Exploring the Putative Involvement of MALAT1 in Mediating the Beneficial Effect of Exendin-4 on Oleic Acid-Induced Lipid Accumulation in HepG2 Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. HepG2 Culture and OA Preparation
2.2. Induction of Steatosis and Treatment with Exendin-4
2.3. Quantification of Steatosis
2.4. Total RNA Isolation and Real-Time PCR
2.5. Cell Transfection and MALAT1 Knockdown
2.6. Western Blotting
2.7. Statistical Analysis
3. Results
3.1. Study Design
3.2. Exendin-4 Reduces OA-Induced Lipid Accumulation in HepG2 Cells
3.3. Oleic Acid Treatment Upregulates MALAT1 in HepG2 Cells
3.4. MALAT1 Knockdown Reverses OA-Induced Lipid Accumulation
3.5. Exendin-4 Inhibits the Effect of OA on De Novo Lipogenesis Gene Expression in HepG2 Cells When MALAT1 Is Silenced
3.6. Effect of MALAT1 Silencing on the Expression of Lipogenesis, Fatty Acid Uptake, and Transport Genes in HepG2 Cells in the Presence of Ex-4
3.7. Modulation of Lipogenesis and Fatty Acid Protein by MALAT1 Silencing in HepG2 Cells Treated with Ex-4
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Murag, S.; Ahmed, A.; Kim, D. Recent Epidemiology of Nonalcoholic Fatty Liver Disease. Gut Liver 2021, 15, 206–216. [Google Scholar] [CrossRef] [PubMed]
- Younossi, Z.M.; Marchesini, G.; Pinto-Cortez, H.; Petta, S. Epidemiology of Nonalcoholic Fatty Liver Disease and Nonalcoholic Steatohepatitis: Implications for Liver Transplantation. Transplantation 2019, 103, 22–27. [Google Scholar] [CrossRef] [PubMed]
- Danilova, O.V.; Tai, A.K.; Mele, D.A.; Beinborn, M.; Leiter, A.B.; Greenberg, A.S.; Perfield, J.W., 2nd; Defuria, J.; Singru, P.S.; Lechan, R.M.; et al. Neurogenin 3-specific dipeptidyl peptidase-2 deficiency causes impaired glucose tolerance, insulin resistance, and visceral obesity. Endocrinology 2009, 150, 5240–5248. [Google Scholar] [CrossRef] [PubMed]
- van den Hoek, A.M.; de Jong, J.; Worms, N.; van Nieuwkoop, A.; Voskuilen, M.; Menke, A.L.; Lek, S.; Caspers, M.P.M.; Verschuren, L.; Kleemann, R. Diet and exercise reduce pre-existing NASH and fibrosis and have additional beneficial effects on the vasculature, adipose tissue and skeletal muscle via organ-crosstalk. Metabolism 2021, 124, 154873. [Google Scholar] [CrossRef]
- Katsagoni, C.N.; Papachristou, E.; Sidossis, A.; Sidossis, L. Effects of Dietary and Lifestyle Interventions on Liver, Clinical and Metabolic Parameters in Children and Adolescents with Non-Alcoholic Fatty Liver Disease: A Systematic Review. Nutrients 2020, 12, 2864. [Google Scholar] [CrossRef]
- Yaskolka Meir, A.; Rinott, E.; Tsaban, G.; Zelicha, H.; Kaplan, A.; Rosen, P.; Shelef, I.; Youngster, I.; Shalev, A.; Blüher, M.; et al. Effect of green-Mediterranean diet on intrahepatic fat: The DIRECT PLUS randomised controlled trial. Gut 2021, 70, 2085–2095. [Google Scholar] [CrossRef]
- Friesen, C.S.; Hosey-Cojocari, C.; Chan, S.S.; Csanaky, I.L.; Wagner, J.B.; Sweeney, B.R.; Friesen, A.; Fraser, J.D.; Shakhnovich, V. Efficacy of Weight Reduction on Pediatric Nonalcoholic Fatty Liver Disease: Opportunities to Improve Treatment Outcomes Through Pharmacotherapy. Front. Endocrinol. 2021, 12, 663351. [Google Scholar] [CrossRef]
- Roberts-Thomson, P.J.; Kennedy, A.; Koh, L.Y. Large quantities of low molecular weight IgM in mixed cryoglobulinaemia. Ann. Rheum. Dis. 1988, 47, 105–109. [Google Scholar] [CrossRef]
- Deng, M.; Wen, Y.; Yan, J.; Fan, Y.; Wang, Z.; Zhang, R.; Ren, L.; Ba, Y.; Wang, H.; Lu, Q.; et al. Comparative effectiveness of multiple different treatment regimens for nonalcoholic fatty liver disease with type 2 diabetes mellitus: A systematic review and Bayesian network meta-analysis of randomised controlled trials. BMC Med. 2023, 21, 447. [Google Scholar] [CrossRef]
- Dougherty, J.A.; Guirguis, E.; Thornby, K.A. A Systematic Review of Newer Antidiabetic Agents in the Treatment of Nonalcoholic Fatty Liver Disease. Ann. Pharmacother. 2021, 55, 65–79. [Google Scholar] [CrossRef] [PubMed]
- Lee, H.A.; Kim, H.Y. Therapeutic Mechanisms and Clinical Effects of Glucagon-like Peptide 1 Receptor Agonists in Nonalcoholic Fatty Liver Disease. Int. J. Mol. Sci. 2023, 24, 9324. [Google Scholar] [CrossRef]
- Wong, C.; Lee, M.H.; Yaow, C.Y.L.; Chin, Y.H.; Goh, X.L.; Ng, C.H.; Lim, A.Y.L.; Muthiah, M.D.; Khoo, C.M. Glucagon-Like Peptide-1 Receptor Agonists for Non-Alcoholic Fatty Liver Disease in Type 2 Diabetes: A Meta-Analysis. Front. Endocrinol. 2021, 12, 609110. [Google Scholar] [CrossRef] [PubMed]
- Patel Chavez, C.; Cusi, K.; Kadiyala, S. The Emerging Role of Glucagon-like Peptide-1 Receptor Agonists for the Management of NAFLD. J. Clin. Endocrinol. Metab. 2022, 107, 29–38. [Google Scholar] [CrossRef] [PubMed]
- Ding, X.; Saxena, N.K.; Lin, S.; Gupta, N.A.; Anania, F.A. Exendin-4, a glucagon-like protein-1 (GLP-1) receptor agonist, reverses hepatic steatosis in ob/ob mice. Hepatology 2006, 43, 173–181. [Google Scholar] [CrossRef]
- Li, R.; Ye, Z.; She, D.; Fang, P.; Zong, G.; Hu, K.; Kong, D.; Xu, W.; Li, L.; Zhou, Y.; et al. Semaglutide May Alleviate Hepatic Steatosis in T2DM Combined with NFALD Mice via miR-5120/ABHD6. Drug Des. Dev. Ther. 2022, 16, 3557–3572. [Google Scholar] [CrossRef]
- Wang, X.C.; Gusdon, A.M.; Liu, H.; Qu, S. Effects of glucagon-like peptide-1 receptor agonists on non-alcoholic fatty liver disease and inflammation. World J. Gastroenterol. 2014, 20, 14821–14830. [Google Scholar] [CrossRef] [PubMed]
- Petrovic, A.; Igrec, D.; Rozac, K.; Bojanic, K.; Kuna, L.; Kolaric, T.O.; Mihaljevic, V.; Sikora, R.; Smolic, R.; Glasnovic, M.; et al. The Role of GLP1-RAs in Direct Modulation of Lipid Metabolism in Hepatic Tissue as Determined Using In Vitro Models of NAFLD. Curr. Issues Mol. Biol. 2023, 45, 4544–4556. [Google Scholar] [CrossRef] [PubMed]
- Sofogianni, A.; Filippidis, A.; Chrysavgis, L.; Tziomalos, K.; Cholongitas, E. Glucagon-like peptide-1 receptor agonists in non-alcoholic fatty liver disease: An update. World J. Hepatol. 2020, 12, 493–505. [Google Scholar] [CrossRef]
- Nauck, M.A.; Quast, D.R.; Wefers, J.; Meier, J.J. GLP-1 receptor agonists in the treatment of type 2 diabetes—State-of-the-art. Mol. Metab. 2021, 46, 101102. [Google Scholar] [CrossRef] [PubMed]
- Nevola, R.; Epifani, R.; Imbriani, S.; Tortorella, G.; Aprea, C.; Galiero, R.; Rinaldi, L.; Marfella, R.; Sasso, F.C. GLP-1 Receptor Agonists in Non-Alcoholic Fatty Liver Disease: Current Evidence and Future Perspectives. Int. J. Mol. Sci. 2023, 24, 1703. [Google Scholar] [CrossRef]
- Khalifa, O.; Al-Akl, N.S.; Errafii, K.; Arredouani, A. Exendin-4 alleviates steatosis in an in vitro cell model by lowering FABP1 and FOXA1 expression via the Wnt/-catenin signaling pathway. Sci. Rep. 2022, 12, 2226. [Google Scholar] [CrossRef] [PubMed]
- Seo, M.H.; Lee, J.; Hong, S.W.; Rhee, E.J.; Park, S.E.; Park, C.Y.; Oh, K.W.; Park, S.W.; Lee, W.Y. Exendin-4 Inhibits Hepatic Lipogenesis by Increasing β-Catenin Signaling. PLoS ONE 2016, 11, e0166913. [Google Scholar] [CrossRef]
- Gao, Z.; Song, G.Y.; Ren, L.P.; Ma, H.J.; Ma, B.Q.; Chen, S.C. β-catenin mediates the effect of GLP-1 receptor agonist on ameliorating hepatic steatosis induced by high fructose diet. Eur. J. Histochem. 2020, 64, 3160. [Google Scholar] [CrossRef]
- Xu, F.; Li, Z.; Zheng, X.; Liu, H.; Liang, H.; Xu, H.; Chen, Z.; Zeng, K.; Weng, J. SIRT1 mediates the effect of GLP-1 receptor agonist exenatide on ameliorating hepatic steatosis. Diabetes 2014, 63, 3637–3646. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.; Hong, S.W.; Chae, S.W.; Kim, D.H.; Choi, J.H.; Bae, J.C.; Park, S.E.; Rhee, E.J.; Park, C.Y.; Oh, K.W.; et al. Exendin-4 improves steatohepatitis by increasing Sirt1 expression in high-fat diet-induced obese C57BL/6J mice. PLoS ONE 2012, 7, e31394. [Google Scholar] [CrossRef]
- Yu, H.H.; Wang, H.C.; Hsieh, M.C.; Lee, M.C.; Su, B.C.; Shan, Y.S. Exendin-4 Attenuates Hepatic Steatosis by Promoting the Autophagy-Lysosomal Pathway. Biomed. Res. Int. 2022, 2022, 4246086. [Google Scholar] [CrossRef]
- Khalifa, O.; Ouararhni, K.; Errafii, K.; Alajez, N.M.; Arredouani, A. Targeted MicroRNA Profiling Reveals That Exendin-4 Modulates the Expression of Several MicroRNAs to Reduce Steatosis in HepG2 Cells. Int. J. Mol. Sci. 2023, 24, 11606. [Google Scholar] [CrossRef]
- Errafii, K.; Al-Akl, N.S.; Khalifa, O.; Arredouani, A. Comprehensive analysis of LncRNAs expression profiles in an in vitro model of steatosis treated with Exendin-4. J. Transl. Med. 2021, 19, 235. [Google Scholar] [CrossRef]
- Kim, J.; Piao, H.L.; Kim, B.J.; Yao, F.; Han, Z.; Wang, Y.; Xiao, Z.; Siverly, A.N.; Lawhon, S.E.; Ton, B.N.; et al. Long noncoding RNA MALAT1 suppresses breast cancer metastasis. Nat. Genet. 2018, 50, 1705–1715. [Google Scholar] [CrossRef] [PubMed]
- Huang, K.; Yu, X.; Yu, Y.; Zhang, L.; Cen, Y.; Chu, J. Long noncoding RNA MALAT1 promotes high glucose-induced inflammation and apoptosis of vascular endothelial cells by regulating miR-361-3p/SOCS3 axis. Int. J. Clin. Exp. Pathol. 2020, 13, 1243–1252. [Google Scholar] [PubMed]
- Ye, J.; Lin, Y.; Yu, Y.; Sun, D. LncRNA NEAT1/microRNA-129-5p/SOCS2 axis regulates liver fibrosis in alcoholic steatohepatitis. J. Transl. Med. 2020, 18, 445. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Zhang, Y.; Guan, X.; Li, X.; Zhao, Z.; Gao, Y.; Zhang, X.; Chen, R. An Integrated Transcriptomics and Proteomics Analysis Implicates lncRNA MALAT1 in the Regulation of Lipid Metabolism. Mol. Cell. Proteom. 2021, 20, 100141. [Google Scholar] [CrossRef]
- Xiang, J.; Deng, Y.Y.; Liu, H.X.; Pu, Y. LncRNA MALAT1 Promotes PPARα/CD36-Mediated Hepatic Lipogenesis in Nonalcoholic Fatty Liver Disease by Modulating miR-206/ARNT Axis. Front. Bioeng. Biotechnol. 2022, 10, 858558. [Google Scholar] [CrossRef] [PubMed]
- Aihemaiti, G.; Song, N.; Luo, J.; Liu, F.; Toyizibai, J.; Adili, N.; Liu, C.; Ji, W.; Yang, Y.N.; Li, X. Targeting lncRNA MALAT1: A Promising Approach to Overcome Metabolic Syndrome. Int. J. Endocrinol. 2024, 2024, 1821252. [Google Scholar] [CrossRef]
- Yan, C.; Chen, J.; Chen, N. Long noncoding RNA MALAT1 promotes hepatic steatosis and insulin resistance by increasing nuclear SREBP-1c protein stability. Sci. Rep. 2016, 6, 22640. [Google Scholar] [CrossRef] [PubMed]
- Hanson, A.; Wilhelmsen, D.; DiStefano, J.K. The Role of Long Non-Coding RNAs (lncRNAs) in the Development and Progression of Fibrosis Associated with Nonalcoholic Fatty Liver Disease (NAFLD). Noncoding RNA 2018, 4, 18. [Google Scholar] [CrossRef] [PubMed]
- Alkhatatbeh, M.J.; Lincz, L.F.; Thorne, R.F. Low simvastatin concentrations reduce oleic acid-induced steatosis in HepG(2) cells: An in vitro model of non-alcoholic fatty liver disease. Exp. Ther. Med. 2016, 11, 1487–1492. [Google Scholar] [CrossRef] [PubMed]
- Khalifa, O.; H. Mroue, K.; Mall, R.; Ullah, E.; S. Al-Akl, N.; Arredouani, A. Investigation of the Effect of Exendin-4 on Oleic Acid-Induced Steatosis in HepG2 Cells Using Fourier Transform Infrared Spectroscopy. Biomedicines 2022, 10, 2652. [Google Scholar] [CrossRef]
- Sztalryd, C.; Brasaemle, D.L. The perilipin family of lipid droplet proteins: Gatekeepers of intracellular lipolysis. Biochim. Biophys. Acta Mol. Cell. Biol. Lipids 2017, 1862, 1221–1232. [Google Scholar] [CrossRef] [PubMed]
- Pouwels, S.; Sakran, N.; Graham, Y.; Leal, A.; Pintar, T.; Yang, W.; Kassir, R.; Singhal, R.; Mahawar, K.; Ramnarain, D. Non-alcoholic fatty liver disease (NAFLD): A review of pathophysiology, clinical management and effects of weight loss. BMC Endocr. Disord. 2022, 22, 63. [Google Scholar] [CrossRef]
- van Solingen, C.; Scacalossi, K.R.; Moore, K.J. Long noncoding RNAs in lipid metabolism. Curr. Opin. Lipidol. 2018, 29, 224–232. [Google Scholar] [CrossRef]
- Heo, M.J.; Yun, J.; Kim, S.G. Role of non-coding RNAs in liver disease progression to hepatocellular carcinoma. Arch. Pharm. Res. 2019, 42, 48–62. [Google Scholar] [CrossRef]
- Qian, G.; Morral, N. Role of non-coding RNAs on liver metabolism and NAFLD pathogenesis. Hum. Mol. Genet. 2022, 31, R4–R21. [Google Scholar] [CrossRef] [PubMed]
- Rohilla, S.; Kaur, S.; Puria, R. Long non-coding RNA in Non-alcoholic fatty liver disease. Adv Clin. Chem. 2022, 110, 1–35. [Google Scholar] [CrossRef] [PubMed]
- Khalifa, O.; Errafii, K.; Al-Akl, N.S.; Arredouani, A. Noncoding RNAs in Nonalcoholic Fatty Liver Disease: Potential Diagnosis and Prognosis Biomarkers. Dis. Markers 2020, 2020, 8822859. [Google Scholar] [CrossRef] [PubMed]
- Sookoian, S.; Flichman, D.; Garaycoechea, M.E.; San Martino, J.; Castaño, G.O.; Pirola, C.J. Metastasis-associated lung adenocarcinoma transcript 1 as a common molecular driver in the pathogenesis of nonalcoholic steatohepatitis and chronic immune-mediated liver damage. Hepatol. Commun. 2018, 2, 654–665. [Google Scholar] [CrossRef]
- Li, J.Z.; Ye, L.H.; Wang, D.H.; Zhang, H.C.; Li, T.Y.; Liu, Z.Q.; Dai, E.H.; Li, M.R. The identify role and molecular mechanism of the MALAT1/hsa-mir-20b-5p/TXNIP axis in liver inflammation caused by CHB in patients with chronic HBV infection complicated with NAFLD. Virus Res. 2021, 298, 198405. [Google Scholar] [CrossRef] [PubMed]
- Leti, F.; Legendre, C.; Still, C.D.; Chu, X.; Petrick, A.; Gerhard, G.S.; DiStefano, J.K. Altered expression of MALAT1 lncRNA in nonalcoholic steatohepatitis fibrosis regulates CXCL5 in hepatic stellate cells. Transl. Res. 2017, 190, 25–39.e21. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Wang, X.; Zhang, T.; Su, L.; Liu, B.; Zhu, Z.; Li, C. LncRNA MALAT1 promotes gastric cancer progression via inhibiting autophagic flux and inducing fibroblast activation. Cell Death Dis. 2021, 12, 368. [Google Scholar] [CrossRef] [PubMed]
- Ipsen, D.H.; Lykkesfeldt, J.; Tveden-Nyborg, P. Molecular mechanisms of hepatic lipid accumulation in non-alcoholic fatty liver disease. Cell. Mol. Life Sci. 2018, 75, 3313–3327. [Google Scholar] [CrossRef] [PubMed]
- Villanueva, C.J.; Monetti, M.; Shih, M.; Zhou, P.; Watkins, S.M.; Bhanot, S.; Farese, R.V., Jr. Specific role for acyl CoA:Diacylglycerol acyltransferase 1 (Dgat1) in hepatic steatosis due to exogenous fatty acids. Hepatology 2009, 50, 434–442. [Google Scholar] [CrossRef]
- Schulman, I.G. Liver X receptors link lipid metabolism and inflammation. FEBS Lett. 2017, 591, 2978–2991. [Google Scholar] [CrossRef] [PubMed]
- Wilson, C.G.; Tran, J.L.; Erion, D.M.; Vera, N.B.; Febbraio, M.; Weiss, E.J. Hepatocyte-Specific Disruption of CD36 Attenuates Fatty Liver and Improves Insulin Sensitivity in HFD-Fed Mice. Endocrinology 2016, 157, 570–585. [Google Scholar] [CrossRef]
- Glatz, J.F.C.; Luiken, J. Dynamic role of the transmembrane glycoprotein CD36 (SR-B2) in cellular fatty acid uptake and utilization. J. Lipid Res. 2018, 59, 1084–1093. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Zhang, J.; Cui, W.; Silverstein, R.L. CD36, a signaling receptor and fatty acid transporter that regulates immune cell metabolism and fate. J. Exp. Med. 2022, 219, e20211314. [Google Scholar] [CrossRef]
- Garbacz, W.G.; Lu, P.; Miller, T.M.; Poloyac, S.M.; Eyre, N.S.; Mayrhofer, G.; Xu, M.; Ren, S.; Xie, W. Hepatic Overexpression of CD36 Improves Glycogen Homeostasis and Attenuates High-Fat Diet-Induced Hepatic Steatosis and Insulin Resistance. Mol. Cell. Biol. 2016, 36, 2715–2727. [Google Scholar] [CrossRef]
- Wu, H.; Zhang, T.; Pan, F.; Steer, C.J.; Li, Z.; Chen, X.; Song, G. MicroRNA-206 prevents hepatosteatosis and hyperglycemia by facilitating insulin signaling and impairing lipogenesis. J. Hepatol. 2017, 66, 816–824. [Google Scholar] [CrossRef] [PubMed]
- Todisco, S.; Santarsiero, A.; Convertini, P.; De Stefano, G.; Gilio, M.; Iacobazzi, V.; Infantino, V. PPAR Alpha as a Metabolic Modulator of the Liver: Role in the Pathogenesis of Nonalcoholic Steatohepatitis (NASH). Biology 2022, 11, 792. [Google Scholar] [CrossRef] [PubMed]
- Febbraio, M.; Hajjar, D.P.; Silverstein, R.L. CD36: A class B scavenger receptor involved in angiogenesis, atherosclerosis, inflammation, and lipid metabolism. J. Clin. Investig. 2001, 108, 785–791. [Google Scholar] [CrossRef] [PubMed]
- Dilworth, L.; Facey, A.; Omoruyi, F. Diabetes Mellitus and Its Metabolic Complications: The Role of Adipose Tissues. Int. J. Mol. Sci. 2021, 22, 7644. [Google Scholar] [CrossRef]
- Maréchal, L.; Laviolette, M.; Rodrigue-Way, A.; Sow, B.; Brochu, M.; Caron, V.; Tremblay, A. The CD36-PPARγ Pathway in Metabolic Disorders. Int. J. Mol. Sci. 2018, 19, 1529. [Google Scholar] [CrossRef] [PubMed]
- Zeng, H.; Qin, H.; Liao, M.; Zheng, E.; Luo, X.; Xiao, A.; Li, Y.; Chen, L.; Wei, L.; Zhao, L.; et al. CD36 promotes de novo lipogenesis in hepatocytes through INSIG2-dependent SREBP1 processing. Mol. Metab. 2022, 57, 101428. [Google Scholar] [CrossRef] [PubMed]
- Zeng, S.; Wu, F.; Chen, M.; Li, Y.; You, M.; Zhang, Y.; Yang, P.; Wei, L.; Ruan, X.Z.; Zhao, L.; et al. Inhibition of Fatty Acid Translocase (FAT/CD36) Palmitoylation Enhances Hepatic Fatty Acid β-Oxidation by Increasing Its Localization to Mitochondria and Interaction with Long-Chain Acyl-CoA Synthetase 1. Antioxid. Redox Signal. 2022, 36, 1081–1100. [Google Scholar] [CrossRef] [PubMed]
- Huangfu, N.; Xu, Z.; Zheng, W.; Wang, Y.; Cheng, J.; Chen, X. LncRNA MALAT1 regulates oxLDL-induced CD36 expression via activating β-catenin. Biochem. Biophys. Res. Commun. 2018, 495, 2111–2117. [Google Scholar] [CrossRef] [PubMed]
- Dai, L.L.; Li, S.D.; Ma, Y.C.; Tang, J.R.; Lv, J.Y.; Zhang, Y.Q.; Miao, Y.L.; Ma, Y.Q.; Li, C.M.; Chu, Y.Y.; et al. MicroRNA-30b regulates insulin sensitivity by targeting SERCA2b in non-alcoholic fatty liver disease. Liver Int. 2019, 39, 1504–1513. [Google Scholar] [CrossRef]
- Wang, Y.; Du, J.; Niu, X.; Fu, N.; Wang, R.; Zhang, Y.; Zhao, S.; Sun, D.; Nan, Y. MiR-130a-3p attenuates activation and induces apoptosis of hepatic stellate cells in nonalcoholic fibrosing steatohepatitis by directly targeting TGFBR1 and TGFBR2. Cell Death Dis. 2017, 8, e2792. [Google Scholar] [CrossRef]
- Zhong, D.; Huang, G.; Zhang, Y.; Zeng, Y.; Xu, Z.; Zhao, Y.; He, X.; He, F. MicroRNA-1 and microRNA-206 suppress LXRα-induced lipogenesis in hepatocytes. Cell. Signal. 2013, 25, 1429–1437. [Google Scholar] [CrossRef] [PubMed]
Gene | GenBank IDs | Forward Sequence (5′3′) | Reverse Sequence (5′3′) | PCR Product Sizes (pb) |
---|---|---|---|---|
SREBP-1 | 6720 | GGCTCCTGCCTACAGCTTCT | CAGCCAGTGGATCACCACA | 109 |
PPARγ | 5468 | GACCTCAGACAGATTGTCAC | AGTCCTTGTAGATCTCCTGC | 106 |
DGAT1 | 8694 | AACTGGTGTGTGGTGATGCT | CCTTCAGGAACAGAGAAACC | 112 |
DGAT2 | 84649 | CTACAGGTCATCTCAGTGCT | GAAGTAGAGCACAGCGATGA | 120 |
FAS | 355 | TATGCTTCTTCGTGCAGCAGTT | GCTGCCACACGCTCCTCTAG | 94 |
ACADL | 33 | TTGGCAAAACAGTTGCTCAC | ACATGTATCCCCAACCTCCA | 123 |
CPT1A | 1374 | TCCAGTTGGCTTATCGTGGTG | CTAACGAGGGGTCGATCTTGG | 244 |
SCD-1 | 20249 | CACCACATTCTTCATTGATTGCA | ATGGCGGCCTTGGAGACT | 75 |
ACC | 104371 | CAGAAGTGACAGACTACAGG | ATCCATGGCTTCCAGGAGTA | 125 |
NR1H2 | 7376 | GCGCTTGATCCTCGTGTAG | GCGCTTGATCCTCGTGTAG | 639 |
MTTP | 4547 | CTACAGGTCATCTCAGTGCT | GAAGTAGAGCACAGCGATGA | 120 |
PLIN1 | 5346 | ACAGACCATTTCTCAGCTCCAT | TATCCAATGCTCCTTTTCCACT | 141 |
PLIN2 | 123 | GAACAGAGCTACTTCGTACG | CAGTTTCCATCAGGCTTAGG | 151 |
PLIN3 | 10226 | TGCTCCACTCACTTTACCGTC | TAGCGTCCAGTGTGTACTGAC | 199 |
MALAT1 | 378938 | GAATTGCGTCATTTAAAGCCTAGTT | GTTTCATCCTACCACTCCCAATTAAT | 185 |
β-actin | 60 | TCATGAAGATCCTCACCGAG | CATCTCTTGCTCGAAGTCCA | 116 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Khalifa, O.; Ayoub, S.; Arredouani, A. Exploring the Putative Involvement of MALAT1 in Mediating the Beneficial Effect of Exendin-4 on Oleic Acid-Induced Lipid Accumulation in HepG2 Cells. Biomedicines 2025, 13, 370. https://doi.org/10.3390/biomedicines13020370
Khalifa O, Ayoub S, Arredouani A. Exploring the Putative Involvement of MALAT1 in Mediating the Beneficial Effect of Exendin-4 on Oleic Acid-Induced Lipid Accumulation in HepG2 Cells. Biomedicines. 2025; 13(2):370. https://doi.org/10.3390/biomedicines13020370
Chicago/Turabian StyleKhalifa, Olfa, Sama Ayoub, and Abdelilah Arredouani. 2025. "Exploring the Putative Involvement of MALAT1 in Mediating the Beneficial Effect of Exendin-4 on Oleic Acid-Induced Lipid Accumulation in HepG2 Cells" Biomedicines 13, no. 2: 370. https://doi.org/10.3390/biomedicines13020370
APA StyleKhalifa, O., Ayoub, S., & Arredouani, A. (2025). Exploring the Putative Involvement of MALAT1 in Mediating the Beneficial Effect of Exendin-4 on Oleic Acid-Induced Lipid Accumulation in HepG2 Cells. Biomedicines, 13(2), 370. https://doi.org/10.3390/biomedicines13020370