnet, C.C.; Al-Ghalith, G.A.; Alexander, H.; Alm, E.J.; Arumugam, M.; Asnicar, F.; et al. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat. Biotechnol. 2019, 37, 852–857. [Google Scholar] [CrossRef]
- Callahan, B.J.; McMurdie, P.J.; Rosen, M.J.; Han, A.W.; Johnson, A.J.A.; Holmes, S.P. DADA2: High-resolution sample inference from Illumina amplicon data. Nat. Methods 2016, 13, 581–583. [Google Scholar] [CrossRef]
- Bokulich, N.A.; Kaehler, B.D.; Rideout, J.R.; Dillon, M.; Bolyen, E.; Knight, R.; Huttley, G.A.; Gregory Caporaso, J. Optimizing taxonomic classification of marker-gene amplicon sequences with QIIME 2’s q2-feature-classifier plugin. Microbiome 2018, 6, 90. [Google Scholar] [CrossRef]
- Quast, C.; Pruesse, E.; Yilmaz, P.; Gerken, J.; Schweer, T.; Yarza, P.; Peplies, J.; Glöckner, F.O. The SILVA ribosomal RNA gene database project: Improved data processing and web-based tools. Nucleic Acids Res. 2013, 41, 590–596. [Google Scholar] [CrossRef]
- Nilsson, R.H.; Larsson, K.H.; Taylor, A.F.S.; Bengtsson-Palme, J.; Jeppesen, T.S.; Schigel, D.; Kennedy, P.; Picard, K.; Glöckner, F.O.; Tedersoo, L.; et al. The UNITE database for molecular identification of fungi: Handling dark taxa and parallel taxonomic classifications. Nucleic Acids Res. 2019, 47, 259–264. [Google Scholar] [CrossRef] [PubMed]
- McMurdie, P.J.; Holmes, S. phyloseq: An R package for reproducible interactive analysis and graphics of microbiome census data. PLoS ONE 2013, 8, e61217. [Google Scholar] [CrossRef]
- Schloss, P.D.; Westcott, S.L.; Ryabin, T.; Hall, J.R.; Hartmann, M.; Hollister, E.B.; Lesniewski, R.A.; Oakley, B.B.; Parks, D.H.; Robinson, C.J.; et al. Introducing mothur: Open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl. Environ. Microbiol. 2009, 75, 7537–7541. [Google Scholar] [CrossRef]
- Dill-McFarland, K.A.; Breaker, J.D.; Suen, G. Microbial succession in the gastrointestinal tract of dairy cows from 2 weeks to first lactation. Sci. Rep. 2017, 7, 40864. [Google Scholar] [CrossRef]
- Good, I.J. The population frequencies of species and the estimation of population parameters. Biometrika 1953, 40, 237–264. [Google Scholar] [CrossRef]
- Bray, J.R.; Curtis, J.T. An Ordination of the Upland Forest Communities of Southern Wisconsin. Ecol. Monogr. 1957, 27, 326–349. [Google Scholar] [CrossRef]
- Xu, S.; Zhan, L.; Tang, W.; Wang, Q.; Dai, Z.; Zhou, L.; Feng, T.; Chen, M.; Wu, T.; Hu, E.; et al. MicrobiotaProcess: A comprehensive R package for deep mining microbiome. Innovation 2023, 4, 100388. [Google Scholar] [CrossRef]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
- Henderson, G.; Cox, F.; Ganesh, S.; Jonker, A.; Young, W.; Global Rumen Census Collaborators; Janssen, P.H. Rumen microbial community composition varies with diet and host, but a core microbiome is found across a wide geographical range. Sci. Rep. 2015, 5, 14567. [Google Scholar] [CrossRef]
- Pitta, D.W.; Kumar, S.; Vecchiarelli, B.; Shirley, D.J.; Bittinger, K.; Baker, L.D.; Ferguson, J.D.; Thomsen, N. Temporal dynamics in the ruminal microbiome of dairy cows during the transition period. J. Anim. Sci. 2014, 92, 4014–4022. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Z.; Difford, G.F.; Noel, S.J.; Lassen, J.; Løvendahl, P.; Højberg, O. Stability Assessment of the Rumen Bacterial and Archaeal Communities in Dairy Cows Within a Single Lactation and Its Association with Host Phenotype. Front Microbiol. 2021, 12, 636223. [Google Scholar] [CrossRef] [PubMed]
- Indugu, N.; Vecchiarelli, B.; Baker, L.D.; Ferguson, J.D.; Vanamala, J.K.P.; Pitta, D.W. Comparison of rumen bacterial communities in dairy herds of different production. BMC Microbiol. 2017, 17, 190. [Google Scholar] [CrossRef] [PubMed]
- Delgado, B.; Bach, A.; Guasch, I.; González, C.; Elcoso, G.; Pryce, J.E.; Gonzalez-Recio, O. Whole rumen metagenome sequencing allows classifying and predicting feed efficiency and intake levels in cattle. Sci. Rep. 2020, 9, 11. [Google Scholar] [CrossRef]
- Jami, E.; White, B.A.; Mizrahi, I. Potential role of the bovine rumen microbiome in modulating milk composition and feed efficiency. PLoS ONE 2014, 9, e85423. [Google Scholar] [CrossRef]
- Chiarello, M.; McCauley, M.; Villéger, S.; Jackson, C.R. Ranking the biases: The choice of OTUs vs. ASVs in 16S rRNA amplicon data analysis has stronger effects on diversity measures than rarefaction and OTU identity threshold. PLoS ONE 2022, 17, e0264443. [Google Scholar] [CrossRef]
- Siddiqui, N.Y.; Ma, L.; Brubaker, L.; Mao, J.; Hoffman, C.; Dahl, E.M.; Wang, Z.; Karstens, L. Updating urinary microbiome analyses to enhance biologic interpretation. Front Cell Infect. Microbiol. 2022, 12, 789439. [Google Scholar] [CrossRef]
- Wang, X.; Li, X.; Zhao, C.; Hu, P.; Chen, H.; Liu, Z.; Liu, G.; Wang, Z. Correlation between composition of the bacterial community and concentration of volatile fatty acids in the rumen during the transition period and ketosis in dairy cows. Appl. Environ. Microbiol. 2012, 7, 2386–2392. [Google Scholar] [CrossRef]
- Wankhade, P.R.; Manimaran, A.; Kumaresan, A.; Jeyakumar, S.; Ramesha, K.P.; Sejian, V.; Rajendran, D.; Varghese, M.R. Metabolic and immunological changes in transition dairy cows: A review. Vet. World 2017, 10, 1367–1377. [Google Scholar] [CrossRef]
- NRC. Nutrient Requirements of Dairy Cattle, 7th ed.; National Academy Press: Washington, DC, USA, 2001. [Google Scholar]
- Auffret, M.D.; Stewart, R.; Dewhurst, R.J.; Duthie, C.A.; Rooke, J.A.; Wallace, R.J.; Freeman, T.C.; Snelling, T.J.; Watson, M.; Roehe, R. Identification, comparison, and validation of robust rumen microbial biomarkers for methane emissions using diverse Bos Taurus breeds and basal Diets. Front. Microbiol. 2018, 8, 2642. [Google Scholar] [CrossRef]
- Janssen, P.H. Influence of hydrogen on rumen methane formation and fermentation balances through microbial growth kinetics and fermentation thermodynamics. Anim. Feed Sci. Technol. 2010, 160, 1–22. [Google Scholar] [CrossRef]
- Martínez-Álvaro, M.; Auffret, M.D.; Stewart, R.D.; Dewhurst, R.J.; Duthie, C.A.; Rooke, J.A.; Wallace, R.J.; Shih, B.; Freeman, T.C.; Watson, M.; et al. Identification of complex rumen microbiome interaction within diverse functional niches as mechanisms affecting the variation of methane emissions in bovine. Front. Microbiol. 2020, 11, 659. [Google Scholar] [CrossRef] [PubMed]
- López-García, A.; Saborío-Montero, A.; Gutiérrez-Rivas, M.; Atxaerandio, R.; Goiri, I.; García-Rodríguez, A.; Jiménez-Montero, J.A.; González, C.; Tamames, J.; Puente-Sánchez, F.; et al. Fungal and ciliate protozoa are the main rumen microbes associated with methane emissions in dairy cattle. Gigascience 2022, 11, giab088. [Google Scholar] [CrossRef] [PubMed]
- Bainbridge, M.L.; Saldinger, L.K.; Barlow, J.W.; Alvez, J.P.; Roman, J.; Kraft, J. Alteration of Rumen Bacteria and Protozoa Through Grazing Regime as a Tool to Enhance the Bioactive Fatty Acid Content of Bovine Milk. Front. Microbiol. 2018, 9, 904. [Google Scholar] [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).