Epidemiological Survey on Tick-Borne Pathogens with Zoonotic Potential in Dog Populations of Southern Ethiopia
Abstract
1. Introduction
2. Materials and Methods
2.1. Sampling
2.2. Laboratory Analysis
2.3. Data Analysis
3. Results
3.1. Dog Population Description
3.2. Molecular Analysis
3.3. Factors Influencing Pathogens’ Distribution
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Baneth, G.; Bourdeau, P.; Bourdoiseau, G.; Bowman, D.; Breitschwerdt, E.; Capelli, G.; Cardoso, L.; Dantas-Torres, F.; Day, M.; Dedet, J.P.; et al. Vector-borne diseases–constant challenge for practicing veterinarians: Recommendations from the CVBD World Forum. Parasite Vectors 2012, 5, 55. [Google Scholar] [CrossRef] [PubMed]
- Colwell, D.D.; Dantas-Torres, F.; Otranto, D. Vector-borne parasitic zoonoses: Emerging scenarios and new perspectives. Vet. Parasitol. 2011, 182, 14–21. [Google Scholar] [CrossRef] [PubMed]
- Otranto, D. Diagnostic challenges and the unwritten stories of dog and cat parasites. Vet. Parasitol. 2015, 212, 54–61. [Google Scholar] [CrossRef]
- Otranto, D.; Dantas-Torres, F.; Mihalca, A.; Traub, R.J.; Lappin, M.; Baneth, G. Zoonotic parasites of sheltered and stray dogs in the era of the global crisis. Trends Parasitol. 2017, 33, 813–825. [Google Scholar] [CrossRef]
- Kostopoulou, D.; Gizzarelli, M.; Ligda, P.; Foglia Manzillo, V.; Saratsi, K.; Montagnaro, S.; Schunack, B.; Boegel, A.; Pollmeier, M.; Oliva, G.; et al. Mapping the canine vector-borne disease risk in a Mediterranean area. Parasites Vectors 2020, 13, 282. [Google Scholar] [CrossRef] [PubMed]
- Otranto, D.; Wall, R. New strategies for the control of arthropod vectors of disease in dogs and cats. Med. Vet. Entomol. 2008, 22, 291–302. [Google Scholar] [CrossRef] [PubMed]
- Angelou, A.; Gelasakis, A.I.; Verde, N.; Pantchev, N.; Schaper, R.; Chandrashekar, R.; Papadopoulos, E. Prevalence and risk factors for selected canine vector-borne diseases in Greece. Parasites Vectors 2019, 12, 283. [Google Scholar] [CrossRef] [PubMed]
- Van Wyk, C.; Mtshali, K.; Taioe, M.O.; Terera, S.; Bakkes, D.; Ramatla, T.; Xuan, X.; Thekisoe, O. Detection of Ticks and Tick-Borne Pathogens of Urban Stray Dogs in South Africa. Pathogens 2022, 11, 862. [Google Scholar]
- De la Fuente, J.; Estrada-Pena, A. Ticks and tick-borne pathogens on the rise. Ticks Tick Borne. Dis. 2012, 3, 115–116. [Google Scholar] [CrossRef] [PubMed]
- Montoya-Alonso, J.A.; Morchón, R.; Costa-Rodríguez, N.; Matos, J.I.; Falcón-Cordón, Y.; Carretón, E. Current Distribution of Selected Vector-Borne Diseases in Dogs in Spain. Front. Vet. Sci 2020, 7, 564429. [Google Scholar] [CrossRef] [PubMed]
- Heylen, D.; Day, M.; Schunack, B.; Fourie, J.; Labuschange, M.; Johnson, S.; Githigia, S.M.; Akande, F.A.; Nzalawahe, J.S.; Tayebwa, D.S.; et al. A community approach of pathogens and their arthropod vectors (ticks and fleas) in dogs of African Sub-Sahara. Parasites Vectors 2021, 14, 576. [Google Scholar] [CrossRef] [PubMed]
- Otranto, D. Arthropod-borne pathogens of dogs and cats: From pathways and times of transmission to disease control. Vet. Parasitol. 2018, 251, 68–77. [Google Scholar] [CrossRef] [PubMed]
- Adamu, M.; Troskie, M.; Oshadu, D.O.; Malatji, D.P.; Penzhorn, B.L.; Matjila, P.T. Occurrence of tick-transmitted pathogens in dogs in Jos, Plateau State, Nigeria. Parasites Vectors 2014, 7, 119. [Google Scholar] [CrossRef] [PubMed]
- Kamani, J.; Baneth, G.; Mumcuoglu, K.Y.; Waziri, N.E.; Eyal, O.; Guthmann, Y.; Harrus, S. Molecular detection and characterization of tick-borne pathogens in dogs and ticks from Nigeria. PLoS Negl. Trop. Dis. 2013, 7, e2108. [Google Scholar] [CrossRef] [PubMed]
- Kennedy, M.A.; Thompson, R.E.; McRee Bakker, A.; Fung, C.; Dawson, J.; Parry, R.; Foggin, C.; Odoi, A. Detection and analysis of tick-borne infections in communal dogs of northwest Zimbabwe. J. S. Afr. Vet. Assoc. 2021, 92, e1–e4. [Google Scholar] [CrossRef]
- Moonga, L.C.; Hayashida, K.; Nakao, R.; Lisulo, M.; Kaneko, C.; Nakamura, I.; Eshita, Y.; Mweene, A.S.; Namangala, B.; Sugimoto, C.; et al. Molecular detection of Rickettsia felis in dogs, rodents and cat fleas in Zambia. Parasites Vectors 2019, 12, 168. [Google Scholar] [CrossRef] [PubMed]
- Proboste, T.; Kalema-Zikusoka, G.; Altet, L.; Solano-Gallego, L.; Mera, I.G.; Chirife, A.D.; Muro, J.C.; Bach, E.; Piazza, A.; Cevidanes, A.; et al. Infection and exposure to vector-borne pathogens in rural dogs and their ticks, Uganda. Parasites Vectors 2015, 8, 306. [Google Scholar] [CrossRef] [PubMed]
- Mtshali, K.; Nakao, R.; Sugimoto, C.; Thekisoe, O. Occurrence of Coxiella burnetii, Ehrlichia canis, Rickettsia species and Anaplasma phagocytophilum-like bacterium in ticks collected from dogs and cats in South Africa. J. S. Afr. Vet. Assoc. 2017, 88, a1390. [Google Scholar] [CrossRef] [PubMed]
- Elhelw, R.; Elhariri, M.; Hamza, D.; Abuowarda, M.; Ismael, E.; Farag, H. Evidence of the presence of Borrelia burgdorferi in dogs and associated ticks in Egypt. BMC Vet. Res. 2021, 17, 49. [Google Scholar] [CrossRef]
- Oyamada, M.; Davoust, B.; Boni, M.; Dereure, J.; Bucheton, B.; Hammad, A.; Itamoto, K.; Okuda, M.; Inokuma, H. Detection of Babesia canis rossi, B. canis vogeli, and Hepatozoon canis in dogs in a village of eastern Sudan by using a screening PCR and sequencing methodologies. Clin. Diagn Lab. Immunol. 2005, 12, 1343–1346. [Google Scholar]
- Shaw, S.E.; Day, M.J.; Birtles, R.J.; Breitschwerdt, E.B. Tick-borne infectious diseases of dogs. Trends Parasitol. 2001, 17, 74–80. [Google Scholar] [CrossRef]
- Kumsa, B.; Parola, P.; Raoult, D.; Socolovschi, C. Molecular Detection of Rickettsia felis and Bartonella henselae in dog and cat fleas in Central Oromia, Ethiopia. Am. J. Trop. Med. Hyg. 2014, 90, 457–462. [Google Scholar] [CrossRef] [PubMed]
- Alberti, A.; Zobba, R.; Chessa, B.; Addis, M.F.; Sparagano, O.; Pinna Parpaglia, M.L.; Cubeddu, T.; Pintori, G.; Pittau, M. Equine and canine Anaplasma phagocytophilum strains isolated on the island of Sardinia (Italy) are phylogenetically related to pathogenic strains from the United States. Appl. Environ. Microbiol. 2005, 71, 6418–6422. [Google Scholar] [CrossRef] [PubMed]
- Otranto, D.; Testini, G.; Dantas-Torres, F.; Latrofa, M.S.; Vissotto de Paiva Diniz, P.P.; de Caprariis, D.; Lia, R.P.; Mencke, N.; Stanneck, D.; Capelli, G.; et al. Diagnosis of canine vector-borne diseases in young dogs: A longitudinal study. J. Clin. Microbiol. 2010, 48, 3316–3324. [Google Scholar] [CrossRef]
- Lee, S.H.; Lee, J.H.; Park, H.S.; Jang, W.J.; Koh, S.E.; Yang, Y.M.; Kim, B.J.; Kook, Y.H.; Park, K.H. Differentiation of Borrelia burgdorferi sensu latu through groEL gene analysis. FEMS Microbiol. Lett. 2003, 222, 51–57. [Google Scholar] [CrossRef] [PubMed]
- Regnery, R.L.; Spruill, C.L.; Plikaytis, B.D. Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. J. Bact. 1991, 173, 1576–1589. [Google Scholar] [CrossRef]
- Tabar, M.D.; Altet, L.; Francino, O.; Sánchez, A.; Ferrer, L.; Roura, X. Vector-borne infections in cats: Molecular study in Barcelona area (Spain). Vet. Parasitol. 2008, 151, 332–336. [Google Scholar] [CrossRef]
- Grillini, M.; Frangipane di Regalbono, A.; Tessarin, C.; Dotto, G.; Beraldo, P.; Marchiori, E.; Simonato, G. A new qPCR approach for the simultaneous detection of Cytauxzoon spp. and Hepatozoon spp. in felids. In Proceedings of the “XXXII Congresso SoIPa”, Napoli, Italy, 27–30 June 2022; p. 319. [Google Scholar]
- Penzhorn, B.L.; Vorster, I.; Harrison-White, R.F.; Oosthuizen, M.C. Black-backed jackals (Canis mesomelas) are natural hosts of Babesia rossi, the virulent causative agent of canine babesiosis in sub-Saharan Africa. Parasites Vectors 2017, 10, 124. [Google Scholar] [CrossRef]
- Bakken, J.S.; Dumler, J.S. Human granulocytic anaplasmosis. Infect. Dis. Clin. North Am. 2015, 29, 341–355. [Google Scholar] [CrossRef]
- Matei, I.A.; Estrada-Peña, A.; Cutler, S.J.; Vayssier-Taussat, M.; Varela-Castro, L.; Potkonjak, A.; Zeller, H.; Mihalca, A.D. A review on the eco-epidemiology and clinical management of human granulocytic anaplasmosis and its agent in Europe. Parasites Vectors 2019, 12, 599. [Google Scholar] [CrossRef]
- CDC 2002. Number of Reported Cases of Anaplasmosis in: Dashboard Data File of Center of Diseases Control and Prevention. Available online: https://www.cdc.gov/anaplasmosis/stats/index.html (accessed on 26 December 2022).
- Huhn, C.; Winter, C.; Wolfsperger, T.; Wüppenhorst, N.; Strašek Smrdel, K.; Skuballa, J.; Pfäffle, M.; Petney, T.; Silaghi, C.; Dyachenko, V.; et al. Analysis of the population structure of Anaplasma ph.hagocytophilum using multilocus sequence typing. PLoS ONE 2014, 9, e93725. [Google Scholar] [CrossRef]
- Jahfari, S.; Coipan, E.C.; Fonville, M.; Van Leeuwen, A.D.; Hengeveld, P.; Heylen, D.; Heyman, P.; Van Maanen, C.; Butler, C.M.; Földvári, G.; et al. Circulation of four Anaplasma phagocytophilum ecotypes in Europe. Parasites Vectors 2014, 7, 365. [Google Scholar] [CrossRef] [PubMed]
- Hornok, S.; Dénes, B.; Meli, M.L.; Tánczos, B.; Fekete, L.; Gyuranecz, M.; De la Fuente, J.; De Mera, I.G.; Farkas, R.; Hofmann-Lehmann, R. Non-pet dogs as sentinels and potential synanthropic reservoirs of tick-borne and zoonotic bacteria. Vet. Microbiol. 2013, 167, 700–703. [Google Scholar] [CrossRef] [PubMed]
- El Hamiani Khatat, S.; Daminet, S.; Duchateau, L.; Elhachimi, L.; Kachani, M.; Sahibi, H. Epidemiological and Clinicopathological Features of Anaplasma phagocytophilum Infection in Dogs: A Systematic Review. Front. Vet. Sci. 2021, 8, 686644. [Google Scholar] [CrossRef] [PubMed]
- Azzag, N.; Petit, E.; Gandoin, C.; Bouillin, C.; Ghalmi, F.; Haddad, N.; Boulouis, H.J. Prevalence of select vector-borne pathogens in stray and client-owned dogs from Algiers. Comp. Immunol. Microbiol. Infect. Dis. 2015, 38, 1–7. [Google Scholar] [CrossRef]
- Clarke, L.L.; Ballweber, L.R.; Little, S.E.; Lapplin, M.R. Prevalence of select vector- borne disease agents in owned dogs of Ghana. J. S. Afr. Vet. Assoc. 2014, 85, 996. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Sili, G.; Byaruhanga, C.; Horak, I.; Steyn, H.; Chaisi, M.; Oosthuizen, M.C.; Neves, L. Ticks and tick-borne pathogens infecting livestock and dogs in Tchicala-Tcholoanga, Huambo Province, Angola. Parasitol. Res. 2021, 120, 1097–1102. [Google Scholar] [CrossRef] [PubMed]
- Kolo, A.O.; Sibeko-Matjila, K.P.; Maina, A.N.; Richards, A.L.; Knobel, D.L.; Matjila, P.T. Molecular Detection of Zoonotic Rickettsiae and Anaplasma spp. in Domestic Dogs and Their Ectoparasites in Bushbuckridge, South Africa. Vector Borne Zoonotic Dis. 2016, 16, 245–252. [Google Scholar] [CrossRef]
- Inokuma, H.; Oyamada, M.; Kelly, P.J.; Jacobson, L.A.; Fournier, P.E.; Itamoto, K.; Okuda, M.; Brouqui, P. Molecular detection of a new Anaplasma species closely related to Anaplasma phagocytophilum in canine blood from South Africa. J. Clin. Microbiol. 2005, 43, 2934–2937. [Google Scholar] [CrossRef] [PubMed]
- Kolo, A.O.; Collins, N.E.; Brayton, K.A.; Chaisi, M.; Blumberg, L.; Frean, J.; Gall, C.A.; Wentzel, J.M.; Wills-Berriman, S.; De Boni, L.; et al. Anaplasma phagocytophilum and other Anaplasma spp. in Various Hosts in the Mnisi Community, Mpumalanga Province, South Africa. Microorganisms 2020, 8, 1812. [Google Scholar] [CrossRef] [PubMed]
- Vlahakis, P.A.; Chitanga, S.; Simuunza, M.C.; Simulundu, E.; Qiu, Y.; Changula, K.; Chambaro, H.M.; Kajihara, M.; Nakao, R.; Takada, A.; et al. Molecular detection and characterization of zoonotic Anaplasma species in domestic dogs in Lusaka, Zambia. Ticks Tick Borne Dis. 2018, 9, 39–43. [Google Scholar] [CrossRef]
- Carrade, D.D.; Foley, J.E.; Borjesson, D.L.; Sykes, J.E. Canine granulocytic anaplasmosis: A review. J. Vet. Intern. Med. 2009, 23, 1129–1141. [Google Scholar] [CrossRef] [PubMed]
- Hegab, A.A.; Omar, H.M.; Abuowarda, M.; Ghattas, S.G.; Mahmoud, N.E.; Fahmy, M.M. Screening and phylogenetic characterization of tick-borne pathogens in a population of dogs and associated ticks in Egypt. Parasites Vectors 2022, 15, 1–15. [Google Scholar] [CrossRef]
- Mghirbi, Y.; Yach, H.; Ghorbel, A.; Bouattour, A. Anaplasma phagocytophilum in horses and ticks in Tunisia. Parasites Vectors 2012, 5, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Arraga-Alvarado, C.M.; Qurollo, B.A.; Parra, O.C.; Berrueta, M.A.; Hegarty, B.C.; Breitschwerdt, E.B. Molecular Evidence of Anaplasma platys Infection in Two Women from Venezuela. Am. J. Trop Med. Hyg. 2014, 91, 1161–1165. [Google Scholar] [CrossRef]
- Breitschwerdt, E.B.; Hegarty, B.C.; Qurollo, B.A.; Saito, T.B.; Maggi, R.G.; Blanton, L.S.; Bouyer, D.H. Intravascular persistence of Anaplasma platys, Ehrlichia chaffeensis, and Ehrlichia ewingii DNA in the blood of a dog and two family members. Parasites Vectors 2014, 7, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Maggi, R.G.; Mascarelli, P.E.; Havenga, L.N.; Naidoo, V.; Breitschwerdt, E.B. Co-infection with Anaplasma platys, Bartonella henselae and Candidatus Mycoplasma haematoparvum in a veterinarian. Parasites Vectors 2013, 6, 103. [Google Scholar] [CrossRef] [PubMed]
- Nicholson, W.L.; Allen, K.E.; McQuiston, J.H.; Breitschwerdt, E.B.; Little, S.E. The increasing recognition of rickettsial pathogens in dogs and people. Trends Parasitol. 2010, 26, 205–212. [Google Scholar] [CrossRef]
- Selim, A.; Alanazi, A.D.; Sazmand, A.; Otranto, D. Seroprevalence and associated risk factors for vector-borne pathogens in dogs from Egypt. Parasites Vectors 2021, 14, 175. [Google Scholar] [CrossRef]
- Lauzi, S.; Maia, J.P.; Epis, S.; Marcos, R.; Pereira, C.; Luzzago, C.; Santos, M.; Puente-Payo, P.; Giordano, A.; Pajoro, M.; et al. Molecular detection of Anaplasma platys, Ehrlichia canis, Hepatozoon canis and Rickettsia monacensis in dogs from Maio Island of Cape Verde archipelago. Ticks Tick Borne. Dis. 2016, 7, 964–969. [Google Scholar] [CrossRef]
- Matei, I.A.; D’Amico, G.; Yao, P.K.; Ionica, A.M.; Kanyari, P.W.N.; Daskalaki, A.A.; Dumitrache, M.O.; Sandor, A.D.; Gherman, C.M.; Qablan, M.; et al. Molecular detection of Anaplasma platys infection in free-roaming dogs and ticks from Kenya and Ivory Coast. Parasites Vectors 2016, 9, 157. [Google Scholar] [CrossRef] [PubMed]
- Cardoso, L.; Oliveira, A.C.; Granada, S.; Nachum-Biala, Y.; Gilad, M.; Lopes, A.P.; Sousa, S.R.; Vilhena, H.; Baneth, G. Molecular investigation of tick-borne pathogens in dogs from Luanda, Angola. Parasites Vectors 2016, 9, 252. [Google Scholar] [CrossRef] [PubMed]
- Sainz, Á.; Roura, X.; Miró, G.; Estrada-Peña, A.; Kohn, B.; Harrus, S.; Solano-Gallego, L. Guideline for veterinary practitioners on canine ehrlichiosis and anaplasmosis in Europe. Parasites Vectors 2015, 8, 75. [Google Scholar] [CrossRef]
- Bessas, A.; Leulmi, H.; Bitam, I.; Zaidi, S.; Ait-Oudhia, K.; Raoult, D.; Parola, P. Molecular evidence of vector-borne pathogens in dogs and cats and their ectoparasites in Algiers, Algeria. Comp. Immunol. Microbiol. Infect. Dis. 2016, 45, 23–28. [Google Scholar] [CrossRef] [PubMed]
- Dumler, J.S.; Walker, D.H. Ehrlichia chaffeensis (Human Monocytotropic Ehrlichiosis), Anaplasma phagocytophilum (Human Granulocytotropic Anaplasmosis), and Other Anaplasmataceae. In Mandell, Douglas, and Bennett’s Principles and Practice of Infectious Diseases; Elsevier Inc.: Amsterdam, The Netherlands, 2020; Volume 192. [Google Scholar]
- Perez, M.; Rikihisa, Y.; Wen, B. Ehrlichia canis-like agent isolated from a man in Venezuela: Antigenic and genetic characterization. J. Clin. Microbiol. 1996, 34, 2133–2139. [Google Scholar] [CrossRef]
- Marques, A.R.; Strle, F.; Wormser, G.P. Comparison of Lyme Disease in the United States and Europe. Emerg. Infect. Dis 2021, 27, 2017–2024. [Google Scholar] [CrossRef] [PubMed]
- Diouf, F.S.; Ndiaye, E.H.I.; Hammoud, A.; Diamanka, A.; Bassene, H.; Ndiaye, M.; Mediannikov, O.; Parola, P.; Raoult, D.; Sokhna, C.; et al. Detection of Coxiella burnetii and Borrelia spp. DNA in Cutaneous Samples and in Household Dust in Rural Areas, Senegal. Vector Borne Zoonotic Dis. 2021, 21, 659–666. [Google Scholar] [CrossRef] [PubMed]
- Hammouda, N.A.; Hegazy, I.H.; El-Sawy, E.H. ELISA screening for Lyme disease in children with chronic arthritis. J. Egypt. Soc. Parasitol. 1995, 25, 525–533. [Google Scholar]
- Chomel, B. Lyme Disease. Revue Scientifique et Technique. Int. Off. Epizoot. 2015, 34, 569–576. [Google Scholar] [CrossRef] [PubMed]
- Parola, P.; Paddock, C.D.; Socolovschi, C.; Labruna, M.B.; Mediannikov, O.; Kernif, T.; Abdad, M.Y.; Stenos, J.; Bitam, I.; Fournier, P.E.; et al. Update on tick-borne rickettsioses around the world: A geographic approach. Clin. Microbiol. Rev. 2013, 26, 657–702. [Google Scholar] [CrossRef]
- Solano-Gallego, L.; Caprì, A.; Pennisi, M.G.; Caldin, M.; Furlanello, T.; Trotta, M. Acute febrile illness is associated with Rickettsia spp. infection in dogs. Parasites Vectors 2015, 8, 1–10. [Google Scholar] [CrossRef]
- Nimo-Paintsil, S.C.; Mosore, M.; Addo, S.O.; Lura, T.; Tagoe, J.; Ladzekpo, D.; Addae, C.; Bentil, R.E.; Behene, E.; Dafeamekpor, C.; et al. Ticks and prevalence of tick-borne pathogens from domestic animals in Ghana. Parasites Vectors 2022, 15, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Barradas, P.F.; Vilhena, H.; Oliveira, A.C.; Granada, S.; Amorim, I.; Ferreira, P.; Cardoso, L.; Gärtner, F.; De Sousa, R. Serological and molecular detection of spotted fever group Rickettsia in a group of pet dogs from Luanda, Angola. Parasites Vectors 2017, 10, 5–8. [Google Scholar] [CrossRef]
- Lineberry, M.W.; Grant, A.N.; Sundstrom, K.D.; Little, S.E.; Allen, K.E. Diversity and geographic distribution of rickettsial agents identified in brown dog ticks from across the United States. Ticks Tick Borne Dis. 2022, 13, 102050. [Google Scholar] [CrossRef]
- Campos-Calderón, L.; Ábrego-Sánchez, L.; Solórzano-Morales, A.; Alberti, A.; Tore, G.; Zobba, R.; Jiménez-Rocha, A.E.; Dolz, G. Molecular detection and identification of Rickettsiales pathogens in dog ticks from Costa Rica. Ticks Tick Borne Dis. 2016, 7, 1198–1202. [Google Scholar] [CrossRef]
- Ionita, M.; Silaghi, C.; Mitrea, I.L.; Edouard, S.; Parola, P.; Pfister, K. Molecular detection of Rickettsia conorii and other zoonotic spotted fever group rickettsiae in ticks, Romania. Ticks Tick Borne Dis. 2016, 7, 150–153. [Google Scholar] [CrossRef] [PubMed]
- Penzhorn, B.L.; Netherlands, E.C.; Cook, C.A.; Smit, N.J.; Vorster, I.; Harrison-White, R.F.; Oosthuizen, M.C. Occurrence of Hepatozoon canis (Adeleorina: Hepatozoidae) and Anaplasma spp. (Rickettsiales: Anaplasmataceae) in black-backed jackals (Canis mesomelas) in South Africa. Parasites Vectors 2018, 11, 158. [Google Scholar] [CrossRef] [PubMed]
- Penzhorn, B.L. Don’t let sleeping dogs lie: Unravelling the identity and taxonomy of Babesia canis, Babesia rossi and Babesia vogeli. Parasites Vectors 2020, 13, 184. [Google Scholar] [CrossRef]
- Viljoen, S.; O’Riain, M.J.; Penzhorn, B.L.; Drouilly, M.; Vorster, I.; Bishop, J.M. Black-backed jackals (Canis mesomelas) from semi-arid rangelands in South Africa harbour Hepatozoon canis and a Theileria species but apparently not Babesia rossi. Vet. Parasitol. Reg. Stud. Rep. 2021, 24, 100559. [Google Scholar] [CrossRef]
- Hodžić, A.; Georges, I.; Postl, M.; Duscher, G.G.; Jeschke, D.; Szentiks, C.A.; Ansorge, H.; Heddergott, M. Molecular survey of tick-borne pathogens reveals a high prevalence and low genetic variability of Hepatozoon canis in free-ranging grey wolves (Canis lupus) in Germany. Ticks Tick Borne Dis. 2020, 11, 101389. [Google Scholar] [CrossRef] [PubMed]
- Lakshmanan, B.; Jose, K.J.; George, A.; Usha, N.P.; Devada, K. Molecular detection of Hepatozoon canis in dogs from Kerala. J. Parasit. Dis. 2018, 42, 287–290. [Google Scholar] [CrossRef]
- Sasaki, M.; Omobowale, O.; Ohta, K.; Tozuka, M.; Matsuu, A.; Hirata, H.; Nottidge, H.O.; Ikadai, H.; Oyamada, T. A PCR-based epidemiological survey of Hepatozoon canis in dogs in Nigeria. J. Vet. Med. Sci. 2008, 70, 743–745. [Google Scholar] [CrossRef][Green Version]
- Serekebirhan, T.K.; Jacob, S.R.A. Diet Composition of Black-Backed Jackal, Canis mesomelas in Nech Sar National Park, Ethiopia. J. Nat. Con. 2011, 23, 169–181. [Google Scholar]
- Morters, M.; Archer, J.; Ma, D.; Matthee, O.; Goddard, A.; Leisewitz, A.; Matjila, P.; Wood, J.; Schoeman, J. Long-term follow-up of owned, free-roaming dogs in South Africa naturally exposed to Babesia rossi. Int. J. Parasitol. 2020, 50, 103–110. [Google Scholar] [CrossRef] [PubMed]
| Pathogen | Primers | Expected Amplicon Length | Ref. |
|---|---|---|---|
| Anaplasma phagocytophilum Anaplasma platys | F (Ephpl-569F) ATGGTATGCAGTTTGATCGC R (Ephpl-1193R) TCTACTCTGTCTTTGCGTTC | 624 bp | [23] |
| Ehrlichia canis | F (Ecan-163S) AAATGTAGTTGTAACGGGTGAACAG R (Ecan-573AS) AGATAATACCTCACGCTTCATAGACA | 410 bp | [24] |
| Borrelia burgdorferi s.l. | F (GF) TACGATTTCTTATGTTGAGGG R (GR) CATTGCTTTTCGTCTATCACC | 310 bp | [25] |
| Rickettsia spp. | F (Rp877p) GGGGGCCTGCTCACGGCGG R (Pp1258n) ATTGCAAAAAGTACAGTGAACA | 381 bp | [26] |
| Piroplasms (real-time PCR and end-point PCR) | F 5′-CCAGCAGCCGCGGTAATTC-3′ R 5′-CTTTCGCAGTAGTTYGTCTTTAACAAATCT-3′ | 373 bp | [27] |
| Hepatozoon canis | Anaplasma phagocythophilum | Babesia canis rossi | Ehrlichia canis | Anaplasma platys | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Factor | Variable | Tested | Prev. * | p-Value | Prev. * | p-Value | Prev. * | p-Value | Prev. * | p-Value | Prev. * | p-Value |
| Sex | female | 92 | 53.3% | >0.1 | 4.3% | >0.1 | 6.5% | =0.065 | 3.3% | >0.1 | 2.2% | >0.1 |
| male | 181 | 54.1% | 8.3% | 1.7% | 2.2% | 2.2% | ||||||
| Age class | young | 140 | 51.4% | >0.1 | 5.7% | >0.1 | 6.4% | =0.003 | 2.9% | >0.1 | 2.1% | >0.1 |
| adult | 133 | 56.4% | 8.3% | 0.0% | 2.3% | 2.3% | ||||||
| Life style | mixed | 14 | 50.0% | >0.1 | 7.1% | >0.1 | 0.0% | >0.1 | 7.1% | >0.1 | 0.0% | >0.1 |
| outdoor | 259 | 54.1% | 6.9% | 3.5% | 2.3% | 2.3% | ||||||
| Agroecology | lowland | 186 | 56.5% | =0.022 | 9.7% | =0.033 | 0.5% | =0.001 | 3.8% | >0.1 | 2.7% | >0.1 |
| midland | 40 | 62.5% | 0.0% | 7.5% | 0.0% | 0.0% | ||||||
| highland | 47 | 36.2% | 2.1% | 10.6% | 0.0% | 2.1% | ||||||
| Location | urban | 176 | 45.5% | <0.001 | 8.5% | >0.1 | 1.7% | =0.072 | 4.0% | =0.053 | 3.4% | =0.066 |
| rural | 97 | 69.1% | 4.1% | 6.2% | 0.0% | 0.0% | ||||||
| Tick infestation | neg | 172 | 48.8% | =0.030 | 7.0% | >0.1 | 3.5% | >0.1 | 2.9% | >0.1 | 2.3% | >0.1 |
| pos | 101 | 62.4% | 6.9% | 3.0% | 2.0% | 2.0% | ||||||
| Total | 273 | 53.8% | 7.0% | 3.3% | 2.6% | 2.2% | ||||||
| Factor | Variable | Odds Ratio | 95% CI per Odds Ratio | p-Value | |
|---|---|---|---|---|---|
| Lower | Upper | ||||
| Location | rural | reference | |||
| urban | 0.283 | 0.144 | 0.555 | <0.001 | |
| Agroecology | lowland | reference | |||
| midland | 0.478 | 0.195 | 1.171 | >0.050 | |
| highland | 0.404 | 0.203 | 0.806 | 0.010 | |
| Factor | Variable | Odds Ratio | 95% CI per Odds Ratio | p-Value | |
|---|---|---|---|---|---|
| Lower | Upper | ||||
| Agroecology | lowland | reference | |||
| midland | 19.207 | 1.801 | 204.900 | 0.014 | |
| highland | 17.935 | 1.961 | 164.063 | 0.011 | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tadesse, H.; Grillini, M.; Simonato, G.; Mondin, A.; Dotto, G.; Frangipane di Regalbono, A.; Kumsa, B.; Cassini, R.; Menandro, M.L. Epidemiological Survey on Tick-Borne Pathogens with Zoonotic Potential in Dog Populations of Southern Ethiopia. Trop. Med. Infect. Dis. 2023, 8, 102. https://doi.org/10.3390/tropicalmed8020102
Tadesse H, Grillini M, Simonato G, Mondin A, Dotto G, Frangipane di Regalbono A, Kumsa B, Cassini R, Menandro ML. Epidemiological Survey on Tick-Borne Pathogens with Zoonotic Potential in Dog Populations of Southern Ethiopia. Tropical Medicine and Infectious Disease. 2023; 8(2):102. https://doi.org/10.3390/tropicalmed8020102
Chicago/Turabian StyleTadesse, Hana, Marika Grillini, Giulia Simonato, Alessandra Mondin, Giorgia Dotto, Antonio Frangipane di Regalbono, Bersissa Kumsa, Rudi Cassini, and Maria Luisa Menandro. 2023. "Epidemiological Survey on Tick-Borne Pathogens with Zoonotic Potential in Dog Populations of Southern Ethiopia" Tropical Medicine and Infectious Disease 8, no. 2: 102. https://doi.org/10.3390/tropicalmed8020102
APA StyleTadesse, H., Grillini, M., Simonato, G., Mondin, A., Dotto, G., Frangipane di Regalbono, A., Kumsa, B., Cassini, R., & Menandro, M. L. (2023). Epidemiological Survey on Tick-Borne Pathogens with Zoonotic Potential in Dog Populations of Southern Ethiopia. Tropical Medicine and Infectious Disease, 8(2), 102. https://doi.org/10.3390/tropicalmed8020102

