Mesenchymal Stem Cells–Hydrogel Microspheres System for Bone Regeneration in Calvarial Defects
Abstract
:1. Introduction
2. Results
2.1. Physical and Biocompatible Characterization of HMs
2.2. Differentiation Effect of HMs on Stem Cells
2.3. In Vivo Evaluation of BMSC/HMs System for Bone Regeneration with Skull Defect Model
3. Discussion
4. Conclusions
5. Materials and Methods
5.1. Preparation of HMs
5.2. Cell Culture
5.3. Cell Viability
5.4. Cell Proliferation
5.5. Quantitative Real-Time PCR
5.6. Animal Model of Cranial Bone Defect
5.7. Micro-CT
5.8. Histological Analysis
5.9. Immunohistochemistry (IHC)
5.10. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Wilcock, C.J.; Stafford, G.P.; Miller, C.A.; Ryabenkova, Y.; Fatima, M.; Gentile, P.; Möbus, G.; Hatton, P.V. Preparation and Antibacterial Properties of Silver-Doped Nanoscale Hydroxyapatite Pastes for Bone Repair and Augmentation. J. Biomed. Nanotechnol. 2017, 13, 1168–1176. [Google Scholar] [CrossRef] [PubMed]
- Shao, R.; Dong, Y.; Zhang, S.; Wu, X.; Huang, X.; Sun, B.; Zeng, B.; Xu, F.; Liang, W. State of the art of bone biomaterials and their interactions with stem cells: Current state and future directions. Biotechnol. J. 2022, 17, 2100074. [Google Scholar] [CrossRef] [PubMed]
- Borzunov, D.Y.; Shastov, A.L. Mechanical solutions to salvage failed distraction osteogenesis in large bone defect management. Int. Orthop. 2018, 43, 1051–1059. [Google Scholar] [CrossRef] [PubMed]
- Zhang, M.; Matinlinna, J.P.; Tsoi, J.K.H.; Liu, W.; Cui, X.; Lu, W.W.; Pan, H. Recent developments in biomaterials for long-bone segmental defect reconstruction: A narrative overview. J. Orthop. Transl. 2020, 22, 26–33. [Google Scholar] [CrossRef]
- Wang, W.; Yeung, K.W.K. Bone grafts and biomaterials substitutes for bone defect repair: A review. Bioact. Mater. 2017, 2, 224–247. [Google Scholar] [CrossRef]
- Hollý, D.; Klein, M.; Mazreku, M.; Zamborský, R.; Polák, Š.; Danišovič, Ľ.; Csöbönyeiová, M. Stem Cells and Their Derivatives—Implications for Alveolar Bone Regeneration: A Comprehensive Review. Int. J. Mol. Sci. 2021, 22, 11746. [Google Scholar] [CrossRef]
- Zhang, Q.; Nettleship, I.; Schmelzer, E.; Gerlach, J.C.; Zhang, M.X.; Wang, J.; Liu, C. Tissue Engineering and Regenerative Medicine Therapies for Cell Senescence in Bone and Cartilage. Tissue Eng. Part B Rev. 2020, 26, 64–78. [Google Scholar] [CrossRef] [Green Version]
- Dixon, D.T.; Gomillion, C.T. Conductive Scaffolds for Bone Tissue Engineering: Current State and Future Outlook. J. Funct. Biomater. 2021, 13, 1. [Google Scholar] [CrossRef]
- Nallusamy, J.; Das, R.K. Hydrogels and Their Role in Bone Tissue Engineering: An Overview. J. Pharm. Bioallied Sci. 2021, 13 (Suppl. S2), S908–S912. [Google Scholar]
- Tharakan, S.; Khondkar, S.; Ilyas, A. Bioprinting of Stem Cells in Multimaterial Scaffolds and Their Applications in Bone Tissue Engineering. Sensors 2021, 21, 7477. [Google Scholar] [CrossRef]
- Wang, B.; Xu, W.; Yang, Z.; Wu, Y.; Pi, F. An Overview on Recent Progress of the Hydrogels: From Material Resources, Properties, to Functional Applications. Macromol. Rapid Commun. 2022, 43, 2100785. [Google Scholar] [CrossRef]
- Li, X.; Yang, Z.; Fang, L.; Ma, C.; Zhao, Y.; Liu, H.; Che, S.; Zvyagin, A.V.; Yang, B.; Lin, Q. Hydrogel Composites with Different Dimensional Nanoparticles for Bone Regeneration. Macromol. Rapid Commun. 2021, 42, 2100362. [Google Scholar] [CrossRef]
- Wu, Y.; Zhang, X.; Zhao, Q.; Tan, B.; Chen, X.; Liao, J. Role of Hydrogels in Bone Tissue Engineering: How Properties Shape Regeneration. J. Biomed. Nanotechnol. 2020, 16, 1667–1686. [Google Scholar] [CrossRef]
- Shanbhag, S.; Suliman, S.; Mohamed-Ahmed, S.; Kampleitner, C.; Hassan, M.N.; Heimel, P.; Dobsak, T.; Tangl, S.; Bolstad, A.I.; Mustafa, K. Bone regeneration in rat calvarial defects using dissociated or spheroid mesenchymal stromal cells in scaffold-hydrogel constructs. Stem Cell Res. Ther. 2021, 12, 575. [Google Scholar] [CrossRef]
- Habanjar, O.; Diab-Assaf, M.; Caldefie-Chezet, F.; Delort, L. 3D Cell Culture Systems: Tumor Application, Advantages, and Disadvantages. Int. J. Mol. Sci. 2021, 22, 12200. [Google Scholar] [CrossRef]
- Riley, L.; Schirmer, L.; Segura, T. Granular hydrogels: Emergent properties of jammed hydrogel microparticles and their applications in tissue repair and regeneration. Curr. Opin. Biotechnol. 2019, 60, 1–8. [Google Scholar] [CrossRef]
- Daly, A.C.; Riley, L.; Segura, T.; Burdick, J.A. Hydrogel microparticles for biomedical applications. Nat. Rev. Mater. 2019, 5, 20–43. [Google Scholar] [CrossRef]
- He, Q.; Liao, Y.; Zhang, J.; Yao, X.; Zhou, W.; Hong, Y.; Ouyang, H. “All-in-One” Gel System for Whole Procedure of Stem-Cell Amplification and Tissue Engineering. Small 2020, 16, e1906539. [Google Scholar] [CrossRef]
- Annamalai, R.T.; Hong, X.; Schott, N.G.; Tiruchinapally, G.; Levi, B.; Stegemann, J.P. Injectable osteogenic microtissues containing mesenchymal stromal cells conformally fill and repair critical-size defects. Biomaterials 2019, 208, 32–44. [Google Scholar] [CrossRef]
- Wang, L.; Rao, R.R.; Stegemann, J.P. Delivery of mesenchymal stem cells in chitosan/collagen microbeads for orthopedic tissue repair. Cells Tissues Organs 2013, 197, 333–343. [Google Scholar] [CrossRef] [Green Version]
- Feyen, D.A.M.; Gaetani, R.; Deddens, J.; van Keulen, D.; van Opbergen, C.; Poldervaart, M.; Alblas, J.; Chamuleau, S.; van Laake, L.W.; Doevendans, P.A.; et al. Gelatin Microspheres as Vehicle for Cardiac Progenitor Cells Delivery to the Myocardium. Adv. Health Mater. 2016, 5, 1071–1079. [Google Scholar] [CrossRef] [PubMed]
- Shrestha, P.; Regmi, S.; Jeong, J.-H. Injectable hydrogels for islet transplantation: A concise review. J. Pharm. Investig. 2019, 50, 29–45. [Google Scholar] [CrossRef]
- Han, Y.; Yang, J.; Zhao, W.; Wang, H.; Sun, Y.; Chen, Y.; Luo, J.; Deng, L.; Xu, X.; Cui, W.; et al. Biomimetic injectable hydrogel microspheres with enhanced lubrication and controllable drug release for the treatment of osteoarthritis. Bioact. Mater. 2021, 6, 3596–3607. [Google Scholar] [CrossRef] [PubMed]
- Wei, S.; Ma, J.-X.; Xu, L.; Gu, X.-S.; Ma, X.-L. Biodegradable materials for bone defect repair. Mil. Med. Res. 2020, 7, 1–25. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Luo, D.; Wang, T. Hierarchical Structures of Bone and Bioinspired Bone Tissue Engineering. Small 2016, 12, 4611–4632. [Google Scholar] [CrossRef]
- Sunami, H.; Yokota, I.; Igarashi, Y. Influence of the pattern size of micropatterned scaffolds on cell morphology, proliferation, migration and F-actin expression. Biomater. Sci. 2014, 2, 399–409. [Google Scholar] [CrossRef] [Green Version]
- Caron, M.M.J.; Emans, P.J.; Coolsen, M.M.E.; Voss, L.; Surtel, D.A.M.; Cremers, A.; van Rhijn, L.W.; Welting, T.J.M. Redifferentiation of dedifferentiated human articular chondrocytes: Comparison of 2D and 3D cultures. Osteoarthr. Cartil. 2012, 20, 1170–1178. [Google Scholar] [CrossRef] [Green Version]
- Li, B.; Wang, X.; Wang, Y.; Gou, W.; Yuan, X.; Peng, J.; Guo, Q.; Lu, S. Past, present, and future of microcarrier-based tissue engineering. J. Orthop. Transl. 2015, 3, 51–57. [Google Scholar] [CrossRef] [Green Version]
- Yue, K.; Trujillo-de Santiago, G.; Alvarez, M.M.; Tamayol, A.; Annabi, N.; Khademhosseini, A. Synthesis, properties, and biomedical applications of gelatin methacryloyl (GelMA) hydrogels. Biomaterials 2015, 73, 254–271. [Google Scholar] [CrossRef] [Green Version]
- Celikkin, N.; Mastrogiacomo, S.; Jaroszewicz, J.; Walboomers, X.F.; Swieszkowski, W. Gelatin methacrylate scaffold for bone tissue engineering: The influence of polymer concentration. J. Biomed. Mater. Res. Part A 2018, 106, 201–209. [Google Scholar] [CrossRef]
- Owston, H.; Giannoudis, P.V.; Jones, E. Do skeletal muscle MSCs in humans contribute to bone repair? A systematic review. Injury 2016, 47, S3–S15. [Google Scholar] [CrossRef]
- Fu, G.; Ren, A.; Qiu, Y.; Zhang, Y. Epigenetic Regulation of Osteogenic Differentiation of Mesenchymal Stem Cells. Curr. Stem Cell Res. Ther. 2016, 11, 235–246. [Google Scholar] [CrossRef]
- Moradi, A.; Pakizeh, M.; Ghassemi, T. A review on bovine hydroxyapatite; extraction and characterization. Biomed. Phys. Eng. Express 2021, 8, 012001. [Google Scholar] [CrossRef]
- Chen, L.; Al-Bayatee, S.; Khurshid, Z.; Shavandi, A.; Brunton, P.; Ratnayake, J. Hydroxyapatite in Oral Care Products—A Review. Materials 2021, 14, 4865. [Google Scholar] [CrossRef]
- Arcos, D.; Vallet-Regí, M. Substituted hydroxyapatite coatings of bone implants. J. Mater. Chem. B 2020, 8, 1781–1800. [Google Scholar] [CrossRef]
- Ma, Y.; You, Y.; Cao, L.; Liang, B.; Tian, B.; Dong, J.; Lin, H. Improved Osteogenesis by Mineralization Combined with Double-Crosslinked Hydrogel Coating for Proliferation and Differentiation of Mesenchymal Stem Cells. Front. Bioeng. Biotechnol. 2021, 9, 706423. [Google Scholar] [CrossRef]
- Liu, C.; Pan, L.; Liu, W.; Li, Y.; Cheng, X.; Jian, X. Enhancing Tissue Adhesion and Osteoblastic Differentiation of MC3T3-E1 Cells on Poly(aryl ether ketone) by Chemically Anchored Hydroxyapatite Nanocomposite Hydrogel Coating. Macromol. Biosci. 2021, 21, 2100078. [Google Scholar] [CrossRef]
- Anada, T.; Pan, C.-C.; Stahl, A.M.; Mori, S.; Fukuda, J.; Suzuki, O.; Yang, Y. Vascularized Bone-Mimetic Hydrogel Constructs by 3D Bioprinting to Promote Osteogenesis and Angiogenesis. Int. J. Mol. Sci. 2019, 20, 1096. [Google Scholar] [CrossRef] [Green Version]
- Qiao, Y.; Liu, X.; Zhou, X.; Zhang, H.; Zhang, W.; Xiao, W.; Pan, G.; Cui, W.; Santos, H.A.; Shi, Q. Gelatin Templated Polypeptide Co-Cross-Linked Hydrogel for Bone Regeneration. Adv. Health Mater. 2019, 9, e1901239. [Google Scholar] [CrossRef]
- Valtanen, R.S.; Yang, Y.P.; Gurtner, G.C.; Maloney, W.J.; Lowenberg, D.W. Synthetic and Bone tissue engineering graft substitutes: What is the future? Injury 2021, 52, S72–S77. [Google Scholar] [CrossRef]
- Arshad, S.; Tehreem, F.; Khan, M.R.; Ahmed, F.; Marya, A.; Karobari, M.I. Platelet-Rich Fibrin Used in Regenerative Endodontics and Dentistry: Current Uses, Limitations, and Future Recommendations for Application. Int. J. Dent. 2021, 2021, 4514598. [Google Scholar] [CrossRef] [PubMed]
- Byambaa, B.; Annabi, N.; Yue, K.; Trujillo-de Santiago, G.; Alvarez, M.M.; Jia, W.; Kazemzadeh-Narbat, M.; Shin, S.R.; Tamayol, A.; Khademhosseini, A. Bioprinted Osteogenic and Vasculogenic Patterns for Engineering 3D Bone Tissue. Adv. Healthc. Mater. 2017, 6, 1700015. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lai, T.C.; Yu, J.; Tsai, W.B. Gelatin methacrylate/carboxybetaine methacrylate hydrogels with tunable crosslinking for controlled drug release. J. Mater. Chem. B 2016, 4, 2304–2313. [Google Scholar] [CrossRef] [PubMed]
- Hao, J.; Zhang, Y.; Jing, D.; Shen, Y.; Tang, G.; Huang, S.; Zhao, Z. Mechanobiology of mesenchymal stem cells: Perspective into mechanical induction of MSC fate. Acta Biomater. 2015, 20, 1–9. [Google Scholar] [CrossRef]
- Miyashita, S.; Ahmed, N.E.M.B.; Murakami, M.; Iohara, K.; Yamamoto, T.; Horibe, H.; Kurita, K.; Takano-Yamamoto, T.; Nakashima, M. Mechanical forces induce odontoblastic differentiation of mesenchymal stem cells on three-dimensional biomimetic scaffolds. J. Tissue Eng. Regen. Med. 2017, 11, 434–446. [Google Scholar] [CrossRef]
- Wang, L.; Zheng, F.; Song, R.; Zhuang, L.; Yang, M.; Suo, J.; Li, L. Integrins in the Regulation of Mesenchymal Stem Cell Differentiation by Mechanical Signals. Stem Cell Rev. Rep. 2021, 18, 126–141. [Google Scholar] [CrossRef]
- Žigon-Branc, S.; Markovic, M.; Van Hoorick, J.; Van Vlierberghe, S.; Dubruel, P.; Zerobin, E.; Baudis, S.; Ovsianikov, A. Impact of Hydrogel Stiffness on Differentiation of Human Adipose-Derived Stem Cell Microspheroids. Tissue Eng. Part A 2019, 25, 1369–1380. [Google Scholar] [CrossRef]
- Liu, Y.; Li, Z.; Li, J.; Yang, S.; Zhang, Y.; Yao, B.; Song, W.; Fu, X.; Huang, S. Stiffness-mediated mesenchymal stem cell fate decision in 3D-bioprinted hydrogels. Burn. Trauma 2020, 8, tkaa029. [Google Scholar] [CrossRef]
- Hwang, J.-H.; Byun, M.R.; Kim, A.R.; Kim, K.M.; Cho, H.J.; Lee, Y.H.; Kim, J.; Jeong, M.G.; Hwang, E.S.; Hong, J.-H. Extracellular Matrix Stiffness Regulates Osteogenic Differentiation through MAPK Activation. PLoS ONE 2015, 10, e0135519. [Google Scholar] [CrossRef] [Green Version]
- Pacelli, S.; Maloney, R.; Chakravarti, A.R.; Whitlow, J.; Basu, S.; Modaresi, S.; Gehrke, S.; Paul, A. Controlling Adult Stem Cell Behavior Using Nanodiamond-Reinforced Hydrogel: Implication in Bone Regeneration Therapy. Sci. Rep. 2017, 7, 6577. [Google Scholar] [CrossRef] [Green Version]
Gene | Forward (5′-3′) | Reverse (5′-3′) |
---|---|---|
GAPDH | GGCAAGTTCAACGGCACAG | CGCCAGTAGACTCCACGACAT |
RUNX2 | AGAATGGACGTGCCCCCTA | CTGGGGAAGCAGCAACACTA |
OCN | GCTCTGTGCTCCTGCATCTG | GCTCTGTGCTCCTGCATCTG |
BMP2 | CGCCTCACAAACAACCACAG | AATGACTCGGTTGGTCTCGG |
SOX9 | CTGACCGTGACCGTAGCAAGT | TGGATGTGGGCTTTGGACTCA |
COLL2 | GCTCCCAGAACATCACCTACCA | ATTCCTGCTCAGGCCCTCC |
PPARγ | GAACGTGAAGCCCATCGAGGAC | GGAGCACCTTGGCGAACAGC |
LPL | GCTGGCGTGGCAGGAAGTC | AGGCGACTAGGGGCTTCTGC |
C/EBPα | CAAGAACAGCAACGAGTACCG | GTCACTGGTCAACTCCAGCAC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Teng, C.; Tong, Z.; He, Q.; Zhu, H.; Wang, L.; Zhang, X.; Wei, W. Mesenchymal Stem Cells–Hydrogel Microspheres System for Bone Regeneration in Calvarial Defects. Gels 2022, 8, 275. https://doi.org/10.3390/gels8050275
Teng C, Tong Z, He Q, Zhu H, Wang L, Zhang X, Wei W. Mesenchymal Stem Cells–Hydrogel Microspheres System for Bone Regeneration in Calvarial Defects. Gels. 2022; 8(5):275. https://doi.org/10.3390/gels8050275
Chicago/Turabian StyleTeng, Chong, Zhicheng Tong, Qiulin He, Huangrong Zhu, Lu Wang, Xianzhu Zhang, and Wei Wei. 2022. "Mesenchymal Stem Cells–Hydrogel Microspheres System for Bone Regeneration in Calvarial Defects" Gels 8, no. 5: 275. https://doi.org/10.3390/gels8050275
APA StyleTeng, C., Tong, Z., He, Q., Zhu, H., Wang, L., Zhang, X., & Wei, W. (2022). Mesenchymal Stem Cells–Hydrogel Microspheres System for Bone Regeneration in Calvarial Defects. Gels, 8(5), 275. https://doi.org/10.3390/gels8050275