Genotypic Differences in the Effect of P Fertilization on Phytic Acid Content in Rice Grain
Abstract
:1. Introduction
2. Results
2.1. Differences in Yield-Related Traits
2.1.1. Effect of P Fertilization in Low and High PA Rice
2.1.2. Effect of the Amount of P Fertilizer on Initial Growth and Yield
2.2. Effects of the Time of P Fertilizer Application
2.3. Variation in the PA Content with Change in the P Concentration in the Soil
2.4. PA-P and Pi Content
2.5. INO1 Expression and PA Content at 10 DAF
2.6. Short-Term Response of Pi Uptake in WRC 5 and WRC 6
3. Discussion
3.1. Effect of P Fertilizer on the PA Content
3.2. Effect of P Fertilizer on PA Biosynthesis
3.3. Other Factors Regulating Grain PA Content
4. Materials and Methods
4.1. Plant Materials
4.2. Determination of the PA and Pi Content
4.3. Analysis of Gene Expression
4.4. Analysis of xylem sap
4.5. Data Analysis
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- IPCC. Climate Change 2013: The Physical Science Basis. Contribution of Working Group I to the Fifth Assessment Report of the Intergovernmental Panel on Climate Change; Cambridge University Press: Cambridge, UK, 2013. [Google Scholar]
- Myers, S.S.; Zanobetti, A.; Kloog, I.; Huybers, P.; Leakey, A.D.; Bloom, A.J.; Carlisle, E.; Dietterich, L.H.; Fitzgerald, G.; Hasegawa, T.; et al. Increasing CO2 threatens human nutrition. Nature 2014, 510, 139–142. [Google Scholar] [CrossRef] [PubMed]
- Roboy, V. Approaches and challenges to engineering seed phytate and total phosphorus. Plant Sci. 2009, 177, 281–296. [Google Scholar] [CrossRef]
- Lönnerdal, B.; Mendoza, C.; Brown, K.H.; Rutger, J.N.; Raboy, V. Zinc absorption from low phytic acid genotypes of Maize (Zea mays L.), Barley (Hordeum vulgare L.), and Rice (Oryza sativa L.) assessed in a suckling rat pup model. J. Agric. Food Chem. 2011, 59, 4755–4762. [Google Scholar] [CrossRef] [PubMed]
- Kies, A.K.; De Jonge, L.H.; Kemme, P.A.; Jongbloed, A.W. Interaction between protein, phytate, and microbial Phytase. In vitro studies. J. Agric. Food Chem. 2006, 54, 1753–1758. [Google Scholar] [CrossRef] [PubMed]
- Mlodzinska, E.; Zboinska, M. Phosphate uptake and allocation—A closer look at Arabidopsis thaliana L. and Oryza sativa L. Front. Plant Sci. 2016, 7, 1198. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, F.; Chang, X.J.; Ye, Y.; Xie, W.B.; Wu, P.; Lian, X.M. Comprehensive sequence and whole-life-cycle expression profile analysis of the phosphate transporter gene family in rice. Mol. Plant. 2011, 4, 1105–1122. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, Y.; Zhang, J.; Zhang, X.; Fan, H.; Gu, M.; Qu, H.; Xu, G. Phosphate transporter OsPht1; 8 in rice plays an important role in phosphorus redistribution from source to sink organs and allocation between embryo and endosperm of seeds. Plant Sci. 2014, 230, 23–32. [Google Scholar] [CrossRef]
- Yamaji, N.; Takemoto, Y.; Miyaji, T.; Mitani-Ueno, N.; Yoshida, K.T.; Ma, J.F. Reducing phosphorus accumulation in rice grains with an impaired transporter in the node. Nature 2017, 541, 92–95. [Google Scholar] [CrossRef]
- Guttieri, M.; Bowen, D.; Dorsch, J.A.; Raboy, V.; Souza, E. Identification and characterization of a low phytic acid wheat. Crop Sci. 2004, 44, 418–424. [Google Scholar] [CrossRef]
- Raboy, V.; Gerbasi, P.F.; Young, K.A.; Stoneberg, S.D.; Pickett, S.G.; Bauman, A.T.; Murthy, P.P.N.; Sheridan, W.F.; Ertl, D.S. Origin and seed phenotype of maize low phytic acid 1-1 and low phytic acid 2-1. Plant Physiol. 2000, 124, 355–368. [Google Scholar] [CrossRef] [Green Version]
- Shi, J.; Wang, H.; Hazebroek, J.; Ertl, D.S.; Harp, T. The maize low-phytic acid 3 encodes a myo-inositol kinase that plays a role in phytic acid biosynthesis in developing seeds. Plant J. 2005, 42, 708–719. [Google Scholar] [CrossRef] [PubMed]
- Pilu, R.; Panzeri, D.; Gavazzi, G.; Rasmussen, S.K.; Consonni, G.; Nielsen, E. Phenotypic, genetic and molecular characterization of a maize low phytic acid mutant (lpa241). Theor. Appl. Genet. 2003, 107, 980–987. [Google Scholar] [CrossRef] [PubMed]
- Wilcox, J.R.; Premachandra, G.S.; Young, K.A.; Raboy, V. Isolation of high seed inorganic P, low-phytate soybean mutants. Crop Sci. 2000, 40, 1601–1605. [Google Scholar] [CrossRef] [Green Version]
- Frank, T.; Habernegg, R.; Yuan, F.J.; Shu, Q.Y.; Engel, K.H. Assessment of the contents of phytic acid and divalent cations in low phytic acid (lpa) mutants of rice and soybean. J. Food Compos. Anal. 2009, 22, 278–284. [Google Scholar] [CrossRef]
- Dorsch, J.A.; Cook, A.; Young, K.A.; Anderson, J.M.; Bauman, A.T.; Volkman, C.J.; Murthy, P.P.; Raboy, V. Seed phosphorus and inositol phosphate phenotype of barley low phytic acid genotypes. Phytochemistry 2003, 62, 691–706. [Google Scholar] [CrossRef]
- Moreau, R.A.; Bregitzer, P.; Liu, K.; Hicks, K.B. Compositional equivalence of barleys differing only in low- and normal-phytate levels. J. Agric. Food Chem. 2012, 60, 6493–6498. [Google Scholar] [CrossRef]
- Ye, H.; Zhang, X.Q.; Broughton, S.; Westcott, S.; Wu, D.; Lance, R.; Li, C. A nonsense mutation in a putative sulphate transporter gene results in low phytic acid in barley. Funct. Integr. Genom. 2011, 11, 103–110. [Google Scholar] [CrossRef]
- Frank, T.; Meuleye, B.S.; Miller, A.; Shu, Q.Y.; Engel, K.H. Metabolite profiling of two low phytic acid (lpa) rice mutants. J. Agric. Food Chem. 2007, 55, 11011–11019. [Google Scholar] [CrossRef]
- Zhao, H.J.; Liu, Q.L.; Fu, H.W.; Xu, X.H.; Wu, D.X.; Shu, Q.Y. Effect of non-lethal low phytic acid mutations on grain yield and seed viability in rice. Field Crops Res. 2008, 108, 206–211. [Google Scholar] [CrossRef]
- Kuwano, M.; Mimura, T.; Takaiwa, F.; Yoshida, K.T. Generation of stable ‘low phytic acid’ transgenic rice thorough antisense repression of the 1D-myo-inositol 3-phosphate synthase gene (RINO1) using the 18-kDa oleosin promoter. Plant Biotechnol. J. 2009, 7, 96–105. [Google Scholar] [CrossRef]
- Raboy, V.; Peterson, K.; Jackson, C.; Marshall, J.M.; Hu, G.; Saneoka, H.; Bregitzer, P. A substantial fraction of barley (Hordeum vulgare L.) low phytic acid mutations have little or no effect on yield across diverse production environments. Plants 2015, 4, 225–239. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yuan, F.J.; Zhao, H.J.; Ren, X.L.; Zhu, S.L.; Fu, X.J.; Shu, Q.Y. Generation and characterization of two novel low phytate mutations in soybean (Glycine max L. Merr.). Theor. Appl. Genet. 2007, 115, 945–957. [Google Scholar] [CrossRef] [PubMed]
- Srilatha, M.; Sharma, S.H.K. Influence of long term use of fertilizers and manures on available nutrient status and inorganic “Phosphorus” fractions in soil under continuous rice—Rice cropping system. IJAR 2015, 3, 960–964. [Google Scholar]
- Shen, J.; Yuan, L.; Zhang, J.; Li, H.; Bai, Z.; Chen, X.; Zhang, W.; Zhang, F. Phosphorus dynamics: From soil to plant. Plant Physiol. 2011, 156, 997–1005. [Google Scholar] [CrossRef] [Green Version]
- Buerkert, A.; Haake, C.; Ruckwied, M.; Marschner, H. Phosphorus application affects the nutritional quality of millet grain in the Sahel. Field Crops Res. 1998, 57, 223–235. [Google Scholar] [CrossRef]
- Coelho, C.M.M.; Santos, J.C.P.; Tsai, S.M.; Vitorello, V.A. Seed phytate content and phosphorus uptake and distribution in dry bean genotypes. Braz. J. Plant Physiol. 2002, 14, 51–58. [Google Scholar] [CrossRef]
- Saneoka, H.; Koba, T. Plant growth and phytic acid accumulation in grain as affected by phosphorus application in maize (Zea maize L.). Grassl. Sci. 2003, 48, 485–489. [Google Scholar]
- Su, D.; Zhou, L.; Zhao, Q.; Pan, G.; Cheng, F. Different phosphorus supplies altered the accumulations and quantitative distributions of phytic acid, zinc, and iron in rice (Oryza sativa L.) grains. J. Agric. Food Chem. 2018, 66, 1601–1611. [Google Scholar] [CrossRef]
- Taliman, N.A.; Dong, Q.; Echigo, K.; Raboy, V.; Saneoka, H. Effect of phosphorus fertilization on the growth, photosynthesis, nitrogen fixation, mineral accumulation, seed yield, and seed quality of a soybean low-phytate line. Plants 2019, 8, 119. [Google Scholar] [CrossRef] [Green Version]
- Perera, I.; Fukushima, A.; Arai, M.; Yamada, K.; Nagasaka, S.; Seneweera, S.; Hirotsu, N. Identification of low phytic acid and high Zn bioavailable rice (Oryza sativa L.) from 69 accessions of the world rice core collection. J. Cereal Sci. 2019, 85, 206–213. [Google Scholar] [CrossRef]
- Perera, I.; Fukushima, A.; Akabane, T.; Genki, H.; Seneweera, S.; Hirotsu, N. Expression regulation of myo-inositol 3-phosphate synthase 1 (INO1) in determination of phytic acid accumulation in rice grain. Sci. Rep. 2019, 9, 14866. [Google Scholar] [CrossRef] [PubMed]
- Delin, L.; Zhaomin, Z. Effect of available phosphorus in paddy soils on phosphorus uptake of rice. J. Radioanal. Nucl. Chem. 1996, 205, 235–243. [Google Scholar] [CrossRef]
- Iwai, T.; Takahashi, M.; Oda, K.; Terada, Y.; Yoshida, K.T. Dynamic changes in the distribution of minerals in relation to phytic acid accumulation during rice seed development. Plant Physiol. 2012, 160, 2007–2014. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Perera, I.; Seneweera, S.; Hirotsu, N. Manipulating the phytic acid content of rice grain toward improving micronutrient bioavailability. Rice 2018, 11, 4. [Google Scholar] [CrossRef] [Green Version]
- Alkarawi, H.H.; Zotz, G. Phytic acid in green leaves of herbaceous plants−temporal variation in situ and response to different nitrogen/phosphorus fertilizing regimes. AoB Plants 2014, 6. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Nagai, Y.; Matsumoto, K.; Kakinuma, Y.; Ujiie, K.; Ishimaru, K.; Gamage, D.M.; Thompson, M.; Milham, P.J.; Seneweera, S.; Hirotsu, N. The chromosome regions for increasing early growth in rice: Role of source biosynthesis and NH4+ uptake. Euphytica 2016, 211, 343–352. [Google Scholar] [CrossRef]
WRC No. | Panicle Number | Panicle Length (cm) | Panicle Weight (g) | 1000 Seed Weight (g) | Total Yield per Plant (g) |
---|---|---|---|---|---|
WRC 5 | 16.6 ± 1.1 | 24.7 ± 2.0 | 2.8 ± 0.5 | 20.2 ± 0.7 | 35.3 ± 4.3 |
WRC 6 | 15.2 ± 1.1 | 20.3 ± 0.7 | 2.5 ± 0.3 | 23.4 ± 0.6 | 36.8 ± 2.2 |
ns | *** | ns | *** | ns |
Cultivar | Treatment | Panicle Number | Total Yield per Plant (g) |
---|---|---|---|
WRC 5 | Control | 8.8 ± 0.5 ab | 19.9 ± 3.6 ab |
P1 | 6.3 ± 1.0 b | 13.3 ± 1.7 b | |
P4 | 10.0 ± 1.4 a | 20.5 ± 4.5 a | |
WRC 6 | Control | 9.0 ± 2.7 ab | 14.6 ± 2.6 ab |
P1 | 9.0 ± 0.8 ab | 16.1 ± 2.5 ab | |
P4 | 10.0 ± 1.4 a | 17.9 ± 3.4 ab |
Shoot | Root | |||
---|---|---|---|---|
Weight (g) | Length (mm) | Weight (g) | Length (mm) | |
WRC 5 | 0.76 ± 0.087 | 333 ± 39 | 0.52 ± 0.15 | 151 ± 23 |
WRC 6 | 0.73 ± 0.033 | 306 ± 24 | 0.62 ± 0.037 | 171 ± 17 |
ns | ns | ns | ns |
Gene | Forward (5′–3′) | Reverse (5′–3′) | Probe# |
---|---|---|---|
INO1 | CAGGGTCGGGAGCTACAA | AAGGTCATCAGGGTTCACCA | #52 |
ITPK1 | AAGGTGAAGAGCTTCCTCCAG | TTCAGAGAGAGGACGAGTCTCA | #72 |
MRP13 | GCACTAGCAAGCAAGACCGTA | TGATATGACCATCCTTAAGAACCA | #146 |
ITPK6 | GGCAAACCTCTTACATTCAACAGT | TTGCACCTCGTTTTGCAG | #68 |
MIK | CGATGAAGGAGTTTGTGTCACT | GAAGATCCTTGGCACTTAGCC | #120 |
IPK1 | GCTCTTCTAATTTCTGACCACACA | GCCTTTATCTCCACTGCTATGC | #38 |
2-PGK | TGAAGAAAGAGATATGCACGAGA | CAGATCGTCGTATTCCTCGTC | #22 |
ITPK2 | GTACGCCCTCACCAAGAAGA | CAATTGCTACAAGATTAATTCCCTTC | #41 |
GAPDH | GCTGCTGCTCACTTGAAGG | AAACATCGGAGCATCTTTGC | #142 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fukushima, A.; Perera, I.; Hosoya, K.; Akabane, T.; Hirotsu, N. Genotypic Differences in the Effect of P Fertilization on Phytic Acid Content in Rice Grain. Plants 2020, 9, 146. https://doi.org/10.3390/plants9020146
Fukushima A, Perera I, Hosoya K, Akabane T, Hirotsu N. Genotypic Differences in the Effect of P Fertilization on Phytic Acid Content in Rice Grain. Plants. 2020; 9(2):146. https://doi.org/10.3390/plants9020146
Chicago/Turabian StyleFukushima, Ayaka, Ishara Perera, Koki Hosoya, Tatsuki Akabane, and Naoki Hirotsu. 2020. "Genotypic Differences in the Effect of P Fertilization on Phytic Acid Content in Rice Grain" Plants 9, no. 2: 146. https://doi.org/10.3390/plants9020146