Next Article in Journal
Functional Characterization of the Paeonia ostii P5CS Gene under Drought Stress
Next Article in Special Issue
Genetic Diversity of Common Bean (Phaseolus vulgaris L.) Landraces Based on Morphological Traits and Molecular Markers
Previous Article in Journal
The Physiological and Molecular Mechanisms of Exogenous Melatonin Promote the Seed Germination of Maize (Zea mays L.) under Salt Stress
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Characterization of Lithuanian Tomato Varieties and Hybrids Using Phenotypic Traits and Molecular Markers

by
Audrius Radzevičius
*,
Jūratė Bronė Šikšnianienė
,
Rasa Karklelienė
,
Danguolė Juškevičienė
,
Raminta Antanynienė
,
Edvinas Misiukevičius
,
Aurelijus Starkus
,
Vidmantas Stanys
and
Birutė Frercks
Lithuanian Research Centre for Agriculture and Forestry, Institute of Horticulture, LT-54333 Babtai, Kaunas District, Lithuania
*
Author to whom correspondence should be addressed.
Plants 2024, 13(15), 2143; https://doi.org/10.3390/plants13152143
Submission received: 14 June 2024 / Revised: 29 July 2024 / Accepted: 1 August 2024 / Published: 2 August 2024
(This article belongs to the Special Issue Characterization and Conservation of Vegetable Genetic Resources)

Abstract

The aim of this study was to evaluate phenotypic traits and genetic diversity of the 13 tomato (Solanum lycopersicum L.) varieties and 6 hybrids developed at the Institute of Horticulture Lithuanian Research Centre for Agriculture and Forestry (LRCAF IH). For the molecular characterisation, seven previously published microsatellite markers (SSR) were used. A24 and 26 alleles were detected in tomato varieties and hybrids, respectively. Based on the polymorphism information content (PIC) value, the most informative SSR primers for varieties were TMS52, TGS0007, LEMDDNa and Tom236-237, and the most informative SSR primers for hybrids were SSR248 and TMS52. In UPGMA cluster analysis, tomato varieties are grouped in some cases due to genetic relationships, as the same cluster cultivars ‘Viltis’ (the parent of cv. ‘Laukiai’) and ‘Aušriai’ (the progeny of cv. ‘Jurgiai’) are present. The grouping of all hybrids in the dendrogram is related to the parental forms, and it shows the usefulness of molecular markers for tomato breeding, as they can be used to trace the origin of hybrids and, eventually, varieties accurately. The knowledge about the genetic background of Lithuanian tomato cultivars will help plan targeted crosses in tomato breeding programs.

1. Introduction

The cultivated tomato (Solanum lycopersicum L.) is the second most consumed vegetable worldwide and a major source of phytonutrients to human health. Huge variations can be found in the cultivated germplasm in terms of fruit colour (white, yellow, orange, pink, red, brown, and green), fruit shape (flattened, oblong, circular, cylindric, elliptic, cordate, ovate, pyriform, and obcordate), and fruit size (very little, small, medium, large, and very large) [1]. Owing to their economic significance, breeders have created many new tomato varieties each year, with the hybrid tomato being one of the most popular. The F1 hybrid cultivars are known for their high yields and occasionally blend the quirky qualities of heirloom tomatoes with the hardiness of regular commercial tomatoes [2]. The associated health impacts of tomatoes on cancer, neurodegenerative and cardioprotective effects, diabetes, and the immune system were recently reviewed [3].
Genetically, genomically, and breeding-wise, tomatoes are a highly studied agricultural crop. The tomato is one of the first crop plants for which a genetic linkage map was created. Currently, there are several molecular maps based on crosses between the cultivated and various wild species of tomato [4]. Based on an L. esculentum × L. pennellii hybrid, the high-density molecular map was created, containing over 2200 markers with an average distance between markers of less than 1 cM and an average of 750 kbp per cM [4,5].
Variety selections under similar growing conditions can achieve up to two times higher yields from the same plot area and significantly increase the economic efficiency of tomato production. A thorough understanding of the phylogenetic relationship of tomato varieties and the parentage of tomato hybrids is essential to identifying and selecting tomato lines for further variety breeding [6,7,8].
Breeders could greatly benefit from using molecular tools like molecular markers to help them create new elite cultivars. Molecular markers like simple sequence repeats (SSRs) are frequently used for cultivar fingerprinting and genetic diversity studies of tomatoes [9,10,11], and some of them were found to be linked to disease resistance [12,13] or salt tolerance [14,15]. Because SSR markers are highly repeatable, co-dominant (allowing for the identification of both parental alleles), and have broad coverage across the tomato genome, they help identify tomato hybrids. This makes them an effective tool for choosing and preserving hybrid lines with desired features in tomato breeding projects and to avoid misnaming varieties [16]. The new SSR markers are constantly being developed to link them to abiotic or biotic stress [17,18].
In the Lithuanian Research Centre for Agriculture and Forestry Institute of Horticulture (LRCAF IH), a large collection of over 500 different tomato genotypes was created, which could be used to develop new tomato varieties and hybrids. Before selecting genotypes for further breeding, evaluating the entire tomato collection by quantitative and qualitative attributes is important. Hence, the objective of this study was to evaluate 28 tomato genotypes developed in Lithuania using phenotypic traits and molecular markers. This is important in tomato breeding and selecting parental forms, which stand out in their valuable biological properties and transfer them to the new hybrids.

2. Materials and Methods

2.1. Plant Material

In total, 28 genotypes of tomato were studied; 13 tomato varieties and 6 hybrids were developed at LRCAF IH, and the 9 parental forms of hybrids were investigated (Table 1; Figure 1). Tomato seeds were sown in wooden boxes, and later sprouts with two real leaves were planted into polypropylene pots (pot volume 1.13 L, height 13.9 cm and diameter 11.6 cm). In total, 336 seedlings were grown (12 seedlings per one genotype). Grown seedlings were transplanted to a permanent place of growth in the natural soil in the unheated greenhouse and grown according to tomato-growing technology adopted by the Institute of Horticulture [19,20].

2.2. Phenotypic Traits Evaluation

Morphological tomato features of different varieties were recorded using The International Union for the Protection of New Varieties of Plants (UPOV) guidelines [21]. The average fruit mass was obtained by weighing all tomato fruits from four plants in three replications (twelve plants) and dividing it by the number of weighted fruits. The average fruit number was counted for four plants in three replications (twelve plants). Plant growth habit, leaf division of blade, pedicel abscission layer, fruit shape, time of tomato maturity, fruit green shoulder, colour at maturity and amount of locules were observed according to “UPOV” descriptions. Four plants in three replications (twelve plants) were selected for observation. Tomato fruit firmness was measured using the texture analyser “TA.XTPlus” (Stable Micro Systems, Godalming, UK). For each test, every tomato was punctured in three specific positions around the equatorial area, approximately 120° between them and perpendicular to the stem-bottom axis. The obtained data were processed by “Texture Exponent 32” software. The firmness was expressed as the peak force and recorded in Newtons (N).

2.3. DNA Extraction

Young leaves from 10 seedlings of each genotype studied (280 samples in total) were collected, flash-frozen with nitrogen and kept at −70 °C until further analysis. DNA was extracted using a modified [22] Cetyltrimethyl ammonium bromide (CTAB) method [23]. DNA was dissolved in 100 μL of TE buffer. The extracted DNA was quantified using a NanoDrop spectrophotometer (Implen, München, Germany) and normalised to a concentration of 300 ng/μL.

2.4. SSR Analysis

Polymerase chain reaction (PCR) was performed using 14 previously published SSR primers with Eppendorf Mastercycler x50a (Eppendorf, Hamburg, Germany). PCR amplifications were performed with 10 μL total volume of the reaction mixture, consisting of (300 ng/μL) DNA, 0.2 mM of each primer, 25 mM of MgCl, 2 mM of dNTP, 10 × buffer, 10 mM of DTT, 1% PVP, and 500 U Taq DNA polymerase (Thermo Scientific, Waltham, MA, USA). The PCR was performed with the conditions as follows: Initial denaturation at 94 °C for 10 min followed by five cycles at 94 °C for 30 s, X °C for 45 s and 72° for 1 min with touchdown procedure at primer annealing step (−1 °C in each cycle). Then, 30 cycles at 94° for 45 s, Y °C for 45 s and 72° for 1 min, with a final extension step of 10 min at 72°, where Y is the appropriate annealing step of primer and X = Y + 7 is the initial temperature for each primer by the touchdown procedure. The agarose gel was used to pre-screen the SSR primers. Eight out of ten used SSR primer pairs showed amplicons, and the forward primer was labelled with a fluorescence dye FAM, NED or VIC (Table 2). Capillary electrophoresis was performed with ABI 3130 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA) using a standard (GeneScan 500LIZ).

2.5. Genetical Data Analysis

Primary data were analysed using the software GeneMapper v.4.0 (Thermo Fisher Scientific Inc., USA). The frequency of alleles, expected (He) and observed heterozygosity (Ho), and the polymorphism information content (PIC) were calculated for each SSR primer pair using PowerMarker software v.3.25 [24]. The informativeness of microsatellite loci was established following [25], where PIC > 0.5 was considered highly informative, 0.5 > PIC > 0.25 was reasonably informative, and PIC < 0.25 was slightly informative. The phylogenetic tree was constructed using the “UPGMA” tree method within DARwin Software 6.0.0.021 [26]. To test the reliability of the dendrograms, a bootstrap analysis with 10,000 replications was performed within software DARwin.
Table 2. Tomato SSR primer pairs.
Table 2. Tomato SSR primer pairs.
No.Name of PrimerReferenceAnnealing Temp. °CDNA Sequence
1.SSR-47 [26]56NED-TCCTCAAGAAATGAAGCT CTG A
CCTTGGAGATAACAACCACAA
2.Tom236-237 [26]56NED-GTTTTTTCAACATCAAAGAGCT
GGATAGGTTTCGTTAGTGAACT
3.LEat014 [26]n.a.VIC-TGTGTTGCGTCATTACCACTAAAC
CCCAACCACCAATACTTTCC
4.Tom-59-60[27]48VIC-CACGTAAAATAAAGAAGGAAT
TAACACATGAACATTAGTTTGA
5.TMS52 [28]55FAM-TTCTATCTCATTTGGCTTCTT C
TTACCTTGAGAATGGCCTTG
6.SSR248 [11]57NED-GCATTCGCTGTAGCTCGTTT
GGGAGCTTCATCATAGTAACG
7.LEMDDNa [29]53.5VIC-ATTCAAGGAACTTTTAGCTCC
TGCATTAAGGTTCATAAATGA
8.TGS0007 [30]51.5FAM-GTGGATTCACTTACCGTTACAAGTT
52.4CATTCGTGGCATGAGATCAA

3. Results

3.1. Phenotypic Trait Evaluation

According to the phenological data obtained in this research, it was established that the average fruit mass had varied from 60 g (var. ‘Balčiai’, ‘Svara’, ‘Laukiai’) up to 160 g (var. ‘Milžinai’) in all investigated varieties and from 38 g (‘Adas’) up to 78 g (‘Sveikutis’) in hybrids (Table 3). It was observed that varieties with small fruits had produced more fruits on one plant with 2–4 fruit locules, and tomato varieties and hybrids with bigger fruits had a smaller number of tomato fruits on the one plant, and their fruits had more locules (from 4 up to 6 and more). Also, it was established that the vining of four tomato varieties (‘Skariai’, ‘Milžinai’, ‘Dručiai’, ‘Rutuliai’) and four hybrids (‘Sveikutis’, ‘Adas’, ‘Auksiai’, ‘Arvaisa’) was indeterminate, and other bushes of the remaining nine varieties were determinate. Three out of all investigated varieties and hybrids (‘Balčiai’, ‘Jurgiai’, ‘Milžinai’) had bipinnate leaf division of blade and only one variety ‘Neris’ had no peduncle abscission layer.
Most of the investigated tomatoes had slightly flattened fruits. Only varieties ‘Skariai’ and hybrid ‘Ainiai’ fruits were obovoid. Fruits of varieties ‘Svara’, and hybrids ‘Adas’ and ‘Auksiai’, were round, and varieties ‘Jurgiai’ were circular.
The majority of the investigated Lithuanian varieties were average early maturing. Only varieties ‘Viltis’, ‘Laukiai’ and ‘Aušriai’ were intended for early harvest, and one variety ‘Svara’ was intended for late harvest. Meanwhile, Lithuanian tomato hybrids were only average early (‘Sveikutis’, ‘Ainiai’, ‘Arvaisa’) or early (‘Pirmutis’, ‘Adas’, ‘Auksiai’).
One tomato hybrid, ‘Auksiai’, had orange-coloured fruits, and all the remaining tomato fruits of investigated varieties and hybrids were red-coloured. Still, some of them (‘Skariai’, ‘Milžinai’, ‘Viltis’, ‘Laukiai’, ‘Vytėnų didieji’, ‘Slapukai’) had green shoulders before maturity.
The fruits of tomato varieties ‘Laukiai’, ‘Jurgiai’, and hybrid ‘Auksiai’ were very soft and had weak fruit firmness. Meanwhile, the fruits of varieties ‘Balčiai’, ‘Vytėnų didieji’, ‘Dručiai’, and hybrid ‘Ainiai’ had strong fruit surface textures (Table 3).

3.2. Genetic Analysis

3.2.1. Molecular Fingerprints of Tomato Genotypes

DNA fragments were generated with all eight SSR primer pairs used in this study. Only one monomorphic fragment was generated with primer Tom 59-60; therefore, it was not used for further analysis. All the tomato varieties were homozygous within the seven remaining SSR primer loci (Table 4).
However, two heterozygotic fragments were generated with some SSR primer pairs (Table 5) in the investigated tomato hybrids. In some cases, hybrids of the same parental forms were found to have three different loci variants, either heterozygous or homozygous from one or the other parental form. The hybrid ‘Arvaisa’ had the largest number of such loci (five loci). By excluding these multiple loci, the number of homozygous loci in hybrids varied from two (‘Arvaisa ‘) to five (‘Auksiai’), and the highest heterozygotic number was observed in hybrid ‘Pirmutis’. All parental forms of the hybrids were monomorphic in all SSR loci. No SSR markers were found to be linked to any phenotypic trait either for varieties or hybrids.

3.2.2. SSR Primer Informativeness

In total, 25 polymorphic alleles were identified in tomato varieties and 26 in tomato hybrids, respectively (Table 6). The number of alleles with each primer pair ranged from 2 to 5 in all investigated varieties and hybrids, but the average value for hybrids was slightly higher (3.71) compared with varieties (3). The allelic range in all SSR loci was higher for hybrids, except loci TMS52, where the range was more comprehensive in varieties than in hybrids. So, all varieties were homozygous; therefore, the observed heterozygosity value (Ho) in all loci was 0. The expected heterozygosity (He) values for varieties ranged from 0.14 to 0.72, with an average of 0.51. He ranged from 0.33 to 0.66 for tomato hybrids, with an average value of 0.51. Despite the average values being equal in four loci, Tom236-237, LEMDDNa, TMS52 and TGS0007, the He values were higher for varieties. Polymorphism information content (PIC) for varieties ranged from 0.13 to 0.68, with an average of 0.47 (Table 6). The primer pairs TMS52, TGS0007, LEMDDNa and Tom236-237 were highly informative (PIC > 0.5) according to the informativeness of Botstein [25]. The PIC value for tomato hybrids ranged from 0.31 to 0.61, with an average of 0.45, and there were only two highly informative SSR primers, SSR248 and TMS52, for hybrids.

3.2.3. Genetic Diversity and Relationships of Tomato Varieties and Hybrids

UPGMA cluster analysis was performed using 12 morphological traits and seven SSR primers to assess the genetic diversity of tomato varieties. In the dendrogram and tanglegram, the varieties were divided into three main groups (Figure 2). The cluster of varieties according to morphological traits does not correspond to clustering according to molecular data. According to the grouping of varieties in both dendrograms, the closest relations between morphological and molecular data are for varieties ‘Vytėnų didieji’, ‘Neris’, ‘Aušriai’, ‘Balčiai’ and ‘Rutuliai’.
In the UPGMA dendrogram, the Lithuanian tomato hybrids and their parental forms were grouped into three main groups (Figure 3). The grouping of hybrids is related to the parental forms; all genotypes of hybrid ‘Sveikutis’ were grouped in the same group in tandem with both parental forms, namely 5622 and 300 (Table 1). Two hybrid ‘Arvaisa’ genotypes were separated by having the same parental form 300 in the same group. Two other genotypes of hybrids ‘Arvaisa’ belonged to the second group of dendrogram as the molecular fingerprints were more similar to the maternal parental form 322. In this group, one subgroup consisted of hybrid ‘Pirmutis’ and both parental forms 5628 and ‘Viltis’. Two other subgroups of the second cluster were built consistently of (1) hybrid ‘Auksiai’ and parental forms BO-01 and S-09, and (2) both genotypes of hybrid ‘Ainiai’ and parental forms ‘Vilina’ and SM01. The last group of dendrogram consisted of separated hybrid ‘Adas’ with the maternal form 1156.

4. Discussion

The fruit size and fruit quantity in the truss are determined by plant genotype [31,32]. Tomato fruit size results from the combination of cell number and cell size, which are determined by both cell division and expansion. Both cell division and cell expansion are under the control of complex interactions between hormone signalling and carbon partitioning, which establish crucial determinants of the quality of ripe fruit, such as the final size, weight, shape, and organoleptic and nutritional traits [33]. Our research has confirmed the findings of previous studies that the genotype of the plant is crucially essential to the size and quantity of fruit on the plant. It is helpful to have the molecular markers, which are necessary to describe the variety, linked to the different traits of the morphological description of the tomato genotypes. Such studies were carried out to identify SSR markers for fruit quality [34], soluble solids [35], drought tolerance [36] and yield-associated traits [37].
An elongated fruit shape was a prevalent morphological feature distinguishing many cultivated varieties from undomesticated accessions. Moreover, SSR markers can be used to distinguish tomato market classes [1,38] between tomatoes’ modern varieties and their landraces [11] or to identify mislabelling in commercially processed tomato products [16]. The major loci identified as contributing to an elongated shape in tomatoes are sun, ovate and fs8.1. Previous phenotypic evaluations demonstrated that three loci regulate unique ovary and fruit elongation aspects in different temporal manners. The most potent effect on organ shape is caused by sun. In addition to fruit shape, the sun also affected leaf and sepal elongation and stem thickness.
The synergistic interaction between sun and ovate or fs8.1 suggested that the pathways involving sun, ovate and the gene(s) underlying fs8.1 may converge at a common node [33,39]. Meanwhile, most of our investigated tomatoes had slightly flattened fruits, and only several had distinguished features with obovoid, round or circular fruit shapes. Only one tomato hybrid ‘Auksiai’ had orange-coloured fruits, while all the rest of the tomato fruits of investigated varieties and hybrids were red-coloured. Geographic origin, cultivation status, fruit size, shape, and growth type were found to exhibit significant genetic differentiation by using SSR markers [17].
Tomato plants’ vegetation period from germination to fruit maturity is a crucial factor in tomato breeding. Usually, the tomato plant vegetation period depends on the variety type and its adaptation in a growing climatic zone. Most Lithuanian tomato varieties are early or medium early and intended for non-heated greenhouses or open fields [40]. In previous studies, scientists observed a positive correlation between the vegetation period and yield: the earlier variety is less productive compared with later ones [40,41]. However, under Lithuanian climatic conditions, late tomato varieties usually fail to mature good quality fruits, so late tomato varieties can be grown only in heated greenhouses.
SSR markers occur frequently in eukaryotic genomes and are highly polymorphic. As a result of their robustness and repeatability, microsatellite markers are widely used codominant markers that have benefits over other molecular markers. SSR analysis offers helpful data for genotyping specific plants or varieties and determining the genetic relatedness of different accessions. For genetic analysis of Lithuanian tomato varieties and hybrids, in total, 14 previously published SSR markers were chosen for the analysis according to the high allelic number and primer informativeness content values. However, only seven of them were suitable for Lithuanian genotypes. Either no fragments were amplificated, or they were monomorphic. One primer, Tom-144, published as very polymorphic and linked to Fusarium wilt resistance for tomato varieties in India [12], was monomorphic for all Lithuanian genotypes.
Heterozygosity is one of the most used measures for describing genetic diversity and describing studied genotypes [42]. No heterozygosity was observed in the investigated cultivars as they were all homozygous with all the loci used. This shows the high level of purity of these varieties. The hybrids’ average heterozygosity was 0.34, with the highest level in SSR primer TGS0007. The expected heterozygosity for cultivars and hybrids was at the same level (0.51), but the range of values was higher in cultivars, showing the possible influence of inbreeding for hybrids.
The polymorphism information content (PIC) is one of the most important indicators as it gives a reasonable indication of the informativeness of the primers and thus allows for the comparison of results between different laboratories [25]. The average PIC values for varieties and hybrids were informative, with values of 0.45 and 0.47, respectively. The most informative SSR primers for varieties were TMS52, TGS0007, LEMDDNa and Tom236-237, and the most informative SSR primers for hybrids were SSR248 and TMS52. The informativeness of other SSR primers is similar to that of other authors [27,28]. Still, there is some tendency for Turkey [38] and Korea [43] to have PIC values greater than for Lithuanian genotypes. This indicates that the gene pool of tomato genotypes in Lithuania may be too poor, and there is a need to introduce more germplasm for the creation of new genetic diversity.
UPGMA cluster analysis demonstrated the usefulness of molecular markers for tomato breeding. They can be used to accurately trace the origin of hybrids and to accurately select the seedlings for tomato breeding. SSR markers will help test seed purity and identify varieties.
Although the first SSR markers for tomatoes were developed more than three decades ago [30], they are still beneficial for the investigation of the genetic diversity of tomatoes in different geographical regions [35,38,44,45,46] to verify the origin of varieties or link to different traits of fruit [34,35,37] or resistance to biotic and abiotic stresses [12,36,47]. Several hundreds of tomato SSR molecular markers are published and/or placed in the database (http://www.kazusa.or.jp/tomato/) (accessed on 31 July 2024). Paradoxically, no single set of SSR primers is suitable for testing all tomato genotypes at least for one continent. Such sets exist for other horticultural plants like cherry [48] or plum [49] in Europe. In the future, it would be great if such a unique primer set for tomatoes could be established through collaboration between laboratories in different countries.

5. Conclusions

This investigation offers valuable insights for characterising cultivated tomato genetic resources, indicating the strong differentiation of phenotypic traits and tomato types. The genetic diversity of 13 Lithuanian tomato varieties, six hybrids and ten parental forms was analysed for seven SSR markers, and it was found that the varieties are homozygous at all loci. The most informative SSR primer pairs for identifying Lithuanian tomato varieties are TMS52, TGS0007, LEMDDNa and Tom236-237. All parental forms of the hybrids were monomorphic at the loci studied, while the hybrids were heterozygous at some loci, inheriting a different allele from each parental form. The most suitable SSR primer pairs for identifying tomato hybrids are SSR248 and TMS52, and for their parental forms, TMS52, SSR248, and TGS0007. Discrepancies in the grouping of tomato varieties according to morphological and molecular data show the need for molecular fingerprinting of tomato varieties to not lose the Lithuanian tomato germplasm by morphological selection.

Author Contributions

Conceptualization, B.F., J.B.Š. and V.S.; methodology, A.R., R.K. and J.B.Š.; software, A.S., E.M. and J.B.Š.; validation B.F., R.A., J.B.Š., R.K., A.R. and V.S.; formal analysis A.S. and R.A.; investigation, B.F., A.R., D.J., A.S., R.A. and V.S.; resources, E.M. and V.S.; data curation, E.M., A.R., D.J. and B.F.; writing—original draft preparation, B.F. and A.R.; writing—review and editing, A.R., R.K., E.M., R.A., J.B.Š. and V.S.; visualization, E.M. and A.S.; supervision B.F. and V.S.; project administration B.F. All authors have read and agreed to the published version of the manuscript.

Funding

Genetics, biotechnology and breeding for plant biodiversity and innovative technologies. Long-term programmes of scientific research and experimental development of the Lithuanian Research Centre for Agriculture and Forestry approved by order No V-585 of Minister of Education, Science and Sport of the Republic of Lithuania of 19 April 2022.

Data Availability Statement

Data is contained within the article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Phan, N.T.; Kim, M.; Sim, S. Scientia Horticulturae Genetic variations of F 1 tomato cultivars revealed by a core set of SSR and InDel markers. Sci. Hortic. 2016, 212, 155–161. [Google Scholar] [CrossRef]
  2. Zahedi, S.M.; Ansari, N.A. Comparison in quantity characters (flowering and fruit set) of ten selected tomato (Solanum lycopersicum L.) genotypes under subtropical climate conditions (Ahvaz). Int. Res. J. Appl. Basic Sci. 2012, 3, 1192–1197. [Google Scholar]
  3. Collins, E.J.; Bowyer, C.; Tsouza, A.; Chopra, M. Tomatoes: An Extensive Review of the Associated Health Their Cultivation. Biology 2022, 11, 239. [Google Scholar] [CrossRef] [PubMed]
  4. Foolad, M.R. Genome Mapping and Molecular Breeding of Tomato. Int. J. Plant Genom. 2007, 52, 064358. [Google Scholar] [CrossRef] [PubMed]
  5. Hanson, P.M.; Yang, R.Y. Genetic improvement of tomato (Solanum lycopersicum L.) for phytonutrient content at AVRDC—The World Vegetable Center. Ekin J. Crop Breed. Genet. 2016, 2, 1–10. [Google Scholar]
  6. Sun, Y.L.; Kang, H.M.; Kim, Y.S. Tomato (Solanum lycopersicum) variety discrimination and hybridization analysis based on the 5S rRNA region. Biotechnol. Biotechnol. Equip. 2014, 28, 431–437. [Google Scholar] [CrossRef] [PubMed][Green Version]
  7. Uphoff, N.; Fasoula, V.; Iswandi, A.; Kassam, A.; Thakur, A.K. Improving the phenotypic expression of rice genotypes: Rethinking “intensification” for production systems and selection practices for rice breeding. Crop J. 2015, 3, 174–189. [Google Scholar] [CrossRef]
  8. Radzevičius, A.; Viškelis, P.; Viškelis, J.; Karklelienė, R.; Juškevičienė, D.; Duchovskis, P. Tomato biochemical composition and quality attributes in different maturity fruits. Acta Sci. Polonorum. Hortorum Cultus 2016, 15, 221–231. [Google Scholar]
  9. Singh, M.; Singh, N.P.; Arya, S.; Singh Vaishali, B. Diversity analysis of tomato germplasm (Lycopersicom Esculentum markers) using SSR. Int. J. Agric. Sci. Res. (IJASR) 2014, 4, 41–48. [Google Scholar]
  10. Korir, N.K.; Diao, W.; Tao, R.; Li, X.; Kayesh, E.; Li, A.; Zhen, W.; Wang, S. Genetic diversity and relationships among different tomato varieties revealed by EST-SSR markers. Genet. Mol. Res. 2014, 13, 43–53. [Google Scholar] [CrossRef] [PubMed]
  11. Sardaro, M.L.S.; Marmiroli, M.; Maestri, E.; Marmiroli, N. Genetic characterization of Italian tomato varieties and their traceability in tomato food products. Food Sci. Nutr. 2012, 1, 54–62. [Google Scholar] [CrossRef] [PubMed]
  12. Parmar, P.; Sudhir, A.; Preethi, R.; Dave, B.; Panchal, K.; Subramanian, R.B.; Patel, A.; Kathiria, K.B. Identification of a SSR marker (TOM-144) linked to Fusarium wilt resistance in Solanum lycopersicum. Am. J. Mol. Biol. 2013, 3, 241–247. [Google Scholar] [CrossRef]
  13. De Almeida, G.Q.; Silva, J.D.O.; Gonçalves, M.; Copati, F.; Dias, F.D.O.; Coelho, M. Tomato breeding for disease resistance. Multi-Sci. J. 2020, 3, 8–16. [Google Scholar] [CrossRef]
  14. Gharsallah, C.; Abdelkrim, A.B.; Fakhfakh, H.; Salhi-Hannachi, A.; Gorsane, F. SSR marker-assisted screening of commercial tomato genotypes under salt stress. Breed. Sci. 2016, 66, 823–830. [Google Scholar] [CrossRef] [PubMed]
  15. Makhadmeh, I.M.; Thabet, S.G.; Ali, M.; Alabbadi, B.; Albalasmeh, A.; Alqudah, A.M. Exploring genetic variation among Jordanian Solanum lycopersicon L. landraces and their performance under salt stress using SSR markers. J. Genet. Eng. Biotechnol. 2022, 20, 45. [Google Scholar] [CrossRef] [PubMed]
  16. Scarano, D.; Rao, R.; Masi, P.; Corrado, G. SSR fingerprint reveals mislabeling in commercial processed tomato products. Food Control 2015, 51, 397–401. [Google Scholar] [CrossRef]
  17. Villanueva-Gutierrez, E.E.; Johansson, E.; Prieto-Linde, M.L.; Centellas Quezada, A.; Olsson, M.E.; Geleta, M. Simple Sequence Repeat Markers Reveal Genetic Diversity and Population Structure of Bolivian Wild and Cultivated Tomatoes (Solanum lycopersicum L.). Genes 2022, 13, 1505. [Google Scholar] [CrossRef] [PubMed]
  18. Brake, M.; Al-Qadumii, L.; Hamasha, H.; Migdadi, H.; Awad, A.; Haddad, N.; Sadder, M.T. Development of SSR Markers Linked to Stress Responsive Genes along Tomato Chromosome 3 (Solanum lycopersicum L.). BioTech 2022, 11, 34. [Google Scholar] [CrossRef]
  19. Karklelienė, R.; Radzevičius, A. Scientific Methods for Agriculture and Forestry Research Investigations, 2nd ed.; Lithuanian Research Centre for Agriculture and Forestry: Akademija, Lithuania, 2013; pp. 157–259. [Google Scholar]
  20. Jankauskiene, J.; Surviliene, E. Vegetables Growing in a Greenhouse; Lithuanian Institute of Horticulture: Babtai, Lithuania, 2003; pp. 43–49. [Google Scholar]
  21. UPOV Guidelines. Available online: https://www.upov.int/test_guidelines/en (accessed on 31 July 2024).
  22. Stanys, V.; Baniulis, D.; Morkunaite-Haimi, S.; Siksnianiene, J.B.; Frercks, B.; Gelvonauskiene, D.; Stepulaitiene, I.; Staniene, G.; Siksnianas, T. Characterising the genetic diversity of Lithuanian sweet cherry (Prunus avium L.) cultivars using SSR markers. Sci. Hortic. 2012, 142, 136–142. [Google Scholar] [CrossRef]
  23. Doyle, J.J.; Doyle, J.L. Isolation of plant DNA from fresh tissue. Focus 1990, 12, 13–15. [Google Scholar]
  24. Liu, K.; Muse, S.V. PowerMarker: Integrated analysis environment for genetic marker data. Bioinformatics 2005, 21, 2128–2129. [Google Scholar] [CrossRef] [PubMed]
  25. Botstein, D.; White, R.; Skolnick, M.; Davis, R.W. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am. J. Hum. Genet. 1980, 32, 314–331. [Google Scholar] [PubMed]
  26. Perrier, X.; Jacquemoud-Collet, J.P. DARwin Software. 2006. Available online: https://darwin.cirad.fr/ (accessed on 31 July 2024).
  27. Benor, S.; Zhang, M.; Wang, Z.; Zhang, H. Assessment of genetic variation in tomato (Solanum lycopersicum L.) inbred lines using SSR molecular markers. J. Genet. Genom. 2008, 35, 373–379. [Google Scholar] [CrossRef] [PubMed]
  28. El-Awady, M.A.M.; El-Tarras, A.E.A.; Hassan, M.M. Genetic diversity and DNA fingerprint study in tomato (Solanum lycopersicum L.) cultivars grown in Egypt using simple sequence repeats (SSR) markers. Afr. J. Biotechnol. 2012, 11, 16233–16240. [Google Scholar]
  29. Areshchenkova, T.; Ganal, M.W. Comparative analysis of polymorphism and chromosomal location of tomato microsatellite markers isolated from different sources. Theor. Appl. Genet. 2002, 104, 229–235. [Google Scholar]
  30. Smulders, M.J.M.; Bredemeijer, G.M.M.; Rus-Kortekaas, W.; Arens, P.F.P.; Vosman, B. Use of short microsatellites from database sequences to generate polymorphisms among Lycopersicon esculentum cultivars and accessions of other Lycopersicon species Use of short microsatellites from database sequences to generate polymorphisms among Lycope. Theor. Appl. Genet. 1997, 97, 264–272. [Google Scholar] [CrossRef]
  31. Ho, L.C. The mechanism of assimilate partitioning and carbohydrate compartmentation in fruit in relation to the quality and yield of tomato. J. Exp. Bot. 1995, 47, 1239–1243. [Google Scholar]
  32. Zsogon, A.; Cermak, T.; Voytas, D.; Peres, L.E.P. Genome editing as a tool to achieve the crop ideotype and de novo domestication of wild relatives: Case study in tomato. Plant Sci. 2017, 256, 120–130. [Google Scholar] [CrossRef] [PubMed]
  33. Azzi, L.; Deluche, C.; Gevaudant, F.; Frangne, N.; Delmas, F.; Hernould, M.; Chevalier, C. Fruit growth-related genes in tomato. J. Exp. Bot. 2016, 66, 1075–1086. [Google Scholar]
  34. Ruggieri, V.; Francese, G.; Sacco, A.; D’Alessandro, A.; Rigano, M.M.; Parisi, M.; Marco Milone, M.; Cardi, T.; Mennella, G.; Barone, A. An association mapping approach to identify favourable alleles for tomato fruit quality breeding. BMC Plant Biol. 2014, 14, 337. [Google Scholar]
  35. Zhang, R.; Tao, J.; Song, L.; Zhang, J.; Liu, H.; Zhu, W. Identification of Genes of Molecular Marker TGS0892 on Chromosome 6 and Its Mechanism of Soluble Solids Metabolism in Tomato. Horticulturae 2023, 9, 52. [Google Scholar] [CrossRef]
  36. Khan, R.T.; Abbas, S.R.; Ahmed, S.D.; Javed, G.; Mehmood, A. Assessment of genetic diversity of tomato genotypes by using molecular markers. Pure Appl. Biol. 2020, 9, 1532–1540. [Google Scholar] [CrossRef]
  37. Schauer, N.; Semel, Y.; Roessner, U.; Gur, A.; Balbo, I.; Carrari, F.; Pleban, T.; Perez-Melis, A.; Bruedigam, C.; Kopka, J.; et al. Comprehensive metabolic profiling and phenotyping of interspecific introgression lines for tomato improvement. Nat. Biotechnol. 2006, 24, 447–454. [Google Scholar] [CrossRef]
  38. Okumus, A.; Dagidir, S. Assessment of genetic diversity on tomato (Lycopersicon esculentum Mill.) landraces using SSR molecular markers in Turkey. Front. Life Sci. Relat. Technol. 2021, 2, 51–59. [Google Scholar] [CrossRef]
  39. Wu, S.; Clevenger, J.P.; Sun, L.; Visa, S.; Kamiya, Y.; Jikumaru, Y.; Blakeslee, J.; Knaap, E. The control of tomato fruit elongation orchestrated by sun, ovate and fs8.1 in a wild relative of tomato. Plant Sci. 2015, 238, 95–104. [Google Scholar] [CrossRef]
  40. Visockienė, G. Advances of tomato breeding in Lithuania. Sodininkystė ir daržininkystė 1998, 17, 18–27. [Google Scholar]
  41. Gregersen, P.L.; Culetic, A.; Boschian, L. Plant senescence and crop productivity. Plant Mol. Biol. 2013, 82, 603. [Google Scholar] [CrossRef] [PubMed]
  42. Fu, Y.B. Understanding crop genetic diversity under modern plant breeding. Theor. Appl. Genet. 2015, 128, 2131–2142. [Google Scholar] [CrossRef] [PubMed]
  43. Kwon, Y.-S.; Park, S.-G.; Yi, S.-I. Assessment of Genetic Variation among Commercial Tomato (Solanum lycopersicum L.) Varieties Using SSR Markerks and Morphological Characteristics. Genes Genom. 2009, 31, 1–10. [Google Scholar] [CrossRef]
  44. Al-shammari, A.M.A.; Hamdi, G.J. Genetic diversity analysis and DNA fingerprinting of tomato breeding lines using SSR markers. J. Agric. Sci. 2021, 32, 1–7. [Google Scholar]
  45. Aziz, S.; Kantoglu, Y.; Tomlekova, N.; Staykova, T.; Ganeva, D.; Sarsu, F. Characterization of tomato genotypes by simple sequence repeats (SSR) molecular markers. Biharean Biol. 2021, 15, 142–148. [Google Scholar]
  46. Popescu, C.F.; Bădulescu, A.; Manolescu, A.E.; Dumitru, A.M.; Sumedrea, D.I. Morphological characterization and genetic variability assessment with ssr markers in several tomato genotypes. Horticulture 2022, 66, 513–519. [Google Scholar]
  47. Radzevičius, A.; Sakalauskienė, S.; Dagys, M.; Simniškis, R.; Karklelienė, R.; Juškevičienė, D.; Račkienė, R.; Brazaitytė, A. Differential Physiological Response and Antioxidant Activity Relative to High-Power Micro-Waves Irradiation and Temperature of Tomato Sprouts. Agriculture 2022, 12, 422. [Google Scholar] [CrossRef]
  48. Clarke, J.B.; Tobutt, K.R. A standard set of accessions, microsatellites and genotypes for harmonising the fingerprinting of cherry collections for the ECPGR. Horticulture 2009, 814, 615–618. [Google Scholar] [CrossRef]
  49. Nybom, H.; Giovannini, D.; Ordidge, M.; Hjeltnes, S.H.; Grahić, J.; Gaši, F. ECPGR recommended SSR loci for analyses of European plum (Prunus domestica) collections. Genet. Resour. 2020, 1, 40–48. [Google Scholar] [CrossRef]
Figure 1. Lithuanian tomatoes. From the left: ‘Adas’ hybrid, ‘Auksiai’ hybrid and ‘Skariai’ variety.
Figure 1. Lithuanian tomatoes. From the left: ‘Adas’ hybrid, ‘Auksiai’ hybrid and ‘Skariai’ variety.
Plants 13 02143 g001
Figure 2. Tanglegram for genetic relations of 13 Lithuanian tomato varieties based on the UPGMA analysis with 12 morphological traits (left) and 7 SSR primers (right). The scale bar indicates the distances between tomato varieties. In the middle, the grey lines indicate the strongness of the relation between morphological and molecular data.
Figure 2. Tanglegram for genetic relations of 13 Lithuanian tomato varieties based on the UPGMA analysis with 12 morphological traits (left) and 7 SSR primers (right). The scale bar indicates the distances between tomato varieties. In the middle, the grey lines indicate the strongness of the relation between morphological and molecular data.
Plants 13 02143 g002
Figure 3. Genetic relations of Lithuanian tomato hybrids and their parental forms based on the UPGMA analysis with 7 SSR primers. Hybrids with the same name but different numbers have more than one molecular fingerprint. The numbers under the branches indicate the percentage of 10,000 bootstrap replications. The scale bar indicates the length of the branches (genetic distance between tomato varieties).
Figure 3. Genetic relations of Lithuanian tomato hybrids and their parental forms based on the UPGMA analysis with 7 SSR primers. Hybrids with the same name but different numbers have more than one molecular fingerprint. The numbers under the branches indicate the percentage of 10,000 bootstrap replications. The scale bar indicates the length of the branches (genetic distance between tomato varieties).
Plants 13 02143 g003
Table 1. Genotypes of tomatoes developed in Lithuania.
Table 1. Genotypes of tomatoes developed in Lithuania.
No.VarietiesParental Forms of Varieties
1.‘Dručiai’Nr. 1404/79 × ‘Nina’
2.‘Vytėnų didieji’‘Patriot’ × ‘Talaliehin 186’
3.‘Neris’‘Dotnuvos tobulybė’ × ‘Grosse fleischige’
4.‘Milžinai’Nr. 478/7 × unknown
5.‘Jurgiai’Nr.13 × ‘Gribovo gruntiniai’ 1180
6.‘Aušriai’‘Jurgiai’ × Nr. 1154
7.‘Slapukai’‘Jurgiai’ × ‘Daltona
8.‘Laukiai’‘Marcanto’ × ‘Viltis’
9.‘Svara’‘Grif’ × ‘Silvana’
10.‘Balčiai’‘Grif’ × ‘Silvana’
11.‘Rutuliai’‘Šagane’ × ‘Aušriai’
12.‘Skariai’‘Everest’ × unknown
13.‘Viltis’‘Roma’ × ‘Alpatjevo štambiniai’
HybridsParental forms of hybrids
1.‘Sveikutis’ 5622 × 300
2.‘Pirmutis’ 5628 × ‘Viltis’
3.‘Ainiai’‘Vilina’ × SM-01
4.‘Adas’1156 × S-09
5.‘Auksiai’BO-01 × S-09
6.‘Arvaisa’322 × 300
Table 3. Tomato phenotypic traits of different varieties and hybrids.
Table 3. Tomato phenotypic traits of different varieties and hybrids.
Average Fruit Mass, gAverage Fruit Number on PlantPlant Growth Type aLeaf Division of Blade bPeduncle Abscission LayerFruit Shape in Longitudinal Section cTime of Maturity dFruit Colour at MaturityGreen ShoulderNumber of LoculesFruit Firmness e
Varieties
‘Dručiai’90 ± 8.640 ± 4.6Ind.Pin.YesS.FAERedNo≥6H
‘Vytėnų didieji’74 ± 7.436 ± 4.5Det.Pin.YesS.FAERedYes3–4H
‘Neris’75 ± 4.642 ± 3.7Det.Pin.NoS.F AERedNo3–4M
‘Milžinai’160 ± 9.624 ± 3.2Ind.Bip.YesS.FAERedYes≥6M
‘Jurgiai’84 ± 6.132 ± 3.6Det.Bip.YesCAERedNo2–3S
‘Aušriai’92 ± 12.330 ± 3.8Det.Pin.YesS.FERedNo4–6M
‘Slapukai’90 ± 7.333 ± 4.9Det.Pin.YesS.FAERedYes3–4M
‘Laukiai’60 ± 6.739 ± 4.1Det.Pin.YesS.FERedYes2–3S
‘Svara’60 ± 10.265 ± 8.1Det.Pin.YesRLRedNo3–4M
‘Balčiai’60 ± 6.743 ± 4.5Det.Bip.YesS.FAERedNo3–4H
‘Rutuliai’101 ± 5.437 ± 3.1Ind.Pin.YesS.FAERedNo3–4M
‘Skariai’142 ± 14.725 ± 5.8Ind.Pin.YesOAERedYes2–3M
‘Viltis’115 ± 21.220 ± 4.1Det.Pin.YesS.FERedYes4–5M
Hybrids
‘Sveikutis’ 78 ± 6.423 ± 4.1Ind.Pin.YesS.FAERedNo3–4M
‘Pirmutis’ 74 ± 7.024 ± 3.9Det.Pin.YesS.FERedYes3–4M
‘Ainiai’ 67 ± 5.965 ± 6.1Det.Pin.YesOAERedYes2–3H
‘Adas’ 35 ± 4.7120 ± 9.6Ind.Pin.YesRERedNo3–4M
‘Auksiai’ 38 ± 3.6111 ± 9.4Ind.Pin.YesREOrangeNo2–3S
‘Arvaisa’ 77 ± 5.721 ± 4.4Ind.Pin.YesS.FAERedYes4–6M
a Plant growth type: Ind.—indeterminate; Det.—determinate. b Leaf division of blade: Pin.—pinnate; Bip.—bipinnate. c Fruit shape in longitudinal section: C—circural; O—obovoid; R—round; S.F.—slightly flattened. d Time of maturity: E—early; AE—average early; L—late. e Fruit firmness: H—hard; M—medium; S—soft.
Table 4. Molecular profiles of Lithuanian tomato varieties based on SSR markers.
Table 4. Molecular profiles of Lithuanian tomato varieties based on SSR markers.
VarietiesSSR-47Tom 236-237LEat014TMS52SSR248LEMDDNaTGS0007
‘Dručiai’192176209158247228276
‘Vytėnų didieji’192190209147245228278
‘Neris’192190209147247228280
‘Milžinai’192176209158247210276
‘Jurgiai’192190209147247228278
‘Aušriai’192192209150250228278
‘Slapukai’192190233150245210287
‘Skariai’192176209158250212276
‘Rutuliai’192190233161247212278
‘Laukiai’192176209147247215285
‘Svara’194190209158247213287
‘Balčiai’192190209158247210285
‘Viltis’192180209154247228- *
* No fragment amplification.
Table 5. Molecular profiles of tomato hybrids and their parental forms based on SSR markers.
Table 5. Molecular profiles of tomato hybrids and their parental forms based on SSR markers.
HybridsSSR-47Tom236-237 LEat014 TMS52 SSR248 LEMDDNa TGS0007
‘Sveikutis’176:192; 176;
192
176:192;
176;
192
233150255213276:285; 276
‘Pirmutis’192180:192; 209:233154:158247213:228;
228
278:285
‘Ainiai’192176209154:158; 158247:255210276:283
‘Adas’192:194176209150247:255213276:288
‘Auksiai’192:194176209154245:252213276
‘Arvaisa’192176209:233; 209;
233
150:154; 150;
154
250:255; 255;
250
213:228;
213;
228
276:285; 276
Parental
Forms
SSR-47Tom236-237LEat014TMS52SSR248LEMDDNaTGS0007
5622192176233150255213285
300192176233150255213276
5628176192233158247228285
‘Viltis’192180209154247228- *
‘Vilina’192213209158255213276
SM-01192176209158245210283
1156192176209150255213288
S-09194176209161247 213276
BO-01192176209154252213276
322192176233154250228276
* No fragment amplification.
Table 6. SSR primer informativeness for tomato varieties and hybrids.
Table 6. SSR primer informativeness for tomato varieties and hybrids.
VarietiesHybrids
SSR PrimersAllele Size
Range (bp)
No of AlleleHe *Ho *PIC *Allele Size
Range (bp)
No of Allele HeHoPIC
Tom236-237176–19240.6000.54176–21340.330.310.31
SSR-47192–19420.1400.13176–19430.380.460.34
LEMDDNa210–22840.6700.62210–22830.540.150.48
LEat014209–23320.2600.23209–23320.500.150.37
TMS52147–16150.7200.68150–16140.630.230.55
SSR248245–25030.4700.43245–25550.660.460.61
TGS0007276–28740.7100.66276–28850.530.620.49
Mean-30.5100.47-3.710.510.340.45
* He—expected heterozygosity; Ho—observed heterozygosity; PIC—polymorphism information content.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Radzevičius, A.; Šikšnianienė, J.B.; Karklelienė, R.; Juškevičienė, D.; Antanynienė, R.; Misiukevičius, E.; Starkus, A.; Stanys, V.; Frercks, B. Characterization of Lithuanian Tomato Varieties and Hybrids Using Phenotypic Traits and Molecular Markers. Plants 2024, 13, 2143. https://doi.org/10.3390/plants13152143

AMA Style

Radzevičius A, Šikšnianienė JB, Karklelienė R, Juškevičienė D, Antanynienė R, Misiukevičius E, Starkus A, Stanys V, Frercks B. Characterization of Lithuanian Tomato Varieties and Hybrids Using Phenotypic Traits and Molecular Markers. Plants. 2024; 13(15):2143. https://doi.org/10.3390/plants13152143

Chicago/Turabian Style

Radzevičius, Audrius, Jūratė Bronė Šikšnianienė, Rasa Karklelienė, Danguolė Juškevičienė, Raminta Antanynienė, Edvinas Misiukevičius, Aurelijus Starkus, Vidmantas Stanys, and Birutė Frercks. 2024. "Characterization of Lithuanian Tomato Varieties and Hybrids Using Phenotypic Traits and Molecular Markers" Plants 13, no. 15: 2143. https://doi.org/10.3390/plants13152143

APA Style

Radzevičius, A., Šikšnianienė, J. B., Karklelienė, R., Juškevičienė, D., Antanynienė, R., Misiukevičius, E., Starkus, A., Stanys, V., & Frercks, B. (2024). Characterization of Lithuanian Tomato Varieties and Hybrids Using Phenotypic Traits and Molecular Markers. Plants, 13(15), 2143. https://doi.org/10.3390/plants13152143

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop