Long-Term In Situ Conservation Drove Microevolution of Solina d’Abruzzo Wheat on Adaptive, Agronomic and Qualitative Traits
Abstract
1. Introduction
2. Results
2.1. Growth Habitus
2.2. Phenotyping for Frost Tolerance and Other Leaf Traits
2.3. Allelic Variation at Major Loci Governing Vernalization Response and Photoperiod Sensitivity
2.4. Genetic Differentiation of Clusters by Fst
2.5. Commercial Quality Parameters
3. Discussion
4. Materials and Methods
4.1. Plant Materials
4.2. Greenhouse Trial
4.3. Frost Tolerance Test
4.4. DNA Extraction and PCR Based Assays
4.5. Fst Analysis
4.6. In Situ Trials
4.7. Commercial Quality Parameters
4.8. Statistical Analyses
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Porfiri, O.; Silveri, D. La “Solina” e altre varietà locali di cereali ancora coltivate in Abruzzo: I risultati di una campagna di collezione e caratterizzazione promossa dall’ARSSA. In Atti VI Convegno Nazionale Biodiversità; Tecnomack: Bari, Italy, 2004; pp. 843–852. [Google Scholar]
- Piergiovanni, A.R. Evaluation of genetic variation and grain quality of old bread wheat varieties introduced in north-western Italian environments. Genet. Resour. Crop Evol. 2013, 60, 325–333. [Google Scholar] [CrossRef]
- Dawson, J.C.; Serpolay, E.; Giuliano, S.; Schermann, N.; Galic, N.; Chable, V.; Goldringer, I. Multi-trait evolution of farmer varieties of bread wheat after cultivation in contrasting organic farming systems in Europe. Genetica 2012, 140, 1–17. [Google Scholar] [CrossRef]
- Khan, A.R.; Goldringer, I.; Thomas, M. Management Practices and Breeding History of Varieties Strongly Determine the Fine Genetic Structure of Crop Populations: A Case Study Based on European Wheat Populations. Sustainability 2020, 12, 613. [Google Scholar] [CrossRef]
- De Flaviis, R.; Tumino, G.; Terzi, V.; Morcia, C.; Santarelli, V.; Sacchetti, G.; Mastrocola, D. Exploration of the Genetic Diversity of Solina Wheat and Its Implication for Grain Quality. Plants 2022, 11, 1170. [Google Scholar] [CrossRef] [PubMed]
- Díaz, A.; Zikhali, M.; Turner, A.S.; Isaac, P.; Laurie, D.A. Copy Number Variation Affecting the Photoperiod-B1 and Vernalization-A1 Genes Is Associated with Altered Flowering Time in Wheat (Triticum aestivum). PLoS ONE 2012, 7, e33234. [Google Scholar] [CrossRef] [PubMed]
- Morcia, C.; Bergami, R.; Scaramagli, S.; Ghizzoni, R.; Carnevali, P.; Terzi, V. A Chip Digital PCR Assay for Quantification of Common Wheat Contamination in Pasta Production Chain. Foods 2020, 9, 911. [Google Scholar] [CrossRef]
- Comadran, J.; Kilian, B.; Russell, J.; Ramsay, L.; Stein, N.; Ganal, M.; Shaw, P.; Bayer, M.; Thomas, W.; Marshall, D.; et al. Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed to spring growth habit and environmental adaptation in cultivated barley. Nat. Genet. 2012, 44, 1388–1392. [Google Scholar] [CrossRef]
- Enjalbert, J.; Dawson, J.C.; Paillard, S.; Rhoné, B.; Rousselle, Y.; Thomas, M.; Goldringer, I. Dynamic management of crop diversity: From an experimental approach to on-farm conservation. Comptes Rendus Biol. 2011, 334, 458–468. [Google Scholar] [CrossRef]
- Goldringer, I.; Prouin, C.; Rousset, M.; Galic, N.; Bonnin, I. Rapid Differentiation of Experimental Populations of Wheat for Heading Time in Response to Local Climatic Conditions. Ann. Bot. 2006, 98, 805–817. [Google Scholar] [CrossRef]
- Kamran, A.; Iqbal, M.; Spaner, D. Flowering time in wheat (Triticum aestivum L.): A key factor for global adaptability. Euphytica 2014, 197, 1–26. [Google Scholar] [CrossRef]
- Muterko, A.; Kalendar, R.; Salina, E. Allelic variation at the VERNALIZATION-A1, VRN-B1, VRN-B3, and PHOTOPERIOD-A1 genes in cultivars of Triticum durum Desf. Planta 2016, 244, 1253–1263. [Google Scholar] [CrossRef] [PubMed]
- Strejčková, B.; Milec, Z.; Holušová, K.; Cápal, P.; Vojtková, T.; Čegan, R.; Šafář, J. In-depth sequence analysis of bread wheat VRN1 genes. Int. J. Mol. Sci. 2021, 22, 12284. [Google Scholar] [CrossRef] [PubMed]
- Worland, A.J.; Korzun, V.; Röder, M.S.; Ganal, M.W.; Law, C.N. Genetic analysis of the dwarfing gene Rht8 in wheat. Part II. The distribution and adaptive significance of allelic variants at the Rht8 locus of wheat as revealed by microsatellite screening. Theor. Appl. Genet. 1998, 96, 1110–1120. [Google Scholar] [CrossRef]
- González, F.G.; Slafer, G.A.; Miralles, D.J. Pre-anthesis development and number of fertile florets in wheat as affected by photoperiod sensitivity genes Ppd-D1 and Ppd-B1. Euphytica 2005, 146, 253–269. [Google Scholar] [CrossRef]
- Wilhelm, E.P.; Boulton, M.I.; Al-Kaff, N.; Balfourier, F.; Bordes, J.; Greenland, A.J.; Powell, W.; Mackay, I.J. Rht-1 and Ppd-D1 associations with height, GA sensitivity, and days to heading in a worldwide bread wheat collection. Theor. Appl. Genet. 2013, 126, 2233–2243. [Google Scholar] [CrossRef]
- Grogan, S.M.; Brown-Guedira, G.; Haley, S.D.; McMaster, G.S.; Reid, S.D.; Smith, J.; Byrne, P.F. Allelic Variation in Developmental Genes and Effects on Winter Wheat Heading Date in the U.S. Great Plains. PLoS ONE 2016, 11, e0152852. [Google Scholar] [CrossRef]
- Bentley, A.R.; Turner, A.S.; Gosman, N.; Leigh, F.; Maccaferri, M.; Dreisigacker, S.; Greenland, A.J.; Laurie, D.A. Frequency of photoperiod-insensitive Ppd-A1a alleles in tetraploid, hexaploid and synthetic hexaploid wheat germplasm. Plant Breed. 2011, 130, 10–15. [Google Scholar] [CrossRef]
- Nishida, H.; Yoshida, T.; Kawakami, K.; Fujita, M.; Long, B.; Akashi, Y.; Laurie, D.A.; Kato, K. Structural variation in the 5′ upstream region of photoperiod-insensitive alleles Ppd-A1a and Ppd-B1a identified in hexaploid wheat (Triticum aestivum L.), and their effect on heading time. Mol. Breed. 2013, 31, 27–37. [Google Scholar] [CrossRef]
- Seki, M.; Chono, M.; Nishimura, T.; Sato, M.; Yoshimura, Y.; Matsunaka, H.; Fujita, M.; Oda, S.; Kubo, K.; Kiribuchi-Otobe, C.; et al. Distribution of photoperiod-insensitive allele Ppd-A1a and its effect on heading time in Japanese wheat cultivars. Breed. Sci. 2013, 63, 309–316. [Google Scholar] [CrossRef]
- Bonvicini, M. Genealogical Selection of the Wheat "Solina"; Istituto di Allevamento Vegetale per la Cerealicoltura: Bologna, Italy, 1936. [Google Scholar]
- Bocci, R.; Bussi, B.; Petitti, M.; Franciolini, R.; Altavilla, V.; Galluzzi, G.; Di Luzio, P.; Migliorini, P.; Spagnolo, S.; Floriddia, R.; et al. Yield, yield stability and farmers’ preferences of evolutionary populations of bread wheat: A dynamic solution to climate change. Eur. J. Agron. 2020, 121, 126156. [Google Scholar] [CrossRef]
- Casañas, F.; Simó, J.; Casals, J.; Prohens, J. Towards an evolved concept of landraces. Front. Plant Sci. 2017, 8, 145. [Google Scholar] [CrossRef] [PubMed]
- Raggi, L.; Pacicco, L.C.; Caproni, L.; Álvarez-Muñiz, C.; Annamaa, K.; Barata, A.M.; Batir-Rusu, D.; Díez, M.J.; Heinonen, M.; Holubec, V.; et al. Analysis of landrace cultivation in Europe: A means to support in situ conservation of crop diversity. Biol. Conserv. 2022, 267, 109460. [Google Scholar] [CrossRef]
- Badeck, F.-W.; Rizza, F. A Combined Field/Laboratory Method for Assessment of Frost Tolerance with Freezing Tests and Chlorophyll Fluorescence. Agronomy 2015, 5, 71–88. [Google Scholar] [CrossRef]
- Yan, L.; Helguera, M.; Kato, K.; Fukuyama, S.; Sherman, J.; Dubcovsky, J. Allelic variation at the VRN-1 promoter region in polyploid wheat. Theor. Appl. Genet. 2004, 109, 1677–1686. [Google Scholar] [CrossRef]
- Fu, D.; Szűcs, P.; Yan, L.; Helguera, M.; Skinner, J.S.; Von Zitzewitz, J.; Hayes, P.M.; Dubcovsky, J. Large deletions within the first intron in VRN-1 are associated with spring growth habit in barley and wheat. Mol. Genet. Genom. 2005, 273, 54–65. [Google Scholar] [CrossRef]
- Yan, L.; Loukoianov, A.; Tranquilli, G.; Helguera, M.; Fahima, T.; Dubcovsky, J. Positional cloning of wheat vernalization gene VRN1. Proc. Natl Acad. Sci. USA 2003, 100, 6263–6268. [Google Scholar] [CrossRef]
- Beales, J.; Turner, A.; Griffiths, S.; Snape, J.W.; Laurie, D.A. A pseudo-response regulator is misexpressed in the photoperiod insensitive Ppd-D1a mutant of wheat (Triticum aestivum L.). Theor. Appl. Genet. 2007, 115, 721–733. [Google Scholar] [CrossRef]
- Guo, W.; Xin, M.; Wang, Z.; Yao, Y.; Hu, Z.; Song, W.; Yu, K.; Chen, Y.; Wang, X.; Guan, P.; et al. Origin and adaptation to high altitude of Tibetan semi-wild wheat. Nat. Commun. 2020, 11, 5085. [Google Scholar] [CrossRef]
- Ayalew, H.; Sorrells, M.E.; Carver, B.F.; Baenziger, P.S.; Ma, X.F. Selection signatures across seven decades of hard winter wheat breeding in the Great Plains of the United States. Plant Genome 2020, 13, e20032. [Google Scholar] [CrossRef]
- R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2021; Available online: https://www.R-project.org/ (accessed on 8 March 2023).
- Goudet, J.; Jombart, T.; hierfstat: Estimation and Tests of Hierarchical F-Statistics. R Package Version 0.5-11. 2022. Available online: https://CRAN.R-project.org/package=hierfstat (accessed on 8 March 2023).
- Klos, K.E.; Huang, Y.; Bekele, W.A.; Obert, D.E.; Babiker, E.; Beattie, A.D.; Bjørnstad, Å.; Bonman, J.M.; Carson, M.L.; Chao, S.; et al. Population genomics related to adaptation in elite oat germplasm. Plant Genome 2016, 9, plantgenome2015-10. [Google Scholar] [CrossRef]
- Lilin, Y. CMplot: Circle Manhattan Plot. R Package Version 4.2.0. 2022. Available online: https://CRAN.R-project.org/package=CMplot (accessed on 8 March 2023).
- Rizza, F.; Pagani, D.; Gut, M.; Prášil, I.; Lago, C.; Tondelli, A.; Orrù, L.; Mazzucotelli, E.; Francia, E.; Badeck, F.-W.; et al. Diversity in the response to low temperature in representative barley genotypes cultivated in Europe. Crop Sci. 2011, 51, 2759–2779. [Google Scholar] [CrossRef]
- Negri, V.; Maxted, N.; Veteläinen, M. European landrace conservation: An introduction. In European Landraces: On-Farm Conservation, Management and Use; Veteläinene, M., Negri, V., Maxted, N., Eds.; Bioversity Technical Bulletin 15; Bioversity International: Rome, Italy, 2009; pp. 1–22. [Google Scholar]
- Bellon, M.R.; Dulloo, E.; Sardos, J.; Thormann, I.; Burdon, J.J. In situ conservation—Harnessing natural and human-derived evolutionary forces to ensure future crop adaptation. Evol. Appl. 2017, 10, 965–977. [Google Scholar] [CrossRef]
- Würschum, T.; Boeven, P.H.; Langer, S.M.; Longin, C.F.H.; Leiser, W.L. Multiply to conquer: Copy number variations at Ppd-B1 and Vrn-A1 facilitate global adaptation in wheat. BMC Genet. 2015, 16, 96. [Google Scholar] [CrossRef] [PubMed]
- Royo, C.; Dreisigacker, S.; Soriano, J.M.; Lopes, M.S.; Ammar, K.; Villegas, D. Allelic variation at the vernalization response (Vrn-1) and photoperiod sensitivity (Ppd-1) genes and their association with the development of durum wheat landraces and modern cultivars. Front. Plant Sci. 2020, 11, 838. [Google Scholar] [CrossRef] [PubMed]
- Bélanger, J.; Pilling, D. The State of the World’s Biodiversity for Food and Agriculture; Food and Agriculture Organization of the United Nations (FAO): Rome, Italy, 2019; p. 572. [Google Scholar]
- Ceccarelli, S.; Grando, S. Evolutionary plant breeding as a response to the complexity of climate change. iScience 2020, 23, 101815. [Google Scholar] [CrossRef] [PubMed]
Trait | Sowing Time | Accessions χ2 Test (p Value) | Genetic Cluster (Blue/Red) χ2 Test (p Value) | Difference Blue/Red | Ratio Blue/Red |
---|---|---|---|---|---|
Height | November | <0.027 | <0.001 | 1.05 | |
February | <0.027 | <0.001 | 1.06 | ||
June | <0.009 | 0.641 | 1.00 | ||
Biomass | November | <0.004 | <0.009 | 1.12 | |
February | <0.004 | 0.189 | 0.91 | ||
June | <0.008 | 0.369 | 0.95 | ||
Heading date | November | 0.998 | <0.032 | −1.42 | |
February | <0.006 | <0.001 | −21.06 | ||
spikes 1 | November | <0.005 | 0.524 | 1.13 | |
February | <0.007 | <0.001 | 4.74 | ||
TKW 2 | November | <0.034 | <0.001 | 1.19 | |
February | <0.004 | <0.001 | 20.42 |
Accession | VRN-A1 | VRN-B1 | VRN-B3 | VRN-D1 | PPD-A1 | PPD-B1 | PPD-D1 |
---|---|---|---|---|---|---|---|
Solina1 | vrn-A1 | vrn-B1 | vrn-B3 | vrn-D1a | Ppd-A1a.1 | Ppd-B1b | Ppd-D1b |
Solina2 | vrn-A1 | vrn-B1 | vrn-B3 | vrn-D1a | Ppd-A1a.1 | Ppd-B1b | Ppd-D1b |
Solina3 | vrn-A1b | vrn-B1 | vrn-B3 | vrn-D1a | Ppd-A1a.1 | Ppd-B1b | Ppd-D1b |
Solina4 | vrn-A1b | vrn-B1 | vrn-B3 | vrn-D1a | Ppd-A1a.1 | Ppd-B1b | Ppd-D1b |
Solina5 | vrn-A1 | vrn-B1 | vrn-B3 | vrn-D1a | Ppd-A1a.1 | Ppd-B1b | Ppd-D1b |
Solina6 | vrn-A1 | vrn-B1 | vrn-B3 | vrn-D1a | Ppd-A1a.1 | Ppd-B1b | Ppd-D1b |
Solina7 | vrn-A1 | vrn-B1 | vrn-B3 | vrn-D1a | Ppd-A1a.1 | Ppd-B1b | Ppd-D1b |
Solina8 | vrn-A1b | vrn-B1 | vrn-B3 | vrn-D1a | Ppd-A1a.1 | Ppd-B1b | Ppd-D1b |
Solina9 | vrn-A1 | Vrn-B1a | vrn-B3 | vrn-D1a | Ppd-A1a.1 | Ppd-B1b | Ppd-D1b |
Solina10 | vrn-A1 | vrn-B1 | vrn-B3 | vrn-D1a | Ppd-A1a.1 | Ppd-B1b | Ppd-D1b |
Solina11 | vrn-A1b | vrn-B1 | vrn-B3 | vrn-D1a | Ppd-A1a.1 | Ppd-B1b | Ppd-D1b |
Solina12 | vrn-A1b | vrn-B1 | vrn-B3 | vrn-D1a | Ppd-A1a.1 | Ppd-B1b | Ppd-D1b |
Solina13 | vrn-A1 | vrn-B1 | vrn-B3 | vrn-D1a | Ppd-A1a.1 | Ppd-B1b | Ppd-D1b |
Solina14 | vrn-A1b | vrn-B1 | vrn-B3 | vrn-D1a | Ppd-A1a.1 | Ppd-B1b | Ppd-D1b |
Solina15 | vrn-A1 | vrn-B1 | vrn-B3 | vrn-D1a | Ppd-A1a.1 | Ppd-B1b | Ppd-D1b |
Solina16 | vrn-A1 | vrn-B1 | vrn-B3 | vrn-D1a | Ppd-A1a.1 | Ppd-B1b | Ppd-D1b |
Solina17 | vrn-A1 | vrn-B1 | vrn-B3 | vrn-D1a | Ppd-A1a.1 | Ppd-B1b | Ppd-D1b |
Solina19 | vrn-A1 | vrn-B1 | vrn-B3 | vrn-D1a | Ppd-A1a.1 | Ppd-B1b | Ppd-D1b |
Solina20 | vrn-A1 | vrn-B1 | vrn-B3 | vrn-D1a | Ppd-A1a.1 | Ppd-B1b | Ppd-D1b |
Solina21 | vrn-A1b | vrn-B1 | vrn-B3 | vrn-D1a | Ppd-A1a.1 | Ppd-B1b | Ppd-D1b |
Solina22 | vrn-A1 | Vrn-B1a | vrn-B3 | vrn-D1a | Ppd-A1a.1 | Ppd-B1b | Ppd-D1b |
Solina23 | vrn-A1b | vrn-B1 | vrn-B3 | vrn-D1a | Ppd-A1a.1 | Ppd-B1b | Ppd-D1b |
Solina24 | vrn-A1 | vrn-B1 | vrn-B3 | vrn-D1a | Ppd-A1a.1 | Ppd-B1b | Ppd-D1b |
24 Accessions | Type | L1 | L2 | L3 | V | L1/L2 | L1/L3 |
---|---|---|---|---|---|---|---|
Cluster | Fixed | <0.001 | <0.001 | <0.001 | <0.001 | 0.006 | ns |
Farm (Cluster) | Random | <0.001 | <0.001 | <0.001 | <0.001 | <0.001 | <0.001 |
24 Accessions | Type | L* | a* | b* | C* | h° | Hardness | Protein 1 | TKW 1 | TW 1 |
---|---|---|---|---|---|---|---|---|---|---|
Cluster | Fixed | ns | <0.001 | <0.001 | 0.003 | <0.001 | 0.005 | ns | 0.018 | 0.017 |
Farm (Cluster) | Random | <0.001 | <0.001 | <0.001 | <0.001 | <0.001 | <0.001 | <0.001 | <0.001 | <0.001 |
Effect | Type | L1 | L2 | L3 | V | L1/L2 | L1/L3 |
---|---|---|---|---|---|---|---|
Plot | Random | ns | ns | ns | ns | ns | ns |
Year (Y) | Random | 0.003 | <0.001 | <0.001 | <0.001 | 0.035 | 0.028 |
Farm (F) | Fixed | ns | ns | 0.016 | 0.016 | ns | ns |
Cluster (C) | Fixed | ns | 0.004 | 0.047 | ns | 0.013 | ns |
Y × F | Random | ns | ns | 0.049 | ns | ns | ns |
Y × C | Random | ns | ns | ns | ns | ns | 0.029 |
F × C | Fixed | 0.006 | ns | ns | ns | 0.027 | 0.001 |
Effect | Type | L* | a* | b* | C* | h° | Hardness | Protein 1 | TKW 1 | TW 1 |
---|---|---|---|---|---|---|---|---|---|---|
Plot | Random | ns | ns | ns | ns | ns | ns | ns | ns | ns |
Year (Y) | Random | ns | <0.001 | <0.001 | <0.001 | ns | 0.013 | 0.008 | ns | <0.001 |
Farm (F) | Fixed | <0.001 | ns | ns | ns | 0.003 | ns | 0.004 | <0.001 | ns |
Cluster (C) | Fixed | ns | ns | ns | ns | ns | ns | 0.004 | 0.006 | <0.001 |
Y × F | Random | 0.041 | ns | 0.009 | 0.013 | ns | 0.001 | <0.001 | <0.001 | <0.001 |
Y × C | Random | 0.014 | ns | ns | ns | 0.007 | ns | 0.011 | 0.006 | ns |
F × C | Fixed | ns | ns | ns | ns | ns | ns | ns | ns | <0.001 |
N.ID | Location | Latitude | Longitude | Altitude (m a.s.l.) |
---|---|---|---|---|
1 | Castelvecchio Subequo | 42.13 | 13.73 | 492 |
2 | Castelvecchio Subequo | 42.13 | 13.73 | 492 |
3 | Introdacqua | 42.01 | 13.90 | 652 |
4 | Scanno | 41.90 | 13.88 | 1004 |
5 | Luco dei Marsi | 41.96 | 13.47 | 664 |
6 | Goriano Sicoli | 42.08 | 13.77 | 712 |
7 | Tagliacozzo | 42.07 | 13.25 | 736 |
8 | Rosciolo dei Marsi | 42.12 | 13.34 | 902 |
9 | Magliano dei Marsi | 42.08 | 13.36 | 707 |
10 | Magliano dei Marsi | 42.08 | 13.36 | 707 |
11 | Scurcola Marsicana | 42.06 | 13.34 | 698 |
12 | Rocca Pia | 41.93 | 13.98 | 1067 |
13 | Scurcola Marsicana | 42.06 | 13.34 | 698 |
14 | Pescosansonesco | 42.25 | 13.88 | 532 |
15 | Farindola | 42.44 | 13.82 | 514 |
16 | Cagnano Amiterno | 42.46 | 13.23 | 844 |
17 | Castel Del Monte | 42.37 | 13.73 | 1354 |
18 | Montereale | 42.53 | 13.24 | 911 |
19 | Capestrano | 42.27 | 13.77 | 501 |
20 | Barisciano | 42.33 | 13.59 | 948 |
21 | Capitignano | 42.52 | 13.30 | 908 |
22 | Ofena | 42.33 | 13.76 | 521 |
23 | Rivisondoli | 41.87 | 14.07 | 1309 |
24 | Elice | 42.52 | 13.97 | 249 |
Primer Name | Primer Sequence [5′–3′] | References |
---|---|---|
VRN1AF VRN1R | GAAAGGAAAAATTCTGCTCG TGCACCTTCCC(C/G)CGCCCCAT | [26] |
Intr1/A/F2 Intr1/A/R3 | AGCCTCCACGGTTTGAAAGTAA AAGTAAGACAACACGAATGTGAGA | [27] |
Intr1/C/F Intr1/AB/R | GCACTCCTAACCCACTAACC TCATCCATCATCAAGGCAAA | [27] |
Intr1/B/F Intr1/B/R3 | CAAGTGGAACGGTTAGGACA CTCATGCCAAAAATTGAAGATGA | [27] |
Intr1/B/F Intr1/B/R4 | CAAGTGGAACGGTTAGGACA CAAATGAAAAGGAATGAGAGCA | [27] |
VRN4-B-INS-F VRN4-B-INS-R | CATAATGCCAAGCCGGTGAGTAC ATGTCTGCCAATTAGCTAGC | [28] |
VRN4-B-NOINS-F VRN4-B-NOINS-R | ATGCTTTCGCTTGCCATCC CTATCCCTACCGGCCATTAG | [28] |
TaPpd-A1prodelF TaPpd-A1prodelR3 | CGTACTCCCTCCGTTTCTTT AATTTACGGGGACCAAATACC | [19] |
TaPpd-A1prodelF TaPpd-A1prodelR2 | CGTACTCCCTCCGTTTCTTT GTTGGGGTCGTTTGGTGGTG | [19] |
TaPpd-B1proinF1 TaPpd-B1proinR1 | CAGCTCCTCCGTTTGCTTCC CAGAGGAGTAGTCCGCGTGT | [19] |
Ppd-D1_F1 Ppd-D1_R2 | ACGCCTCCCACTACACTG CACTGGTGGTAGCTGAGATT | [29] |
Ppd-D1_F1 Ppd-D1_R1 | ACGCCTCCCACTACACTG GTTGGTTCAAACAGAGAGC | [29] |
Oligo Name | Sequence (5′ to 3′) | 5′ Dye | 3′ Quencer | Reference |
---|---|---|---|---|
TriAPX-prob | AGCTCTTGCAAGGAT | FAM | MGB | [7] |
TriAPX-For | AGGAGCGGCCGAAGCT | |||
TriAPX-Rev | TGTGAAACATCGCTCCATCAC | |||
VRN-A1 | TGTGTTCGCTTTGGTTGTGCAGGCA | VIC | MGB | [6] |
VRN-A1-For | GCAGCCCACTTTTGGTCTCTA | |||
VRN-A1-Rev | TCTGCCCTCTCGCCTGTT |
Steps | Temperature | Time | Cycles |
---|---|---|---|
Activation | 96 °C | 10 min | 1 |
Denaturation | 98 °C | 30 s | 47 |
Annealing/extension | 56 °C | 2 min | |
Final extension | 60 °C | 2 min | 1 |
Storage | 4 °C | ∞ | 1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Morcia, C.; De Flaviis, R.; Terzi, V.; Gasparelli, M.E.; Ghizzoni, R.; Badeck, F.-W.; Rizza, F.; Santarelli, V.; Tumino, G.; Sacchetti, G. Long-Term In Situ Conservation Drove Microevolution of Solina d’Abruzzo Wheat on Adaptive, Agronomic and Qualitative Traits. Plants 2023, 12, 1306. https://doi.org/10.3390/plants12061306
Morcia C, De Flaviis R, Terzi V, Gasparelli ME, Ghizzoni R, Badeck F-W, Rizza F, Santarelli V, Tumino G, Sacchetti G. Long-Term In Situ Conservation Drove Microevolution of Solina d’Abruzzo Wheat on Adaptive, Agronomic and Qualitative Traits. Plants. 2023; 12(6):1306. https://doi.org/10.3390/plants12061306
Chicago/Turabian StyleMorcia, Caterina, Riccardo De Flaviis, Valeria Terzi, Maria Eugenia Gasparelli, Roberta Ghizzoni, Franz-W. Badeck, Fulvia Rizza, Veronica Santarelli, Giorgio Tumino, and Giampiero Sacchetti. 2023. "Long-Term In Situ Conservation Drove Microevolution of Solina d’Abruzzo Wheat on Adaptive, Agronomic and Qualitative Traits" Plants 12, no. 6: 1306. https://doi.org/10.3390/plants12061306
APA StyleMorcia, C., De Flaviis, R., Terzi, V., Gasparelli, M. E., Ghizzoni, R., Badeck, F.-W., Rizza, F., Santarelli, V., Tumino, G., & Sacchetti, G. (2023). Long-Term In Situ Conservation Drove Microevolution of Solina d’Abruzzo Wheat on Adaptive, Agronomic and Qualitative Traits. Plants, 12(6), 1306. https://doi.org/10.3390/plants12061306