Identification of Candidate Genes for Rind Color and Bloom Formation in Watermelon Fruits Based on a Quantitative Trait Locus-Seq
Abstract
1. Introduction
2. Results
2.1. Mode of Genetic Inheritance
2.2. WGRS and Single Nucleotide Polymorphism (SNP) Detection
2.3. QTL-Seq
2.4. Cleaved Amplified Polymorphic Sequence Development and Genetic Mapping
2.4.1. Rind Color
2.4.2. Bloom Formation
2.5. Determination of Bloom Powder Composition
3. Discussion
4. Materials and Methods
4.1. Plant Material
4.2. Phenotyping and Genetic Inheritance Analysis
4.3. QTL-Seq
4.3.1. Genomic DNA Extraction
4.3.2. WGRS
4.3.3. QTL-Seq
4.4. Genetic Linkage Mapping
4.4.1. CAPS Marker Genotyping Analysis
4.4.2. PCR and Electrophoresis
4.4.3. Genetic Linkage Map Construction
4.5. Determination of Bloom Powder Composition
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- KOSTAT (2020) Statistics Korea. 2020, Version: September 2021. Available online: https://kosis.kr/statHtml/statHtml.do?orgId=101&tblId=DT_1ET0027&conn_path=I2ancor (accessed on 24 August 2022).
- FAOSTAT (2020) FAOSTAT. Food and Agriculture Organization of the United Nations. Production: Crops: 2020. Available online: https://www.fao.org/faostat/en/#data/QCLancor (accessed on 26 August 2020).
- Levi, A.; Thomas, C.E.; Keinath, A.P.; Wehner, T.C. Genetic diversity among watermelon (Citrullus lanatus and Citrullus colocynthis) accessions. Genet. Resour. Crop Evol. 2001, 48, 559–566. [Google Scholar] [CrossRef] [Scilit]
- Guo, S.; Zhang, J.; Sun, H.; Salse, J.; Lucas, W.J.; Zhang, H.; Zheng, Y.; Mao, L.; Ren, Y.; Wang, Z.; et al. The draft genome of watermelon (Citrullus lanatus) and resequencing of 20 diverse accessions. Nat. Genet. 2013, 45, 51–58. [Google Scholar] [CrossRef] [Scilit]
- Wu, S.; Wang, X.; Reddy, U.; Sun, H.; Bao, K.; Gao, L.; Mao, L.; Patel, T.; Ortiz, C.; Abburi, V.L.; et al. Genome of ‘Charleston Gray’, the principal American watermelon cultivar, and genetic characterization of 1365 accessions in the US National Plant Germplasm System watermelon collection. Plant Biotechnol. J. 2019, 17, 2246–2258. [Google Scholar] [CrossRef] [Scilit]
- Gusmini, G.; Wehner, T.C. Genes determining rind pattern inheritance in watermelon: A review. HortScience 2005, 40, 1928–1930. [Google Scholar] [CrossRef] [Scilit]
- Porter, D. Inheritance of certain fruit and seed characters in watermelons. Hilgardia 1937, 10, 489–509. [Google Scholar] [CrossRef] [Scilit]
- Weetman, L. Inheritance and correlation of shape, size and color in the watermelon, Citrullus vulgaris Schrad. Res. Bull. 1937, 228, 224–256. [Google Scholar]
- Poole, C. Genetics of cultivated cucurbits. J. Hered. 1944, 35, 122–128. [Google Scholar] [CrossRef] [Scilit]
- Kumar, R.; Wehner, T.C. Discovery of second gene for solid dark green versus light green rind pattern in watermelon. J. Hered. 2011, 102, 489–493. [Google Scholar] [CrossRef] [Scilit]
- Li, B.; Lu, X.; Dou, J.; Aslam, A.; Gao, L.; Zhao, S.; He, N.; Liu, W. Construction of a high-density genetic map and mapping of fruit traits in watermelon (Citrullus lanatus L.) based on whole-genome resequencing. Int. J. Mol. Sci. 2018, 19, 3268. [Google Scholar] [CrossRef] [Scilit]
- Li, B.; Zhao, S.; Dou, J.; Ali, A.; Gebremeskel, H.; Gao, L.; He, N.; Lu, X.; Liu, W. Genetic mapping and development of molecular markers for a candidate gene locus controlling rind color in watermelon. Theor. Appl. Genet. 2019, 132, 2741–2753. [Google Scholar] [CrossRef] [Scilit]
- Barthlott, W.; Neinhuis, C. Purity of the sacred lotus, or escape from contamination in biological surfaces. Planta 1997, 202, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Hayashi, T.; Suzuki, T.; Oosawa, K. Correlation between occurrence of bloom on cucumber fruit and air temperature in a plastic film greenhouse. Acta Hortic. 2002, 588, 29–33. [Google Scholar] [CrossRef] [Scilit]
- Burow, G.; Franks, C.; Xin, Z. Genetic and physiological analysis of an irradiated bloomless mutant (epicuticular wax mutant) of sorghum. Crop Sci. 2008, 48, 41–48. [Google Scholar] [CrossRef] [Scilit]
- Ebercon, A.; Blum, A.; Jordan, W. A rapid colorimetric method for epicuticular wax contest of sorghum leaves 1. Crop Sci. 1977, 17, 179–180. [Google Scholar] [CrossRef] [Scilit]
- Alkio, M.; Jonas, U.; Sprink, T.; van Nocker, S.; Knoche, M. Identification of putative candidate genes involved in cuticle formation in Prunus avium (sweet cherry) fruit. Ann. Bot. 2012, 110, 101–112. [Google Scholar] [CrossRef] [Scilit]
- Shin, K.; Park, H.; Lee, C.; Yun, S.; Choi, I. Morphological Structure and Chemical Composition in Epicuticular Wax of Fruits in Four Kinds of Grape Cultivars. Korean J. Hortic. Sci. Technol. 2009, 27, 353–358. [Google Scholar]
- Sakata, Y.; Ohara, T.; Sugiyama, M. The history of melon and cucumber grafting in Japan. Acta Hortic. 2008, 767, 217–228. [Google Scholar] [CrossRef] [Scilit]
- Das, S.; Upadhyaya, H.D.; Bajaj, D.; Kujur, A.; Badoni, S.; Kumar, V.; Tripathi, S.; Gowda, C.L.; Sharma, S.; Singh, S.; et al. Deploying QTL-seq for rapid delineation of a potential candidate gene underlying major trait-associated QTL in chickpea. DNA Res. 2015, 22, 193–203. [Google Scholar] [CrossRef] [Scilit]
- Hormaza, J.; Dollo, L.; Polito, V. Identification of a RAPD marker linked to sex determination in Pistacia vera using bulked segregant analysis. Theor. Appl. Genet. 1994, 89, 9–13. [Google Scholar] [CrossRef] [Scilit]
- Meuwissen, T.; Goddard, M. Accurate prediction of genetic values for complex traits by whole-genome resequencing. Genetics 2010, 185, 623–631. [Google Scholar] [CrossRef] [Scilit]
- Saidi, A.; Hajibarat, Z. Application of Next Generation Sequencing, GWAS, RNA seq, WGRS, for genetic improvement of potato (Solanum tuberosum L.) under drought stress. Biocatal. Agric. Biotechnol. 2020, 29, 101801. [Google Scholar] [CrossRef] [Scilit]
- Singh, V.K.; Khan, A.W.; Jaganathan, D.; Thudi, M.; Roorkiwal, M.; Takagi, H.; Garg, V.; Kumar, V.; Chitikineni, A.; Gaur, P.M.; et al. QTL-seq for rapid identification of candidate genes for 100-seed weight and root/total plant dry weight ratio under rainfed conditions in chickpea. Plant Biotechnol. J. 2016, 14, 2110–2119. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pandey, M.K.; Khan, A.W.; Singh, V.K.; Vishwakarma, M.K.; Shasidhar, Y.; Kumar, V.; Garg, V.; Bhat, R.S.; Chitikineni, A.; Janila, P.; et al. QTL-seq approach identified genomic regions and diagnostic markers for rust and late leaf spot resistance in groundnut (Arachis hypogaea L.). Plant Biotechnol. J. 2017, 15, 927–941. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wen, J.; Jiang, F.; Weng, Y.; Sun, M.; Shi, X.; Zhou, Y.; Yu, L.; Wu, Z. Identification of heat-tolerance QTLs and high-temperature stress-responsive genes through conventional QTL mapping, QTL-seq and RNA-seq in tomato. BMC Plant Biol. 2019, 19, 398. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Branham, S.E.; Patrick Wechter, W.; Lambel, S.; Massey, L.; Ma, M.; Fauve, J.; Farnham, M.W.; Levi, A. QTL-seq and marker development for resistance to Fusarium oxysporum f. sp. niveum race 1 in cultivated watermelon. Mol. Breed. 2018, 38, 139. [Google Scholar] [CrossRef] [Scilit]
- Cho, Y.; Lee, S.; Park, J.; Kwon, S.; Park, G.; Kim, H.; Park, Y. Identification of a candidate gene controlling semi-dwarfism in watermelon, Citrullus lanatus, using a combination of genetic linkage mapping and QTL-seq. Hortic. Environ. Biotechnol. 2021, 62, 447–459. [Google Scholar] [CrossRef] [Scilit]
- Pei, S.; Liu, Z.; Wang, X.; Luan, F.; Dai, Z.; Yang, Z.; Zhang, Q.; Liu, S. Quantitative trait loci and candidate genes responsible for pale green flesh colour in watermelon (Citrullus lanatus). Plant Breed. 2021, 140, 349–359. [Google Scholar] [CrossRef] [Scilit]
- Jansson, S.; Stefánsson, H.; Nyström, U.; Gustafsson, P.; Albertsson, P.Å. Antenna protein composition of PS I and PS II in thylakoid sub-domains. Biochim. Biophys. Acta (BBA)-Bioenerg. 1997, 1320, 297–309. [Google Scholar] [CrossRef] [Scilit]
- Humbeck, K.; Krupinska, K. The abundance of minor chlorophyll a/b-binding proteins CP29 and LHCI of barley (Hordeum vulgare L.) during leaf senescence is controlled by light. J. Exp. Bot. 2003, 54, 375–383. [Google Scholar] [CrossRef]
- Caffarri, S.; Frigerio, S.; Olivieri, E.; Righetti, P.G.; Bassi, R. Differential accumulation of Lhcb gene products in thylakoid membranes of Zea mays plants grown under contrasting light and temperature conditions. Proteomics 2005, 5, 758–768. [Google Scholar] [CrossRef] [Scilit]
- Cheng, H.; Chen, M.; Yu, F.-L. The variation of pigment-protein complexes in the albescent stage of tea. Plant Physiol. Commun. 2000, 36, 300–304. [Google Scholar]
- Ma, C.-L.; Chen, L.; Wang, X.-C.; Jin, J.Q.; Ma, J.Q.; Yao, M.Z.; Wang, Z.L. Differential expression analysis of different albescent stages of ‘Anji Baicha’ (Camellia sinensis (L.) O. Kuntze) using cDNA microarray. Sci. Hortic. 2012, 148, 246–254. [Google Scholar] [CrossRef] [Scilit]
- Van Oostende, C.; Widhalm, J.R.; Furt, F.; Ducluzeau, A.L.; Basset, G.J. Vitamin K1 (phylloquinone): Function, enzymes and genes. Adv. Bot. Res. 2011, 59, 229–261. [Google Scholar] [CrossRef] [Scilit]
- Basset, G.J.; Latimer, S.; Fatihi, A.; Soubeyrand, E.; Block, A. Phylloquinone (Vitamin K1): Occurrence, biosynthesis and functions. Mini Rev. Med. Chem. 2017, 17, 1028–1038. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Uttam, G.A.; Praveen, M.; Rao, Y.V.; Tonapi, V.A.; Madhusudhana, R. Molecular mapping and candidate gene analysis of a new epicuticular wax locus in sorghum (Sorghum bicolor L. Moench). Theor. Appl. Genet. 2017, 130, 2109–2125. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jung, J.; Kim, J.; Jin, B.; Choi, Y.; Hong, C.O.; Lee, H.H.; Choi, Y.; Kang, J.; Park, Y. Characterization of the Lsi1 homologs in Cucurbita moschata and C. ficifolia for breeding of stock cultivars used for bloomless cucumber production. Hortic. Sci. Technol. 2017, 35, 333–343. [Google Scholar] [CrossRef] [Scilit]
- Choi, E.; Kim, B.; Hwang, U.; Do, H.W.; Suh, D.H. Characterization of Blooming on Cucumber Fruits. Korean J. Hortic. Sci. Technol. 2013, 31, 159–164. [Google Scholar] [CrossRef] [Scilit]
- Ma, J.F.; Tamai, K.; Yamaji, N.; Mitani, N.; Konishi, S.; Katsuhara, M.; Ishiguro, M.; Murata, Y.; Yano, M. A silicon transporter in rice. Nature 2006, 440, 688–691. [Google Scholar] [CrossRef] [Scilit]
- Ma, J.F.; Yamaji, N.; Mitani, N.; Tamai, K.; Konishi, S.; Fujiwara, T.; Katsuhara, M.; Yano, M. An efflux transporter of silicon in rice. Nature 2007, 448, 209–212. [Google Scholar] [CrossRef] [Scilit]
- Yamaji, N.; Ma, J.F. Further characterization of a rice silicon efflux transporter, Lsi2. Soil Sci. Plant Nutr. 2011, 57, 259–264. [Google Scholar] [CrossRef] [Scilit]
- Kaur, H.; Greger, M. A review on Si uptake and transport system. Plants 2019, 8, 81. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, Y.; Woo, M.O.; Rihua, P.; Koh, H.J. The DROOPING LEAF (DR) gene encoding GDSL esterase is involved in silica deposition in rice (Oryza sativa L.). PLoS ONE 2020, 15, e0238887. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hou, C.; Tian, W.; Kleist, T.; He, K.; Garcia, V.; Bai, F.; Hao, Y.; Luan, S.; Li, L. DUF221 proteins are a family of osmosensitive calcium-permeable cation channels conserved across eukaryotes. Cell Res. 2014, 24, 632–635. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Noh, J.; Do, Y.S.; Kim, G.H.; Choi, C. A genome-wide association study for the detection of genes related to apple Marssonina blotch disease resistance in apples. Sci. Hortic. 2020, 262, 108986. [Google Scholar] [CrossRef] [Scilit]
- Zhao, Y.; Liu, Y.; Ji, X.; Sun, J.; Lv, S.; Yang, H.; Zhao, X.; Hu, X. Physiological and proteomic analyses reveal cAMP-regulated key factors in maize root tolerance to heat stress. Food Energy Secur. 2021, 10, e309. [Google Scholar] [CrossRef] [Scilit]
- Romano, A.; Guse, A.; Krascenicova, I.; Schnabel, H.; Schnabel, R.; Glotzer, M. CSC-1: A subunit of the Aurora B kinase complex that binds to the survivin-like protein BIR-1 and the incenp-like protein ICP-1. J. Cell Biol. 2003, 161, 229–236. [Google Scholar] [CrossRef] [Scilit]
- Tang, R.-J.; Luan, S. Regulation of calcium and magnesium homeostasis in plants: From transporters to signaling network. Curr. Opin. Plant Biol. 2017, 39, 97–105. [Google Scholar] [CrossRef] [Scilit]
- Nongpiur, R.C.; Singla-Pareek, S.L.; Pareek, A. The quest for osmosensors in plants. J. Exp. Bot. 2020, 71, 595–607. [Google Scholar] [CrossRef] [Scilit]





| Trait | QTL | Genomic Location | No. of Genes | No. of SNP | Nonsynonymous | Synonymous | No. of InDel | ||
|---|---|---|---|---|---|---|---|---|---|
| Total | Genic | SNP | SNP | Total | Genic | ||||
| RC | RC-QTL-C6 | Chr.6: 27.56–27.83 | 22 | 144 | 3 | 0 | 3 | 26 | 0 |
| RC-QTL-C8 | Chr.8: 26.83–28.20 | 77 | 433 | 18 | 2 | 16 | 179 | 3 | |
| BF | BF-QTL-C1 | Chr.1: 32.10–33.51 | 217 | 674 | 51 | 28 | 23 | 32 | 1 |
| Marker | Gene ID | Gene Function | SNP Location | Forward Primer (5′→3′) | Restriction Enzyme | Expected Amplicon Size (PP/MP)z(bp) |
|---|---|---|---|---|---|---|
| RC-m1 | Cla97C06G119680 | dnaJ homolog subfamily C GRV2 | 20,950,898 | F: TCCTCTCTGCTGCTTTGGTT | Hpy166II | 186, 210, 35/396,35 |
| R: CATCCCACAAATGCCATGTA | ||||||
| RC-m2 | Cla97C06G123140 | protein SMAX1-LIKE 4-like | 25,477,052 | GAGCCTATCGAGGCAATCAA | MspI | 157, 280/437 |
| CTTCCTTTCCGCTCAAACAC | ||||||
| RC-m3 | Cla97C06G125670 | Pentatricopeptide repeat-containing protein | 27,617,100 | ACATGAATTACGCTGTTGTTGTTTT | MluCI | 5, 80, 67, 37, 10, 22/5, 147, 37, 10, 22 |
| TAACTGCTTTCCCAACATAATTGAAC | ||||||
| RC-m4 | Cla97C06G125700 | Expansin | 27,636,308 | ACTTCAATTTAGTTCTTGTAACCAACG | HpyCH4V | 116, 126, 47/242, 47 |
| AAAAACTCTGTTCCGTTTTGTTGTT | ||||||
| RC-m5 | Cla97C06G125710 | Chlorophyll a-b binding protein, chloroplastic | 27,640,473 | GTTTTTGGGAGGCGAGTTATTAGTT | MluCI | 47, 56, 118/47, 174 |
| AATGTGCTGCAATAGGTTGTCAAAT | ||||||
| RC-m6 | Cla97C06G125790 | RWP-RK domain-containing protein | 27,678,509 | TGTAGGCTCATCAACTTCCTATGAG | BccI | 35, 232/35, 116, 112 |
| GATGGTGGAGGAAATGAAGAAAATAGA | ||||||
| RC-m7 | Cla97C06G125810 | promoter | 27,691,376 | TTGTTGATAGAGAGTGACATTTTGTT | MfeI | 226, 206/432 |
| CCCTTTAAACGCAGTAAACCA | ||||||
| RC-m8 | Cla97C06G125840 | promoter | 27,722,575 | AACATGTTGTATTTCGTTGCATT | HpyCH4V | 19, 152, 254/425 |
| TTTGTGCCTATTTATGGTTGAA | ||||||
| RC-m9 | Cla97C06G127750 | gamma carbonic anhydrase-like 2, mitochondrial | 29,181,220 | AAATGGCAGCTGTAGCTCGT | BtgI | 272, 241/513 |
| AAAATTGCGAGTGCAGGAAT | ||||||
| BF-m1 | Cla97C01G019650 | 2OG-Fe(II) oxygenase family oxidoreductase | 32,548,234 | TTGTTTCCACCTGTTGTTTGTCTAA | BstNI | 253/72, 181 |
| TACTCATTCAACCGACAACAAAGAA | ||||||
| BF-m2 | Cla97C01G019840 | 26S proteasome non-ATPase regulatory subunit 4 homolog | 32,731,607 | ATTCTTCAATGGAGGAAATGGAGTC | HaeIII | 195, 104/299 |
| GACCTATCTAGAGAGCCCATGATTG | ||||||
| BF-m3 | Cla97C01G019840 | 26S proteasome non-ATPase regulatory subunit 4 homolog | 32,741,354 | TTGATTGTTATTCTGGGTTGTCAGT | RsaI | 177/103, 74 |
| ATGCTTTTAATTCCAGAAACTCACCG | ||||||
| BF-m019900 | Cla97C01G019900 | Protein of unknown function (DUF630 and DUF632) | 32,777,333 | CTATGGGTTGCTGTTACTCGAGAT | HindIII | 97, 91/188 |
| AATGTAGGTCTCTGCATTGGAAAAC | ||||||
| BF-m020050 | Cla97C01G020050 | CSC1-like protein | 32,878,578 | TCTTTTGCTCTCCTCCAAATATACC | FokI | 13, 75, 59, 107/13, 135, 107 |
| TCTTTTGCTCTCCTCCAAATATACC | ||||||
| BF-m4 | Cla97C01G020120 | Phospholipase D | 32,925,042 | AGCAAAATAAGAGCGAAGGAAAGAT | AciI | 74, 135/209 |
| GTCCATCACATTCGGTAATGGATAC | ||||||
| BF-m5 | Cla97C01G020220 | Regulator of Vps4 activity in the MVB pathway protein | 32,971,051 | GTTGGTTAGGGTAGAATTAGCAGGA | Hpy188I | 260/168, 92 |
| GAGCAAGCAGCAGTATTTTCATTTA | ||||||
| BF-m6 | Cla97C01G020540 | Trafficking protein particle complex subunit-like protein | 33,148,668 | TGAGGTTAAAGTAAATCTGGGCAAC | RsaI | 88, 45, 42/133, 42 |
| ATCGAAGTTATTGCAGGAAATCAAG | ||||||
| BF-m7 | Cla97C01G020540 | Trafficking protein particle complex subunit-like protein | 33,155,492 | ATCAGGGGTTCCTCTCAAAATTAAC | MluCI | 18, 81, 45, 5, 26/18, 126, 5 |
| ATTGCAGTGGCAACTTAATCTGAAT | ||||||
| BF-m8 | Cla97C01G020630 | promoter | 33,210,953 | TGCTCAATACATTTACAGCCTAATCA | MluCI | 73, 27, 155, 41/73, 182, 41 |
| TGAGGGGTGAATCGATATTTACATTAT |
| Genotype a | Number of F2 Plants b | Number of G Allele | Percentage of DG (%) | |||
|---|---|---|---|---|---|---|
| DG | IDG | LG | Total | |||
| G1G1G2G2 | 6 | 2 | 0 | 8 | 4 | 75.0 |
| G1g1G2G2 | 10 | 29 | 0 | 39 | 3 | 25.6 |
| G1G1G2g2 | 12 | 16 | 0 | 28 | 3 | 42.9 |
| G1g1G2g2 | 10 | 38 | 0 | 48 | 2 | 20.8 |
| g1g1G2G2 | 1 | 13 | 0 | 14 | 2 | 7.1 |
| G1G1g2g2 | 1 | 17 | 0 | 18 | 2 | 5.6 |
| G1g1g2g2 | 0 | 29 | 0 | 29 | 1 | 0.0 |
| g1g1G2g2 | 1 | 25 | 0 | 26 | 1 | 3.8 |
| g1g1g2g2 | 0 | 0 | 9 | 9 | 0 | 0.0 |
| Total | 41 | 169 | 9 | 219 | ||
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, S.; Jang, G.; Choi, Y.; Park, G.; Park, S.; Kwon, G.; Je, B.; Park, Y. Identification of Candidate Genes for Rind Color and Bloom Formation in Watermelon Fruits Based on a Quantitative Trait Locus-Seq. Plants 2022, 11, 2739. https://doi.org/10.3390/plants11202739
Lee S, Jang G, Choi Y, Park G, Park S, Kwon G, Je B, Park Y. Identification of Candidate Genes for Rind Color and Bloom Formation in Watermelon Fruits Based on a Quantitative Trait Locus-Seq. Plants. 2022; 11(20):2739. https://doi.org/10.3390/plants11202739
Chicago/Turabian StyleLee, Siyoung, Gaeun Jang, Yunseo Choi, Girim Park, Seoyeon Park, Gibeom Kwon, Byoungil Je, and Younghoon Park. 2022. "Identification of Candidate Genes for Rind Color and Bloom Formation in Watermelon Fruits Based on a Quantitative Trait Locus-Seq" Plants 11, no. 20: 2739. https://doi.org/10.3390/plants11202739
APA StyleLee, S., Jang, G., Choi, Y., Park, G., Park, S., Kwon, G., Je, B., & Park, Y. (2022). Identification of Candidate Genes for Rind Color and Bloom Formation in Watermelon Fruits Based on a Quantitative Trait Locus-Seq. Plants, 11(20), 2739. https://doi.org/10.3390/plants11202739

