Melatonin Modulates Tomato Root Morphology by Regulating Key Genes and Endogenous Hormones
Abstract
1. Introduction
2. Results
2.1. Effects of Exogenous Melatonin Treatment on the Fresh Weight and Root Activity of Tomato Seedlings
2.2. Effects of Exogenous Melatonin Treatment on Root Architecture Parameters of Tomato Seedlings
2.3. Effects of Exogenous Melatonin Treatment on Root Hair Length and Density of Tomato Seedlings
2.4. Effects of Exogenous Melatonin Treatment on Root Meristem Cells of Tomato Seedlings
2.5. Effects of Exogenous Melatonin Treatment on Root Hormone Content of Tomato Seedlings
2.6. Effects of Exogenous Melatonin Treatment on the Expression of Root-Related Genes in Tomato Seedlings
3. Discussion
4. Materials and Methods
4.1. Plant Material and Growth Conditions
4.2. Experimental Design
4.3. Fresh Weight and Root Activity
4.4. Root Scanning
4.5. Tomato Seedling Root Hair Length and Density
4.6. The Size and Number of Meristematic Cells
4.7. Hormone Content
4.8. Quantitative Real-Time PCR
4.9. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kenrick, P.; Strullu-Derrien, C. The origin and early evolution of roots. Plant Physiol. 2014, 166, 570–580. [Google Scholar] [CrossRef]
- Ristova, D.; Busch, W. Natural variation of root traits: From development to nutrient uptake. Plant Physiol. 2014, 166, 518–527. [Google Scholar] [CrossRef]
- Petricka, J.J.; Winter, C.M.; Benfey, P.N. Control of Arabidopsis root development. Annu. Rev. Plant Biol. 2012, 63, 563–590. [Google Scholar] [CrossRef]
- Smith, S.; De Smet, I. Root system architecture: Insights from Arabidopsis and Cereal Crops. Philos. Trans. R. Soc. B Biol. Sci. 2012, 367, 1441–1452. [Google Scholar] [CrossRef]
- Scheres, B.; Wolkenfelt, H.; Willemsen, V.; Terlouw, M.; Lawson, E.; Dean, C.; Weisbeek, P. Embryonic origin of the Arabidopsis primary root and root meristem initials. Development 1994, 120, 2475–2487. [Google Scholar] [CrossRef]
- Bellini, C.; Pacurar, D.I.; Perrone, I. Adventitious roots and lateral roots: Similarities and differences. Annu. Rev. Plant Biol. 2014, 65, 639–666. [Google Scholar] [CrossRef]
- Verstraeten, I.; Schotte, S.; Geelen, D. Hypocotyl adventitious root organogenesis differs from lateral root development. Front. Plant Sci. 2014, 5, 495. [Google Scholar] [CrossRef]
- Coudert, P.P.; van Anh Le, T.; Gantet, P. Rice: A Model Plant to Decipher the Hidden Origin of Adventitious Roots; CRC Press: Boca Raton, FL, USA, 2013. [Google Scholar]
- Cao, X.; Chen, C.; Zhang, D.; Shu, B.; Xiao, J.; Xia, R. Influence of nutrient deficiency on root architecture and root hair morphology of trifoliate orange (Poncirus trifoliata L. Raf.) seedlings under sand culture. Sci. Hortic. 2013, 162, 100–105. [Google Scholar] [CrossRef]
- Vincent, C.; Rowland, D.; Na, C.; Schaffer, B. A high-throughput method to quantify root hair area in digital images taken in situ. Plant Soil 2017, 412, 61–80. [Google Scholar] [CrossRef]
- Dolan, L. Root hair development in grasses and cereals (Poaceae). Curr. Opin. Genet. Dev. 2017, 45, 76–81. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.-Y.; Wang, P.; Zhang, D.-J.; Zou, Y.-N.; Kuča, K.; Wu, Q.-S. Mycorrhiza-induced change in root hair growth is associated with IAA accumulation and expression of EXPs in trifoliate orange under two P levels. Sci. Hortic. 2018, 234, 227–235. [Google Scholar] [CrossRef]
- Ahn, S.J.; Shin, R.; Schachtman, D.P. Expression of KT/KUP Genes in Arabidopsis and the Role of Root Hairs in K+ Uptake. Plant Physiol. 2004, 134, 1135–1145. [Google Scholar] [CrossRef] [PubMed]
- Huang, L.; Shi, X.; Wang, W.; Ryu, K.H.; Schiefelbein, J. Diversification of Root Hair Development Genes in Vascular Plants. Plant Physiol. 2017, 174, 1697–1712. [Google Scholar] [CrossRef] [PubMed]
- Młodzińska, E.; Zboińska, M. Phosphate uptake and allocation—A closer look at Arabidopsis thaliana L. and Oryza sativa L. Front. Plant Sci. 2016, 7, 1198. [Google Scholar] [CrossRef] [PubMed]
- Wang, F.; Deng, M.; Xu, J.; Zhu, X.; Mao, C. Molecular mechanisms of phosphate transport and signdaling in higher plants. Semin. Cell Dev. Biol. 2018, 74, 114–122. [Google Scholar] [CrossRef] [PubMed]
- Yuan, L.; Loqué, D.; Kojima, S.; Rauch, S.; Ishiyama, K.; Inoue, E.; Takahashi, H.; von Wirén, N. The Organization of High-Affinity Ammonium Uptake in Arabidopsis Roots Depends on the Spatial Arrangement and Biochemical Properties of AMT1-Type Transporters. Plant Cell 2007, 19, 2636–2652. [Google Scholar] [CrossRef] [PubMed]
- Takahashi, H. Sulfate transport systems in plants: Functional diversity and molecular mechanisms underlying regulatory coordination. J. Exp. Bot. 2019, 70, 4075–4087. [Google Scholar] [CrossRef] [PubMed]
- Zhang, D.; Chunyan, L.; Yujie, Y.; Qiangsheng, W.; Yeyun, L. Plant root hair growth in response to hormones. Not. Bot. Horti Agrobot. 2019, 47, 278–281. [Google Scholar] [CrossRef]
- Reiter, R.J. Pineal melatonin: Cell biology of its synthesis and of its physiological interactions. Endocr. Rev. 1991, 12, 151–180. [Google Scholar] [CrossRef]
- Jan, J.E.; Reiter, R.J.; Wasdell, M.B.; Bax, M. The role of the thalamus in sleep, pineal melatonin production, and circadian rhythm sleep disorders. J. Pineal Res. 2009, 46, 1–7. [Google Scholar] [CrossRef]
- Pieri, C.; Marra, M.; Moroni, F.; Recchioni, R.; Marcheselli, F. Melatonin: A peroxyl radical scavenger more effective than vitamin E. Life Sci. 1994, 55, PL271–PL276. [Google Scholar] [CrossRef]
- Brainard, G.C.; Hanifin, J.P.; Greeson, J.M.; Byrne, B.; Glickman, G.; Gerner, E.; Rollag, M.D. Action spectrum for melatonin regulation in humans: Evidence for a novel circadian photoreceptor. J. Neurosci. 2001, 21, 6405–6412. [Google Scholar] [CrossRef] [PubMed]
- Dubbels, R.; Reiter, R.; Klenke, E.; Goebel, A.; Schnakenberg, E.; Ehlers, C.; Schiwara, H.; Schloot, W. Melatonin in edible plants identified by radioimmunoassay and by high performance liquid chromatography-mass spectrometry. J. Pineal Res. 1995, 18, 28–31. [Google Scholar] [CrossRef] [PubMed]
- Hattori, A.; Migitaka, H.; Iigo, M.; Itoh, M.; Yamamoto, K.; Ohtani-Kaneko, R.; Hara, M.; Suzuki, T.; Reiter, R.J. Identification of melatonin in plants and its effects on plasma melatonin levels and binding to melatonin receptors in vertebrates. Biochem. Mol. Biol. Int. 1995, 35, 627–634. [Google Scholar] [PubMed]
- Sun, C.; Liu, L.; Wang, L.; Li, B.; Jin, C.; Lin, X. Melatonin: A master regulator of plant development and stress responses. J. Integr. Plant Biol. 2021, 63, 126–145. [Google Scholar] [CrossRef]
- Back, K.; Tan, D.X.; Reiter, R.J. Melatonin biosynthesis in plants: Multiple pathways catalyze tryptophan to melatonin in the cytoplasm or chloroplasts. J. Pineal Res. 2016, 61, 426–437. [Google Scholar] [CrossRef]
- Murch, S.J.; Saxena, P.K. Melatonin: A potential regulator of plant growth and development? In Vitro Cell. Dev. Biol. Plant 2002, 38, 531–536. [Google Scholar] [CrossRef]
- Arnao, M.B.; Hernández-Ruiz, J. Melatonin promotes adventitious-and lateral root regeneration in etiolated hypocotyls of Lupinus albus L. J. Pineal Res. 2007, 42, 147–152. [Google Scholar] [CrossRef]
- Hernández-Ruiz, J.; Cano, A.; Arnao, M.B. Melatonin acts as a growth-stimulating compound in some monocot species. J. Pineal Res. 2005, 39, 137–142. [Google Scholar] [CrossRef]
- Arnao, M.; Hernández-Ruiz, J. Growth activity, rooting capacity, and tropism: Three auxinic precepts fulfilled by melatonin. Acta Physiol. Plant. 2017, 39, 127. [Google Scholar] [CrossRef]
- Posmyk, M.M.; Bałabusta, M.; Wieczorek, M.; Sliwinska, E.; Janas, K. Melatonin applied to cucumber (Cucumis sativus L.) seeds improves germination during chilling stress. J. Pineal Res. 2009, 46, 214–223. [Google Scholar] [CrossRef]
- Wei, W.; Li, Q.-T.; Chu, Y.-N.; Reiter, R.J.; Yu, X.-M.; Zhu, D.-H.; Zhang, W.-K.; Ma, B.; Lin, Q.; Zhang, J.-S. Melatonin enhances plant growth and abiotic stress tolerance in soybean plants. J. Exp. Bot. 2015, 66, 695–707. [Google Scholar] [CrossRef] [PubMed]
- Pelagio-Flores, R.; Muñoz-Parra, E.; Ortiz-Castro, R.; López-Bucio, J. Melatonin regulates Arabidopsis root system architecture likely acting independently of auxin signaling. J. Pineal Res. 2012, 53, 279–288. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Li, H.; Yang, K.; Wang, Y.; Yang, L.; Hu, L.; Liu, R.; Shi, Z. Melatonin facilitates lateral root development by coordinating PAO-derived hydrogen peroxide and Rboh-derived superoxide radical. Free Radic. Biol. Med. 2019, 143, 534–544. [Google Scholar] [CrossRef] [PubMed]
- Zhang, N.; Zhang, H.J.; Zhao, B.; Sun, Q.Q.; Cao, Y.Y.; Li, R.; Wu, X.X.; Weeda, S.; Li, L.; Ren, S. The RNA-seq approach to discriminate gene expression profiles in response to melatonin on cucumber lateral root formation. J. Pineal Res. 2014, 56, 39–50. [Google Scholar] [CrossRef]
- Wen, D.; Gong, B.; Sun, S.; Liu, S.; Wang, X.; Wei, M.; Yang, F.; Li, Y.; Shi, Q. Promoting roles of melatonin in adventitious root development of Solanum lycopersicum L. by regulating auxin and nitric oxide signaling. Front. Plant Sci. 2016, 7, 718. [Google Scholar] [CrossRef]
- Chen, Q.; Qi, W.-b.; Reiter, R.J.; Wei, W.; Wang, B.-m. Exogenously applied melatonin stimulates root growth and raises endogenous indoleacetic acid in roots of etiolated seedlings of Brassica juncea. J. Plant Physiol. 2009, 166, 324–328. [Google Scholar] [CrossRef]
- Altaf, M.A.; Shahid, R.; Ren, M.-X.; Naz, S.; Altaf, M.M.; Khan, L.U.; Lal, M.K.; Tiwari, R.K.; Shakoor, A. Melatonin mitigates cadmium toxicity by promoting root architecture and mineral homeostasis of tomato genotypes. J. Soil Sci. Plant Nutr. 2022, 22, 1112–1128. [Google Scholar] [CrossRef]
- Baldantoni, D.; Bellino, A.; Alfani, A. Soil compost amendment enhances tomato (Solanum lycopersicum L.) quality. J. Sci. Food Agric. 2016, 96, 4082–4088. [Google Scholar] [CrossRef]
- Karaca, P.; Cekic, F.Ö. Exogenous melatonin-stimulated defense responses in tomato plants treated with polyethylene glycol. Int. J. Veg. Sci. 2019, 25, 601–609. [Google Scholar] [CrossRef]
- Ibrahim, M.F.; Elbar, O.H.A.; Farag, R.; Hikal, M.; El-Kelish, A.; El-Yazied, A.A.; Alkahtani, J.; El-Gawad, H.G.A. Melatonin counteracts drought induced oxidative damage and stimulates growth, productivity and fruit quality properties of tomato plants. Plants 2020, 9, 1276. [Google Scholar] [CrossRef] [PubMed]
- Jahan, M.S.; Guo, S.; Baloch, A.R.; Sun, J.; Shu, S.; Wang, Y.; Ahammed, G.J.; Kabir, K.; Roy, R. Melatonin alleviates nickel phytotoxicity by improving photosynthesis, secondary metabolism and oxidative stress tolerance in tomato seedlings. Ecotoxicol. Environ. Saf. 2020, 197, 110593. [Google Scholar] [CrossRef] [PubMed]
- Hasan, M.K.; Ahammed, G.J.; Sun, S.; Li, M.; Yin, H.; Zhou, J. Melatonin inhibits cadmium translocation and enhances plant tolerance by regulating sulfur uptake and assimilation in Solanum lycopersicum L. J. Agric. Food Chem. 2019, 67, 10563–10576. [Google Scholar] [CrossRef] [PubMed]
- Jahan, M.S.; Shu, S.; Wang, Y.; Chen, Z.; He, M.; Tao, M.; Sun, J.; Guo, S. Melatonin alleviates heat-induced damage of tomato seedlings by balancing redox homeostasis and modulating polyamine and nitric oxide biosynthesis. BMC Plant Biol. 2019, 19, 414. [Google Scholar] [CrossRef] [PubMed]
- Yang, X.; Xu, H.; Li, D.; Gao, X.; Li, T.; Wang, R. Effect of melatonin priming on photosynthetic capacity of tomato leaves under low-temperature stress. Photosynthetica 2018, 56, 884–892. [Google Scholar] [CrossRef]
- Ali, M.; Kamran, M.; Abbasi, G.H.; Saleem, M.H.; Ahmad, S.; Parveen, A.; Malik, Z.; Afzal, S.; Ahmar, S.; Dawar, K.M. Melatonin-induced salinity tolerance by ameliorating osmotic and oxidative stress in the seedlings of two tomato (Solanum lycopersicum L.) cultivars. J. Plant Growth Regul. 2021, 40, 2236–2248. [Google Scholar] [CrossRef]
- Wang, M.; Zhang, T.; Ding, F. Exogenous melatonin delays methyl jasmonate-triggered senescence in tomato leaves. Agronomy 2019, 9, 795. [Google Scholar] [CrossRef]
- Li, S.; Xu, Y.; Bi, Y.; Zhang, B.; Shen, S.; Jiang, T.; Zheng, X. Melatonin treatment inhibits gray mold and induces disease resistance in cherry tomato fruit during postharvest. Postharvest Biol. Technol. 2019, 157, 110962. [Google Scholar] [CrossRef]
- Liu, D.-D.; Sun, X.-S.; Liu, L.; Shi, H.-D.; Chen, S.-Y.; Zhao, D.-K. Overexpression of the melatonin synthesis-related gene SlCOMT1 improves the resistance of tomato to salt stress. Molecules 2019, 24, 1514. [Google Scholar] [CrossRef]
- Sun, Q.; Zhang, N.; Wang, J.; Zhang, H.; Li, D.; Shi, J.; Li, R.; Weeda, S.; Zhao, B.; Ren, S. Melatonin promotes ripening and improves quality of tomato fruit during postharvest life. J. Exp. Bot. 2015, 66, 657–668. [Google Scholar] [CrossRef]
- Dou, J.; Wang, J.; Tang, Z.; Yu, J.; Wu, Y.; Liu, Z.; Wang, J.; Wang, G.; Tian, Q. Application of exogenous melatonin improves tomato fruit quality by promoting the accumulation of primary and secondary metabolites. Foods 2022, 11, 4097. [Google Scholar] [CrossRef] [PubMed]
- Gotoh, E.; Suetsugu, N.; Yamori, W.; Ishishita, K.; Kiyabu, R.; Fukuda, M.; Higa, T.; Shirouchi, B.; Wada, M. Chloroplast accumulation response enhances leaf photosynthesis and plant biomass production. Plant Physiol. 2018, 178, 1358–1369. [Google Scholar] [CrossRef] [PubMed]
- Dui, H.Y.; Mei, L.R.; Bin, W.C.; Ming, S.G. Effect of Exogenous Calcium on Root Growth and Endogenous Hormone Contents in Pineapple Seedlings. Adv. Mater. Res. 2013, 864, 106–110. [Google Scholar]
- Zhang, N.; Zhao, B.; Zhang, H.J.; Weeda, S.; Yang, C.; Yang, Z.C.; Ren, S.; Guo, Y.D. Melatonin promotes water-stress tolerance, lateral root formation, and seed germination in cucumber (Cucumis sativus L.). J. Pineal Res. 2012, 54, 15–23. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Wang, W.; Wang, L.; Sun, Y. Exogenous melatonin improves seedling health index and drought tolerance in tomato. Plant Growth Regul. Int. J. Nat. Synth. Regul. 2015, 77, 317–326. [Google Scholar] [CrossRef]
- Neumann, G. Cluster roots—An underground adaptation for survival in extreme environments. Trends Plant Sci. 2002, 7, 162–167. [Google Scholar] [CrossRef]
- Wang, Y.; Li, J.; Yang, L.; Chan, Z. Melatonin Antagonizes Cytokinin Responses to Stimulate Root Growth in Arabidopsis. J. Plant Growth Regul. 2022, 42, 1833–1845. [Google Scholar] [CrossRef]
- Guo, K. Carbon monoxide promotes root hair development in tomato. Plant Cell Environ. 2010, 32, 1033–1045. [Google Scholar] [CrossRef]
- Hartje, S.; Zimmermann, S.; Mueller-Roeber, K.B. Functional characterisation of LKT1, a K + uptake channel from tomato root hairs, and comparison with the closely related potato inwardly rectifying K + channel SKT1 after expression in Xenopus oocytes. Planta 2000, 210, 723–731. [Google Scholar] [CrossRef]
- Zhou, X.; Zhao, H.; Cao, K.; Hu, L.; Du, T.; Baluška, F.; Zou, Z. Beneficial roles of melatonin on redox regulation of photosynthetic electron transport and synthesis of D1 protein in tomato seedlings under salt stress. Front. Plant Sci. 2016, 7, 1823. [Google Scholar] [CrossRef]
- Brady, S.M. Auxin-Mediated Cell Cycle Activation during Early Lateral Root Initiation. Plant Cell 2019, 31, 1188–1189. [Google Scholar] [CrossRef] [PubMed]
- Verkest, A.; Weinl, C.; Inzé, D.; De Veylder, L.; Schnittger, A. Switching the Cell Cycle. Kip-Related Proteins in Plant Cell Cycle Control. Plant Physiol. 2005, 139, 1099–1106. [Google Scholar] [PubMed]
- Correa-Aragunde, N.; Graziano, M.; Chevalier, C.; Lamattina, L. Nitric oxide modulates the expression of cell cycle regulatory genes during lateral root formation in tomato. J. Exp. Bot. 2006, 57, 581–588. [Google Scholar] [CrossRef] [PubMed]
- Casimiro, I.; Beeckman, T.; Graham, N.; Bhalerao, R.; Zhang, H.; Casero, P.; Sandberg, G.; Bennett, M.J. Dissecting Arabidopsis lateral root development. Trends Plant Sci. 2003, 8, 165–171. [Google Scholar] [CrossRef] [PubMed]
- Takahashi, I.; Kojima, S.; Sakaguchi, N.; Umeda-Hara, C.; Umeda, M. Two Arabidopsis cyclin A3s possess G1 cyclin-like features. Plant Cell Rep. 2010, 29, 307–315. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Shi, Y.; Zhang, X.; Du, H.; Xu, B.; Huang, B. Melatonin suppression of heat-induced leaf senescence involves changes in abscisic acid and cytokinin biosynthesis and signaling pathways in perennial ryegrass (Lolium perenne L.). Environ. Exp. Bot. 2017, 138, 36–45. [Google Scholar] [CrossRef]
- Zhang, H.J.; Zhang, N.; Yang, R.C.; Wang, L.; Sun, Q.Q.; Li, D.B.; Cao, Y.Y.; Weeda, S.; Zhao, B.; Ren, S. Melatonin promotes seed germination under high salinity by regulating antioxidant systems, ABA and GA(4) interaction in cucumber (Cucumis sativus L.). J. Pineal Res. 2014, 57, 269–279. [Google Scholar] [CrossRef]
- Hu, Y.; Zhou, L.; Huang, M.; He, X.; Yang, Y.; Liu, X.; Li, Y.; Hou, X. Gibberellins play an essential role in late embryogenesis of Arabidopsis. Nat. Plants 2018, 4, 289–298. [Google Scholar] [CrossRef]
- Paque, S.; Weijers, D. Q & A: Auxin: The plant molecule that influences almost anything. BMC Biol. 2016, 14, 67. [Google Scholar]
- An, L.; Zhou, Z.; Sun, L.; Yan, A.; Xi, W.; Yu, N.; Cai, W.; Chen, X.; Yu, H.; Schiefelbein, J. A zinc finger protein gene ZFP5 integrates phytohormone signaling to control root hair development in Arabidopsis. Plant J. 2012, 72, 474–490. [Google Scholar] [CrossRef]
- Rymen, B.; Kawamura, A.; Schäfer, S.; Breuer, C.; Iwase, A.; Shibata, M.; Ikeda, M.; Mitsuda, N.; Koncz, C.; Ohme-Takagi, M. ABA Suppresses Root Hair Growth via the OBP4 Transcriptional Regulator. Plant Physiol. 2017, 173, 1750–1762. [Google Scholar] [CrossRef] [PubMed]
- Cheng, Y.; Zhu, W.; Chen, Y.; Ito, S.; Asami, T.; Wang, X. Brassinosteroids control root epidermal cell fate via direct regulation of a MYB-bHLH-WD40 complex by GSK3-like kinases. Elife 2014, 3, e02525. [Google Scholar] [CrossRef] [PubMed]
- Tripathi, P.; Subedi, S.; Khan, A.; Chung, Y.; Kim, Y. Silicon Effects on the Root System of Diverse Crop Species Using Root Phenotyping Technology. Plants 2021, 10, 885. [Google Scholar] [CrossRef] [PubMed]
- Cheng, F.; Cheng, Z.; Meng, H.; Tang, X. The garlic allelochemical diallyl disulfide affects tomato root growth by influencing cell division, phytohormone balance and expansin gene expression. Front. Plant Sci. 2016, 7, 1199. [Google Scholar] [CrossRef]
- Dobrev, P.I.; Vankova, R. Quantification of abscisic acid, cytokinin, and auxin content in salt-stressed plant tissues. In Plant Salt Tolerance: Methods and Protocols; Springer: Berlin/Heidelberg, Germany, 2012; pp. 251–261. [Google Scholar]
- Altaf, M.A.; Shahid, R.; Ren, M.; Naz, S.; Altaf, M.; Khan, L.; Tiwari, R.; Lal, M.; Shahid, M.; Kumar, R. Melatonin Improves Drought Stress Tolerance of Tomato by Modulating Plant Growth, Root Architecture, Photosynthesis, and Antioxidant Defense System. Antioxidants 2022, 11, 309. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data using Real-Time Quantitative PCR. Methods 2002, 25, 402–408. [Google Scholar] [CrossRef]
- Schmittgen, T.D.; Livak, K.J.; Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]






| Treatments | Total Root Length·cm−1 | Root Volume·cm−3 | Root Surarea cm−2 | Root Forks | Root Tips | Root Crossings |
|---|---|---|---|---|---|---|
| 0 (CK) | 102.77 ± 2.27 a | 0.11 ± 0.00 a | 11.71 ± 0.06 a | 220 ± 17.9 b | 412 ± 9.24 a | 41.67 ± 3.76 a |
| 10 μmol·L−1 | 97.19 ± 1.40 a | 0.14 ± 0.02 a | 12.49 ± 1.21 a | 367 ± 13.57 a | 352 ± 16.46 b | 45.33 ± 3.76 a |
| 30 μmol·L−1 | 73.88 ± 2.09 c | 0.11 ± 0.01 a | 11.84 ± 0.56 a | 349 ± 28.00 a | 283 ± 16.17 c | 48.00 ± 5.20 a |
| 50 μmol·L−1 | 81.87 ± 0.64 b | 0.10 ± 0.02 a | 9.26 ± 0.18 b | 269 ± 13.86 b | 249 ± 2.91 c | 52.00 ± 6.93 a |
| Primer Names | Accession Number | Sequences (5′→3′) |
|---|---|---|
| SlActin | NM_001330119.1 | F: CCACGAGACTACATACAA |
| R: TACCACCACTGAGCACAA | ||
| SlCYCA3;1 | NM_001247858.2 | F: TGCGGTTCTTGCCATCA |
| R: CGCCCAGTTGCTTCCA | ||
| SlCYCA2;1 | NM_001246839.2 | F: CATTAACAAGGGTATGCGAA |
| R: GTCAGGTAAAGAGTGTCCGG | ||
| SlCDKA1 | NM_001247447.2 | F: CACTTGCCTGTCGCCTCCTC |
| R: ACCCCCTCGTCTTCCTGCTC | ||
| SlKRP2 | NM_001247055.2 | F: CTTCACAAACCACCCACCCC |
| R: TTTCGTCCACCTCCCTCACC | ||
| SlARF2 | XM_010320115.3 | F: CTATGCCGTGTTGTGAATGTCCTG |
| R: ACCGTGAGTGCTTGTATCAGAGG | ||
| SlF3H | NM_001374424 | F: TGAAAAGACCCTTGAAACAA |
| R: CGATTCTCTCACATATTTCA | ||
| SlExt1 | NM_001247899.3 | F: AAGAGCTATGAGC TCCCAGATGG |
| R: TTAATCTTCATG CTGCTAGGAGC | ||
| SlKT1 | NM_001247329.3 | F: GAGGTCAGGGCTGGTGATCTTTG |
| R: TGGCACAGTCTCTTCGTTCGTAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tian, Q.; Wang, G.; Dou, J.; Niu, Y.; Li, R.; An, W.; Tang, Z.; Yu, J. Melatonin Modulates Tomato Root Morphology by Regulating Key Genes and Endogenous Hormones. Plants 2024, 13, 383. https://doi.org/10.3390/plants13030383
Tian Q, Wang G, Dou J, Niu Y, Li R, An W, Tang Z, Yu J. Melatonin Modulates Tomato Root Morphology by Regulating Key Genes and Endogenous Hormones. Plants. 2024; 13(3):383. https://doi.org/10.3390/plants13030383
Chicago/Turabian StyleTian, Qiang, Guangzheng Wang, Jianhua Dou, Yu Niu, Ruirui Li, Wangwang An, Zhongqi Tang, and Jihua Yu. 2024. "Melatonin Modulates Tomato Root Morphology by Regulating Key Genes and Endogenous Hormones" Plants 13, no. 3: 383. https://doi.org/10.3390/plants13030383
APA StyleTian, Q., Wang, G., Dou, J., Niu, Y., Li, R., An, W., Tang, Z., & Yu, J. (2024). Melatonin Modulates Tomato Root Morphology by Regulating Key Genes and Endogenous Hormones. Plants, 13(3), 383. https://doi.org/10.3390/plants13030383

