Plant Growth Regulators Enhance Floral Induction of ‘Ziniangxi’ Litchi Under Warm–Humid Winters
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Climate Conditions During the Experimental Period
2.3. Single-Agent Plant Growth Regulator Applications
2.4. Composite Plant Growth Regulators and Key Nutrient Appications
2.5. Quantification of Starch and Sucrose
2.6. qPCR Analysis of Flowering-Related Genes
2.7. Statistical Analysis
3. Results
3.1. Climate Conditions and Carbohydrate Profiles Associated with Bud Fate in ‘Ziniangxi’
3.2. Single-Agent Effects on ‘Ziniangxi’ Bud Fate in Warm, Humid Winters
3.3. Composite PGRs Effects on ‘Ziniangxi’ Bud Fate in Warm, Humid Winters
4. Discussion
4.1. Partial Recovery of Flowering Under Warm–Humid, Marginal-Chill Winters
4.2. Hormonal Crosstalk, Carbohydrate Status and Floral Gene Expression
4.3. Limitations of the Present Study and Implications for Practice
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Chen, H.; Yang, S.; Su, Z.; Ou, S.; Pan, W.; Peng, X. Analysis of the National Litchi Production in 2024 and Management Suggestions. China Trop. Agric. 2024, 3, 8–20. (In Chinese) [Google Scholar]
- Hu, G.; Yang, S.; Qi, W. Analysis of China’s Litchi Production in 2025 and Management Recommendations. China Trop. Agric. 2025, 2, 8–16. (In Chinese) [Google Scholar]
- Huang, H.B.; Chen, H.B. A phase approach towards floral formation in lychee. Acta Hortic. 2005, 665, 185–194. [Google Scholar] [CrossRef]
- Singh, R.K.; Maurya, J.P.; Azeez, A.; Miskolczi, P.; Tylewicz, S.; Stojkovič, K.; Bhalerao, R.P. A genetic network mediating the control of bud break in hybrid aspen. Nat. Commun. 2018, 9, 4173. [Google Scholar] [CrossRef]
- Yang, M.C.; Wu, Z.C.; Chen, R.Y.; Abbas, F.; Hu, G.B.; Huang, X.M.; Wang, H.C. Single-nucleus RNA sequencing and mRNA hybridization indicate key bud events and LcFT1 and LcTFL1-2 mRNA transportability during floral transition in litchi. J. Exp. Bot. 2023, 74, 3613–3629. [Google Scholar] [CrossRef]
- Wilkie, J.D.; Sedgley, M.; Olesen, T. Regulation of floral initiation in horticultural trees. J. Exp. Bot. 2008, 59, 3215–3228. [Google Scholar] [CrossRef]
- Lal, N.; Pandey, S.K.; Nath, V. Effect of weather on panicle development, flower morphogenesis and fruit set in litchi cv. Shahi. Plant Physiol. Rep. 2025, 30, 53–57. [Google Scholar] [CrossRef]
- Li, H. Longan fruit tree physiology and its flowering induction. In Handbook of Plant and Crop Physiology; CRC Press: Boca Raton, FL, USA, 2021; pp. 77–97. [Google Scholar]
- Zhang, H.; Shen, J.; Wei, Y.; Chen, H. Transcriptome profiling of litchi leaves in response to low temperature reveals candidate regulatory genes and key metabolic events during floral induction. BMC Genom. 2017, 18, 363. [Google Scholar] [CrossRef]
- Liu, H.; Wang, C.; Chen, H.; Zhou, B. Genome-wide transcriptome analysis reveals the molecular mechanism of high temperature-induced floral abortion in Litchi chinensis. BMC Genom. 2019, 20, 127. [Google Scholar] [CrossRef]
- Zhu, Y.; Klasfeld, S.; Jeong, C.W.; Jin, R.; Goto, K.; Yamaguchi, N.; Wagner, D. TERMINAL FLOWER 1–FD complex target genes and competition with FLOWERING LOCUS T. Nat. Commun. 2020, 11, 5118. [Google Scholar] [CrossRef]
- Xie, X.; Zhang, H.; Kong, Z.; Qian, D.; Liu, X.; Zhao, M.; Li, J. Cytokinin response factor LcARR11 promotes floral bud physiological differentiation by activating LcIPT3 and LcFT1 in litchi. Hortic. Res. 2025, 12, uhaf218. [Google Scholar] [CrossRef]
- Gui, Q.; Wei, J.; Wu, Z.; Mo, X.; Qing, H.; Shi, Y.; Guo, H.; Sheng, J.; Ding, F.; Zhang, S. Litchi LcAP1-1 and LcAP1-2 Exhibit Different Roles in Flowering Time. Plants 2025, 14, 2697. [Google Scholar] [CrossRef]
- Ma, M.M.; Zhang, H.F.; Tian, Q.; Wang, H.C.; Zhang, F.Y.; Tian, X.; Zeng, R.F.; Huang, X.M. MIKC type MADS-box transcription factor LcSVP2 is involved in dormancy regulation of the terminal buds in evergreen perennial litchi (Litchi chinensis Sonn.). Hortic. Res. 2024, 11, uhae150. [Google Scholar] [CrossRef]
- Balanzà, V.; Martínez-Fernández, I.; Ferrándiz, C. Sequential action of FRUITFULL as a modulator of the activity of the floral regulators SVP and SOC1. J. Exp. Bot. 2014, 65, 1193–1203. [Google Scholar] [CrossRef]
- Hu, T.; Li, X.; Du, L.; Manuela, D.; Xu, M. LEAFY and APETALA1 down-regulate ZINC FINGER PROTEIN 1 and 8 to release their repression on class B and C floral homeotic genes. Proc. Natl. Acad. Sci. USA 2023, 120, e2221181120. [Google Scholar] [CrossRef] [PubMed]
- Wu, X.; Li, Y.; Zhang, S.; Qie, M.; Feng, X.; Xie, J.; Cao, M.; He, S.; Jiang, Y.; Hou, Z. Sucrose participates in the flower bud differentiation regulation promoted by short pruning in blueberry. Fruit Res. 2025, 5, e025. [Google Scholar] [CrossRef]
- Yang, H.F.; Kim, H.J.; Chen, H.B.; Rahman, J.; Lu, X.Y.; Zhou, B.Y. Carbohydrate accumulation and flowering-related gene expression levels at different developmental stages of terminal shoots in Litchi chinensis. HortScience 2014, 49, 1381–1391. [Google Scholar] [CrossRef]
- Singh, S.K.; Kumar, A.; Purbey, S.K.; Sharma, S. Improving Flowering and Fruit Quality in Litchi: Applying PGRs and Chemical Regulants. In ICAR–National Research Centre on Litchi; EXCEL India Publishers: Delhi, India, 2016. [Google Scholar]
- Pal, S.L. Role of plant growth regulators in floriculture: An overview. J. Pharmacogn. Phytochem. 2019, 8, 789–796. [Google Scholar]
- Wen, B.; Deng, C.; Tian, Q.; Ouyang, J.; Zeng, R.; Wang, H.; Huang, X. Application of ethephon manually or via drone enforces bud dormancy and enhances flowering response to chilling in litchi (Litchi chinensis Sonn.). Horticulturae 2024, 10, 1109. [Google Scholar] [CrossRef]
- Cronje, R.B.; Hajari, E.; Jonker, A.; Ratlapane, I.M.; Huang, X.; Theron, K.I.; Hoffman, E.W. Foliar application of ethephon induces bud dormancy and affects gene expression of dormancy- and flowering-related genes in ‘Mauritius’ litchi (Litchi chinensis Sonn.). J. Plant Physiol. 2022, 276, 153768. [Google Scholar] [CrossRef]
- Cui, Z.; Zhou, B.; Zhang, Z.; Hu, Z. Abscisic acid promotes flowering and enhances LcAP1 expression in Litchi chinensis Sonn. S. Afr. J. Bot. 2013, 88, 76–79. [Google Scholar] [CrossRef]
- Hu, X.; Hu, F.; Fan, H.; Wang, X.; Han, B.; Lin, Y. Effects of five plant growth regulators on blooming and fruit-setting of ‘Feizixiao’ litchi. Southwest China J. Agric. Sci. 2016, 4, 915–919. (In Chinese) [Google Scholar]
- Kutschera, U.; Wang, Z.Y. Brassinosteroid action in flowering plants: A Darwinian perspective. J. Exp. Bot. 2012, 63, 3511–3522. [Google Scholar] [CrossRef]
- Chen, W.S. Changes in cytokinins before and during early flower bud differentiation in lychee (Litchi chinensis Sonn.). Plant Physiol. 1991, 96, 1203–1206. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Yan, T.; Wang, M.; Dong, Y.; Yang, M.; Zhou, W.; Zhou, R.; Chen, Z.; Hu, F.; Wang, X. Effect of compound plant growth regulators on the flowering and fruit setting in litchi. China Fruits 2024, 4, 83–95. (In Chinese) [Google Scholar]
- Wang, M.Q.; Wu, W.D.; Yan, T.T.; Yang, M.; Hu, F. Regulation effect of different growth regulators on the flowering of ’Feizixiao’ litchi. China Trop. Agric. 2024, 2, 30–34, 29. (In Chinese) [Google Scholar]
- Sebastian, K.; Arya, M.S.; Reshma, U.R.; Anaswara, S.J.; Thampi, S.S. Impact of plant growth regulators on fruit production. Int. J. Curr. Microbiol. Appl. Sci. 2019, 8, 800–814. [Google Scholar] [CrossRef]
- Shen, J.; Xiao, Q.; Qiu, H.; Chen, C.; Chen, H. Integrative effect of drought and low temperature on litchi (Litchi chinensis Sonn.) Flor. Initiat. Reveal. Dyn. Genome-Wide Transcr. Analysis. Sci. Rep. 2016, 6, 32005. [Google Scholar]
- Liu, P.X. Studies on the Relationship Between Flowering and Chilling Accumulation and Flowering Regulation in litchi (Litchi chinensis Sonn.). Master’s Thesis, South China Agricultural University, Guangzhou, China, 2017. (In Chinese). [Google Scholar]
- Guo, L.; Dai, J.; Ranjitkar, S.; Yu, H.; Xu, J.; Luedeling, E. Chilling and heat requirements for flowering in temperate fruit trees. Int. J. Biometeorol. 2014, 58, 1195–1206. [Google Scholar] [CrossRef]
- Zhang, H.N.; Wei, Y.Z.; Shen, J.Y.; Lai, B.; Huang, X.M.; Ding, F.; Chen, H.B. Transcriptomic analysis of floral initiation in litchi (Litchi chinensis Sonn.) Based De Novo RNA Sequencing. Plant Cell Rep. 2014, 33, 1723–1735. [Google Scholar] [CrossRef]
- Al-Turabi, Z.M.A.; Trad, S.A.; Al-Zurfi, M.T.H. Effect of spraying with brassinolide and boric acid on growth and flowering of Osteospermum ecklonis. IOP Conf. Ser. Earth Environ. Sci. 2025, 1487, 012051. [Google Scholar] [CrossRef]
- Sheng, J.; Li, X.; Zhang, D. Gibberellins, brassinolide, and ethylene signaling were involved in flower differentiation and development in Nelumbo nucifera. Hortic. Plant J. 2022, 8, 243–250. [Google Scholar] [CrossRef]
- Cho, L.H.; Pasriga, R.; Yoon, J.; Jeon, J.S.; An, G. Roles of sugars in controlling flowering time. J. Plant Biol. 2018, 61, 121–130. [Google Scholar] [CrossRef]
- Huang, X.M.; Chen, H.B. Studies on shoot, flower and fruit development in litchi and strategies for improved litchi production. Acta Hortic. 2014, 1029, 127–136. [Google Scholar] [CrossRef]
- Ding, F.; Zhang, S.; Chen, H.; Su, Z.; Zhang, R.; Xiao, Q.; Li, H. Promoter difference of LcFT1 is a leading cause of natural variation of flowering timing in different litchi cultivars (Litchi chinensis Sonn.). Plant Sci. 2015, 241, 128–137. [Google Scholar] [CrossRef] [PubMed]







| Group | Treatment | Concentration (mg/L) |
|---|---|---|
| 6-BA | 6-Benzylaminopurine (6-BA) | 13.33 |
| ABA | Abscisic acid (ABA) | 3.33 |
| BR | Brassinolide (BR) | 0.05 |
| ETH0.2 | Ethephon | 26.67 |
| ETH0.8 | Ethephon | 80.00 |
| Oxy | Oxyfluorfen | 1.80 |
| CK | Water | - |
| Group | Treatment and Concentration |
|---|---|
| A | Ethephon 26.67 mg/L + Uniconazole 33.33 mg/L |
| B | Ethephon 26.67 mg/L + Oxyfluorfen 1.80 mg/L |
| C | Ethephon 26.67 mg/L + Oxyfluorfen 1.80 mg/L + Glucose 10.00 g/L |
| D | Ethephon 26.67 mg/L + Oxyfluorfen 1.80 mg/L + Trehalose 5.00 g/L |
| E | Ethephon 26.67 mg/L + Oxyfluorfen 1.80 mg/L + Sucrose 10.00 g/L |
| F | Ethephon 26.67 mg/L + Uniconazole 33.33 mg/L + ABA 0.06 mg/L |
| G | Ethephon 26.67 mg/L + Uniconazole 33.33 mg/L + ABA 0.06 mg/L + Oxyfluorfen 1.80 mg/L |
| H | Diethyl aminoethyl hexanoate (DA-6) 0.40 g/L + Potassium Dihydrogen Phosphate (KH2PO4) 1.00 g/L |
| I | Prohexadione calcium 66.67 mg/L + KH2PO4 1.00 g/L |
| J | 6-BA 13.33 mg/L + Triacontanol 0.67 mg/L + Boric acid 0.67 g/L + KH2PO4 1.00 g/L |
| K | BR 0.05 mg/L + ABA 0.06 mg/L + KH2PO4 1.00 g/L+ Boric acid 0.67 mg/L |
| L | BR 0.05 mg/L + ABA 0.06 mg/L + KH2PO4 1.00 g/L |
| M | 6-BA 13.33 mg/L + Triacontanol 0.67 mg/L + KH2PO4 1.00 g/L |
| CK | Water |
| Gene Name | Forward Primer Sequence | Reversed Primer Sequence |
|---|---|---|
| LcFLC | TAACCACTCCATTTCAACCTCATT | CTTCCTGTCAATCCTTCATCTTCA |
| LcFD | AACAACGACAACAACAACAATGG | CGATGGAGAAGAGCAGGTAGA |
| LcAP2 | TGGCAATCAGGTCCTCATCA | GTCTAATCTGTGGTGCGAATCC |
| LcTFL1-1 [5] | AAAGAAGTGGTGGGCTACGAGATT | TAGACAGCAGCGACGGGAAG |
| LcLFY | GCGGCGGCGGAGAAGAAG | TGCCACCACTACCACCGTTATCG |
| LcFUL | GCCCGAACTCGTCCACTATTCTTT | CGCCTCCGCTGGTCCTTG |
| LcActin [5] | ACCGTATGAGCAAGGAAATCACTG | TCGTCGTACTCACCCTTTGAAATC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, M.; Chen, D.; He, Y.; Hu, F.; Yan, T.; Chen, Z.; Wang, X. Plant Growth Regulators Enhance Floral Induction of ‘Ziniangxi’ Litchi Under Warm–Humid Winters. Horticulturae 2025, 11, 1522. https://doi.org/10.3390/horticulturae11121522
Yang M, Chen D, He Y, Hu F, Yan T, Chen Z, Wang X. Plant Growth Regulators Enhance Floral Induction of ‘Ziniangxi’ Litchi Under Warm–Humid Winters. Horticulturae. 2025; 11(12):1522. https://doi.org/10.3390/horticulturae11121522
Chicago/Turabian StyleYang, Mingchao, Ding Chen, Yukun He, Fuchu Hu, Tingting Yan, Zhe Chen, and Xianghe Wang. 2025. "Plant Growth Regulators Enhance Floral Induction of ‘Ziniangxi’ Litchi Under Warm–Humid Winters" Horticulturae 11, no. 12: 1522. https://doi.org/10.3390/horticulturae11121522
APA StyleYang, M., Chen, D., He, Y., Hu, F., Yan, T., Chen, Z., & Wang, X. (2025). Plant Growth Regulators Enhance Floral Induction of ‘Ziniangxi’ Litchi Under Warm–Humid Winters. Horticulturae, 11(12), 1522. https://doi.org/10.3390/horticulturae11121522

