High Co-Infection Rate of Trichomonas vaginalis and Candidatus Mycoplasma Girerdii in Gansu Province, China
Abstract
:1. Introduction
2. Materials and Methods
2.1. Collection of Clinical Specimens
2.2. Extraction of Genomic DNA
2.3. Polymerase Chain Reaction (PCR) Amplification
2.4. Parasites and Culture Conditions
2.5. Confocal Microscopy
2.6. Data Analysis and Statistics
3. Results
3.1. Epidemiological Characteristics of Trichomonas Vaginalis
3.2. Co-Infection Rate of Tv and Various Mycoplasma
3.3. Tv Gene Analysis
3.4. Ca. M. Girerdii Gene Analyses
3.5. Mycoplasma Localized in Tv Cells
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Fichorova, R.; Fraga, J.; Rappelli, P.; Fiori, P.L. Trichomonas vaginalis infection in symbiosis with Trichomonasvirus and Mycoplasma. Res. Microbiol. 2017, 168, 882–891. [Google Scholar] [CrossRef] [PubMed]
- Rowley, J.; Hoorn, S.V.; Korenromp, E.; Low, N.; Unemo, M.; Abu-Raddad, L.J.; Chico, R.M.; Smolak, A.; Newman, L.; Gottlieb, S.; et al. Chlamydia, gonorrhoea, trichomoniasis and syphilis: Global prevalence and incidence estimates. Bull. World Health Organ. 2019, 97, 548–562P. [Google Scholar] [CrossRef] [PubMed]
- Ladefoged, A.S. Molecular dissection of Mycoplasma hominis. APMIS. Suppl. 2000, 97, 1–45. [Google Scholar] [CrossRef] [PubMed]
- Waites, K.B.; Katz, B.; Schelonka, R.L. Mycoplasmas and Ureaplasmas as Neonatal Pathogens. Clin. Microbiol. Rev. 2005, 18, 687–702. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rappelli, P.; Addis, M.F.; Carta, F.; Fiori, P.L. Mycoplasma hominis parasitism of Trichomonas vaginalis. Lancet 1998, 352, 1286. [Google Scholar] [CrossRef]
- Hampl, V.; Vaňáčová, Š.; Kulda, J.; Flegr, J. Concordance between genetic relatedness and phenotypic similarities of Trichomonas vaginalis strains. BMC Evol. Biol. 2001, 1, 11. [Google Scholar] [CrossRef] [PubMed]
- Xiao, J.C.; Xie, L.F.; Fang, S.L.; Gao, M.Y.; Zhu, Y.; Song, L.Y.; Zhong, H.M.; Lun, Z.R. Symbiosis of Mycoplasma hominis in Trichomonas vaginalis may link metronidazole resistance in vitro. Parasitol. Res. 2006, 100, 123–130. [Google Scholar] [CrossRef] [PubMed]
- Butler, S.E.; Augostini, P.; Secor, W.E. Mycoplasma hominis infection of Trichomonas vaginalis is not associated with metronidazole-resistant trichomoniasis in clinical isolates from the United States. Parasitol. Res. 2010, 107, 1023–1027. [Google Scholar] [CrossRef] [PubMed]
- Fiori, P.L.; Diaz, N.; Cocco, A.R.; Rappelli, P.; Dessi, D. Association of Trichomonas vaginalis with its symbiont Mycoplasma hominis synergistically upregulates the in vitro proinflammatory response of human monocytes. Sex. Transm. Infect. 2013, 89, 449–454. [Google Scholar] [CrossRef] [PubMed]
- Martin, D.H.; Zozaya, M.; Lillis, R.A.; Myers, L.; Nsuami, M.J.; Ferris, M.J. Unique Vaginal Microbiota That Includes an Unknown Mycoplasma-Like Organism Is Associated with Trichomonas vaginalis Infection. J. Infect. Dis. 2013, 207, 1922–1931. [Google Scholar] [CrossRef]
- Fettweis, J.M.; Serrano, M.G.; Huang, B.; Brooks, J.P.; Glascock, A.L.; Sheth, N.U.; Strauss, J.F.; Jefferson, K.K.; Buck, G.A. Vaginal Microbiome Consortium an Emerging Mycoplasma Associated with Trichomoniasis, Vaginal Infection and Disease. PLoS ONE 2014, 9, e110943. [Google Scholar] [CrossRef] [Green Version]
- Ioannidis, A.; Papaioannou, P.; Magiorkinis, E.; Magana, M.; Ioannidou, V.; Tzanetou, K.; Burriel, A.R.; Tsironi, M.; Chatzipanagiotou, S. Detecting the Diversity of Mycoplasma and Ureaplasma Endosymbionts Hosted by Trichomonas vaginalis Isolates. Front. Microbiol. 2017, 8, 1188. [Google Scholar] [CrossRef]
- Conrad, M.D.; Gorman, A.W.; Schillinger, J.A.; Fiori, P.L.; Arroyo, R.; Malla, N.; Dubey, M.L.; Gonzalez, J.; Blank, S.; Secor, W.E.; et al. Extensive Genetic Diversity, Unique Population Structure and Evidence of Genetic Exchange in the Sexually Transmitted Parasite Trichomonas vaginalis. PLoS Negl. Trop. Dis. 2012, 6, e1573. [Google Scholar] [CrossRef] [Green Version]
- Liu, J.; Feng, M.; Wang, X.; Fu, Y.; Ma, C.; Cheng, X. Unique Trichomonas vaginalis gene sequences identified in multinational regions of Northwest China. Biosci. Trends 2017, 11, 303–307. [Google Scholar] [CrossRef] [Green Version]
- Megarani, D.; Nugroho, H.A.; Andarini, Z.P.; Surbakti, Y.D.; Widayanti, R. Genetic characterization and phylogenetic study of Indonesian indigenous catfish based on mitochondrial cytochrome B gene. Vet. World 2020, 13, 96–103. [Google Scholar] [CrossRef] [Green Version]
- Madhivanan, P.; Bartman, M.T.; Pasutti, L.; Krupp, K.; Arun, A.; Reingold, A.L.; Klausner, J.D. Prevalence of Trichomonas vaginalis infection among young reproductive age women in India: Implications for treatment and prevention. Sex. Health 2009, 6, 339–344. [Google Scholar] [CrossRef] [Green Version]
- Patel, E.U.; Gaydos, A.C.; Packman, Z.R.; Quinn, T.C.; Tobian, A.A.R. Prevalence and Correlates of Trichomonas vaginalis Infection Among Men and Women in the United States. Clin. Infect. Dis. 2018, 67, 211–217. [Google Scholar] [CrossRef] [Green Version]
- Feng, R.-M.; Wang, M.Z.; Smith, J.S.; Dong, L.; Chen, F.; Pan, Q.-J.; Zhang, X.; Qiao, Y.-L.; Zhao, F.-H. Risk of high-risk human papillomavirus infection and cervical precancerous lesions with past or current trichomonas infection: A pooled analysis of 25,054 women in rural China. J. Clin. Virol. 2018, 99–100, 84–90. [Google Scholar] [CrossRef]
- Nikpay, S.; Otaghi, M.; Azami, M.; Karimi, M.; Abdi, J. Trichomonas Vaginalis Infection Among Women Attending Laboratory Centers in Ilam, Iran. Infect. Disord. Drug Targets 2020, 20, 98–101. [Google Scholar] [CrossRef]
- Buvé, A.; Weiss, H.A.; Laga, M.; Van Dyck, E.; Musonda, R.; Zekeng, L.; Kahindo, M.; Anagonou, S.; Morison, L.; Robinson, N.J.; et al. The epidemiology of trichomoniasis in women in four African cities. AIDS 2001, 15, S89–S96. [Google Scholar] [CrossRef]
- Field, N.; Clifton, S.; Alexander, S.; Ison, A.C.; Khanom, R.; Saunders, P.; Hughes, G.; Heath, L.; Beddows, S.; Mercer, C.; et al. Trichomonas vaginalis infection is uncommon in the British general population: Implications for clinical testing and public health screening. Sex. Transm. Infect. 2016, 94, 226–229. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ibáñez-Escribano, A.; Nogal-Ruiz, J.J.; Arán, V.J.; Escario, J.A.; Gómez-Barrio, A.; Alderete, J. Determination of internal transcribed spacer regions (ITS) in Trichomonas vaginalis isolates and differentiation among Trichomonas species. Parasitol. Int. 2014, 63, 427–431. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dessi, D.; Delogu, G.; Emonte, E.; Catania, M.R.; Fiori, P.L.; Rappelli, P. Long-Term Survival and Intracellular Replication of Mycoplasma hominis in Trichomonas vaginalis Cells: Potential Role of the Protozoon in Transmitting Bacterial Infection. Infect. Immun. 2005, 73, 1180–1186. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Costello, E.K.; Sun, C.L.; Carlisle, E.M.; Morowitz, M.J.; Banfield, J.F.; Relman, D.A. Candidatus Mycoplasma girerdii replicates, diversifies, and co-occurs with Trichomonas vaginalis in the oral cavity of a premature infant. Sci. Rep. 2017, 7, 1–11. [Google Scholar] [CrossRef]
- Dessi, D.; Margarita, V.; Cocco, A.R.; Marongiu, A.; Fiori, P.L.; Rappelli, P. Trichomonas vaginalis and Mycoplasma hominis: New tales of two old friends. Parasitology 2019, 146, 1150–1155. [Google Scholar] [CrossRef]
Gene or Locus | Sequence (5′–3′) | Product (bp) | AT (°C) |
---|---|---|---|
Tv18S | ATCAGAGGCACGCCATTC | 580 | 60 |
Tv18AS | CGCCCTTGATCGACAGAA | ||
Mh16S2S | GGCTAATGCCGGATACGC | 330 | 60 |
Mh16S2S | GGTACCGTCAGTCTGCAAT | ||
Mg16S-423F | TTTATTAGGGACGAACGGCACT | 313 | 55 |
Mg16S-736R | CAGTTGTGACCTAAGTTCTCGC | ||
Mg207F | TTTAGGATGAGGGTGCGGTTTA | 1201 | 55 |
Mg1408R | TAGCAGGACGGTTTTAGGTATT |
Age (years) | Total Patients (n = 312) | Patients with Tv Infection (n = 94) (30.1%) | p-Value | OR (95% CI) |
---|---|---|---|---|
17–30 | 105 | 44 (41.9%) | 0.011 | 3.275 (1.319–8.134) |
31–40 | 62 | 12 (19.4%) | 0.781 | 1.159 (0.410–3.274) |
41–50 | 106 | 31 (29.2%) | 0.128 | 2.054 (0.813–5.189) |
51–75 | 39 | 7 (17.9%) | 1 |
Total Samples (n = 312) | ||||
---|---|---|---|---|
Mycoplasma Positive | χ2 p-Value | |||
Mycoplasma positive rate | Tv positive (n = 94) | Tv negative (n = 218) | ||
Ca. M. girerdii | 48 (15.4%) * | 40 (83.3%) ** | 8 | <0.001 |
M. hominis | 153 (49%) * | 80 (52.3) ** | 73 | <0.001 |
Tv Isolates | Type of Mycoplasma Symbiosis | |
---|---|---|
M. hominis | Ca. M. Girerdii | |
ZYTv-166 | − | − |
ZYTv-57 | + | − |
ZYTv-92 | + | + |
ZYTv-125 | + | − |
ZYTv-129 | + | − |
ZYTv-168 | + | − |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, S.; Wang, Z.; Zhou, H.; Fu, Y.; Feng, M.; Cheng, X. High Co-Infection Rate of Trichomonas vaginalis and Candidatus Mycoplasma Girerdii in Gansu Province, China. Healthcare 2021, 9, 706. https://doi.org/10.3390/healthcare9060706
Xu S, Wang Z, Zhou H, Fu Y, Feng M, Cheng X. High Co-Infection Rate of Trichomonas vaginalis and Candidatus Mycoplasma Girerdii in Gansu Province, China. Healthcare. 2021; 9(6):706. https://doi.org/10.3390/healthcare9060706
Chicago/Turabian StyleXu, Shuhui, Zhixin Wang, Hang Zhou, Yongfeng Fu, Meng Feng, and Xunjia Cheng. 2021. "High Co-Infection Rate of Trichomonas vaginalis and Candidatus Mycoplasma Girerdii in Gansu Province, China" Healthcare 9, no. 6: 706. https://doi.org/10.3390/healthcare9060706