Evaluation of Dittrichia viscosa Aquaporin Nip1.1 Gene as Marker for Arsenic-Tolerant Plant Selection
Abstract
:1. Introduction
2. Results
2.1. Cloning of Dittrichia Viscosa Nip1.1 Gene
2.2. Identification and Validation of Putative Reference Gene in Dittrichia Viscosa
2.3. Real-Time Analysis of DvNip1.1 Expression
2.4. DvNip1.1 Expression and As Tolerance
3. Discussion
4. Conclusions
5. Materials and Methods
5.1. Plant Material
5.2. DNA and RNA Extraction
5.3. Isolation of Sequences Encoding Partial Putative DvNip1 Gene
5.4. cDNA Synthesis and Amplification
5.5. Cloning and Sequence Analysis
5.6. Hydroponic Culture and HM Treatments
5.7. RNA Extraction and Real-Time Analysis
5.8. Selection of Candidate Reference Genes
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- López-Orenes, A.; Bueso, M.C.; Párraga-Aguado, I.M.; Calderón, A.A.; Ferrer, M.A. Coordinated role of soluble and cell wall bound phenols is a key feature of the metabolic adjustment in a mining woody fleabane (Dittrichia viscosa L.) population under semi-arid conditions. Sci. Total Environ. 2018, 618, 1139–1151. [Google Scholar] [CrossRef] [PubMed]
- Barbafieri, M.; Dadea, C.; Tassi, E.; Bretzel, F.; Fanfani, L. Uptake of Heavy Metals by Native Species Growing in a Mining Area in Sardinia, Italy: Discovering Native Flora for Phytoremediation. Int. J. Phytoremed. 2011, 13, 985–997. [Google Scholar] [CrossRef] [PubMed]
- Jiménez, M.; Bacchetta, G.; Casti, M.; Navarro, F.B.; Lallena, A.; Fernández-Ondoño, E. Potential use in phytoremediation of three plant species growing on contaminated mine-tailing soils in Sardinia. Ecol. Eng. 2011, 37, 392–398. [Google Scholar] [CrossRef]
- Parolin, P.; Ion Scotta, M.; Bresch, C. Biology of Dittrichia viscosa, a mediterranean ruderal plant: A review. Phyton 2014, 83, 251–262. [Google Scholar]
- Papadia, P.; Barozzi, F.; Angilé, F.; Migoni, D.; Piro, G.; Fanizzi, F.P.; Di Sansebastiano, G.-P. Evaluation of Dittrichia viscosa performance in substrates with moderately low levels of As and Cd contamination. Plant Biosyst. Int. J. Deal. All Asp. Plant Biol. 2020, 154, 983–989. [Google Scholar] [CrossRef]
- Guarino, F.; Conte, B.; Improta, G.; Sciarrillo, R.; Castiglione, S.; Cicatelli, A.; Guarino, C. Genetic characterization, micropropagation, and potential use for arsenic phytoremediation of Dittrichia viscosa (L.) Greuter. Ecotoxicol. Environ. Saf. 2018, 148, 675–683. [Google Scholar] [CrossRef]
- Yadav, M.K.; Saidulu, D.; Gupta, A.K.; Ghosal, P.S.; Mukherjee, A. Status and management of arsenic pollution in groundwater: A comprehensive appraisal of recent global scenario, human health impacts, sustainable field-scale treatment technologies. J. Environ. Chem. Eng. 2021, 9, 105203. [Google Scholar] [CrossRef]
- Liu, Y.; Tian, X.; Cao, S.; Li, Y.; Dong, H.; Li, Y. Pollution characteristics and health risk assessment of arsenic transformed from feed additive organoarsenicals around chicken farms on the North China Plain. Chemosphere 2021, 278, 130438. [Google Scholar] [CrossRef]
- Buscaroli, A.; Zannoni, D.; Menichetti, M.; Dinelli, E. Assessment of metal accumulation capacity of Dittrichia viscosa (L.) Greuter in two different Italian mine areas for contaminated soils remediation. J. Geochem. Explor. 2017, 182, 123–131. [Google Scholar] [CrossRef]
- Pérez-Sirvent, C.; Sánchez, M.J.M.; Martínez-López, S.; Bech, J.; Bolan, N. Distribution and bioaccumulation of arsenic and antimony in Dittrichia viscosa growing in mining-affected semiarid soils in southeast Spain. J. Geochem. Explor. 2012, 123, 128–135. [Google Scholar] [CrossRef]
- Mondal, S.; Pramanik, K.; Ghosh, S.K.; Pal, P.; Ghosh, P.K.; Ghosh, A.; Maiti, T.K. Molecular insight into arsenic uptake, transport, phytotoxicity, and defense responses in plants: A critical review. Planta 2022, 255, 1–37. [Google Scholar] [CrossRef] [PubMed]
- Kamiya, T.; Tanaka, M.; Mitani, N.; Ma, J.F.; Maeshima, M.; Fujiwara, T. NIP1; 1, an Aquaporin Homolog, Determines the Arsenite Sensitivity of Arabidopsis thaliana. J. Biol. Chem. 2009, 284, 2114–2120. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Barozzi, F.; Papadia, P.; Stefano, G.; Renna, L.; Brandizzi, F.; Migoni, D.; Fanizzi, F.P.; Piro, G.; Di Sansebastiano, G.-P. Variation in Membrane Trafficking Linked to SNARE AtSYP51 Interaction With Aquaporin NIP1;1. Front. Plant Sci. 2019, 9, 1949. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kamiya, T.; Fujiwara, T. Arabidopsis NIP1;1 Transports Antimonite and Determines Antimonite Sensitivity. Plant Cell Physiol. 2009, 50, 1977–1981. [Google Scholar] [CrossRef] [PubMed]
- Ji, R.; Zhou, L.; Liu, J.; Wang, Y.; Yang, L.; Zheng, Q.; Zhang, C.; Zhang, B.; Ge, H.; Yang, Y.; et al. Calcium-dependent protein kinase CPK31 interacts with arsenic transporter AtNIP1;1 and regulates arsenite uptake in Arabidopsis thaliana. PLoS ONE 2017, 12, e0173681. [Google Scholar] [CrossRef]
- Gomes, D.; Agasse, A.; Thiébaud, P.; Delrot, S.; Gerós, H.; Chaumont, F. Aquaporins are multifunctional water and solute transporters highly divergent in living organisms. Biochim. Biophys. Acta (BBA) Biomembr. 2009, 1788, 1213–1228. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Murata, K.; Mitsuoka, K.; Hirai, T.; Walz, T.; Agre, P.; Heymann, J.B.; Engel, A.K.; Fujiyoshi, Y. Structural determinants of water permeation through aquaporin-1. Nature 2000, 407, 599–605. [Google Scholar] [CrossRef]
- Törnroth-Horsefield, S.; Wang, Y.; Hedfalk, K.; Johanson, U.; Karlsson, M.; Tajkhorshid, E.; Neutze, R.; Kjellbom, P. Structural mechanism of plant aquaporin gating. Nature 2005, 439, 688–694. [Google Scholar] [CrossRef]
- Deshmukh, R.K.; Vivancos, J.; Ramakrishnan, G.; Guérin, V.; A Carpentier, G.; Sonah, H.; Labbé, C.; Isenring, P.; Belzile, F.J.; Bélanger, R.R. A precise spacing between the NPA domains of aquaporins is essential for silicon permeability in plants. Plant J. 2015, 83, 489–500. [Google Scholar] [CrossRef] [PubMed]
- Deshmukh, R.K.; Sonah, H.; Bélanger, R.R. Plant Aquaporins: Genome-Wide Identification, Transcriptomics, Proteomics, and Advanced Analytical Tools. Front. Plant Sci. 2016, 7, 1896. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Uehlein, N.; Otto, B.; Hanson, D.T.; Fischer, M.; McDowell, N.; Kaldenhoff, R. Function of Nicotiana tabacum Aquaporins as Chloroplast Gas Pores Challenges the Concept of Membrane CO2 Permeability. Plant Cell 2008, 20, 648–657. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Di Sansebastiano, G.P.; Barozzi, F.; Piro, G.; Denecke, J.; Lousa, C.D.M. Trafficking routes to the plant vacuole: Connecting alternative and classical pathways. J. Exp. Bot. 2017, 69, 79–90. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Besserer, A.; Burnotte, E.; Bienert, G.; Chevalier, A.S.; Errachid, A.; Grefen, C.; Blatt, M.R.; Chaumont, F. Selective Regulation of Maize Plasma Membrane Aquaporin Trafficking and Activity by the SNARE SYP121. Plant Cell 2012, 24, 3463–3481. [Google Scholar] [CrossRef] [Green Version]
- Hachez, C.; Laloux, T.; Reinhardt, H.; Cavez, D.; Degand, H.; Grefen, C.; De Rycke, R.; Inzé, D.; Blatt, M.R.; Russinova, E.; et al. Arabidopsis SNAREs SYP61 and SYP121 Coordinate the Trafficking of Plasma Membrane Aquaporin PIP2;7 to Modulate the Cell Membrane Water Permeability. Plant Cell 2014, 26, 3132–3147. [Google Scholar] [CrossRef] [Green Version]
- De Caroli, M.; Barozzi, F.; Renna, L.; Piro, G.; Di Sansebastiano, G.-P. Actin and Microtubules Differently Contribute to Vacuolar Targeting Specificity during the Export from the ER. Membranes 2021, 11, 299. [Google Scholar] [CrossRef] [PubMed]
- Li, N.; Wang, J.; Song, W.-Y. Arsenic Uptake and Translocation in Plants. Plant Cell Physiol. 2015, 57, 4–13. [Google Scholar] [CrossRef] [Green Version]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [PubMed]
- Khalid, S.; Shahid, M.; Niazi, N.K.; Murtaza, B.; Bibi, I.; Dumat, C. A comparison of technologies for remediation of heavy metal contaminated soils. J. Geochem. Explor. 2017, 182, 247–268. [Google Scholar] [CrossRef] [Green Version]
- Suman, J.; Uhlik, O.; Viktorova, J.; Macek, T. Phytoextraction of Heavy Metals: A Promising Tool for Clean-Up of Polluted Environment? Front. Plant Sci. 2018, 9, 1476. [Google Scholar] [CrossRef] [Green Version]
- Pandey, J.; Verma, R.K.; Singh, S. Suitability of aromatic plants for phytoremediation of heavy metal contaminated areas: A review. Int. J. Phytoremed. 2019, 21, 405–418. [Google Scholar] [CrossRef] [PubMed]
- Sytar, O.; Ghosh, S.; Malinska, H.; Zivcak, M.; Brestic, M. Physiological and molecular mechanisms of metal accumulation in hyperaccumulator plants. Physiol. Plant. 2020, 173, 148–166. [Google Scholar] [CrossRef] [PubMed]
- Yue, X.; Zhao, X.; Fei, Y.; Zhang, X. Correlation of Aquaporins and Transmembrane Solute Transporters Revealed by Genome-Wide Analysis in Developing Maize Leaf. Comp. Funct. Genom. 2012, 2012, 546930. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ariani, A.; Barozzi, F.; Sebastiani, L.; di Toppi, L.S.; di Sansebastiano, G.P.; Andreucci, A. AQUA1 is a mercury sensitive poplar aquaporin regulated at transcriptional and post-translational levels by Zn stress. Plant Physiol. Biochem. 2018, 135, 588–600. [Google Scholar] [CrossRef] [PubMed]
- De Caroli, M.; Furini, A.; DalCorso, G.; Rojas, M.; Di Sansebastiano, G.-P. Endomembrane Reorganization Induced by Heavy Metals. Plants 2020, 9, 482. [Google Scholar] [CrossRef] [Green Version]
- Czechowski, T.; Stitt, M.; Altmann, T.; Udvardi, M.K. Genome-Wide Identification and Testing of Superior Reference Genes for Transcript Normalization. Plant Physiol. 2005, 139, 5–17. [Google Scholar] [CrossRef] [Green Version]
- Jin, Y.; Liu, F.; Huang, W.; Sun, Q.; Huang, X. Identification of reliable reference genes for qRT-PCR in the ephemeral plant Arabidopsis pumila based on full-length transcriptome data. Sci. Rep. 2019, 9, 8408. [Google Scholar] [CrossRef] [PubMed]
- De Caroli, M.; Manno, E.; Piro, G.; Lenucci, M.S. Ride to cell wall: Arabidopsis XTH11, XTH29 and XTH33 exhibit different secretion pathways and responses to heat and drought stress. Plant J. 2021, 107, 448–466. [Google Scholar] [CrossRef] [PubMed]
- Venkatesh, J.; Yu, J.-W.; Park, S.W. Genome-wide analysis and expression profiling of the Solanum tuberosum aquaporins. Plant Physiol. Biochem. 2013, 73, 392–404. [Google Scholar] [CrossRef]
- De Rosa, A.; Watson-Lazowski, A.; Evans, J.R.; Groszmann, M. Genome-wide identification and characterisation of Aquaporins in Nicotiana tabacum and their relationships with other Solanaceae species. BMC Plant Biol. 2020, 20, 266. [Google Scholar] [CrossRef]
- Corpet, F. Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res. 1988, 16, 10881–10890. [Google Scholar] [CrossRef] [PubMed]
- Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hallgren, J.; Tsirigos, K.D.; Pedersen, M.D.; Juan, J. DeepTMHMM predicts alpha and beta transmembrane proteins using deep neural networks. bioRxiv preprint 2022.04.08.487609. 2022. [Google Scholar] [CrossRef]
- Chen, L.-R.; Chao, C.-H.; Chen, C.-F.; Lee, Y.-P.; Chen, Y.-L.; Shiue, Y.-L. Expression of 25 high egg production related transcripts that identified from hypothalamus and pituitary gland in red-feather Taiwan country chickens. Anim. Reprod. Sci. 2007, 100, 172–185. [Google Scholar] [CrossRef] [PubMed]
Primer | Sequence | Application |
---|---|---|
DvNipDegR | CCYAARCTYCTTSCYGGRTTCAT | gPCR |
DvNipDegF | GGYGCHCATTTYAAYCCDGC | gPCR |
DvNip3′GSP1-F | AACCCTGCCGTCACCATTG | 3′RACE |
RACE (AUAP) | GGCCACGCGTCGACTAGTAC | 3′-5′RACE |
DvNip5′GSP2R(nested) | CAATGGTGACGGCAGGGTTG | 5′RACE |
DvNip5′GSP1-R | GAAACCTACTGCAGGATGC | 5′RACE |
DvNip-Full-F | ATGGCGGAGATAGAGGGAG | RT-PCR |
DvNip-Full-R | TCATCGTTTAGAACTATTACG | RT-PCR |
AtEF1Afor | AGCCCAAGAGGCCATCAGA | RT-qPCR |
AtEF1Arev | CCACTGGCACCGTTCCA | RT-qPCR |
AtAct2for | TACAGTGTCTGGATCGGTGGTT | RT-qPCR |
AtAct2rev | CGGCCTTGGAGATCCACAT | RT-qPCR |
AtAct8for | GCTGGATTCGCTGGAGATGA | RT-qPCR |
AtAct8rev | CATGATGTCTAGGTCGACCAACA | RT-qPCR |
NtEF1Afor | TGAGATGCACCACGAAGCTC | RT-qPCR |
NtEf1Arev | CCAACATTGTCACCAGGAAGTG | RT-qPCR |
DvNip1.1for | TTTTGGTGCGTGGGTCTACA | RT-qPCR |
DvNip1.1rev | ACGACTGCTAGCATACCGAA | RT-qPCR |
HaEF1Afor | TCAACCAACCTCGACTGGTA | PCR |
HaEF1Arev | TCAACGCTCTTGATGACACC | PCR |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
De Paolis, A.; De Caroli, M.; Rojas, M.; Curci, L.M.; Piro, G.; Di Sansebastiano, G.-P. Evaluation of Dittrichia viscosa Aquaporin Nip1.1 Gene as Marker for Arsenic-Tolerant Plant Selection. Plants 2022, 11, 1968. https://doi.org/10.3390/plants11151968
De Paolis A, De Caroli M, Rojas M, Curci LM, Piro G, Di Sansebastiano G-P. Evaluation of Dittrichia viscosa Aquaporin Nip1.1 Gene as Marker for Arsenic-Tolerant Plant Selection. Plants. 2022; 11(15):1968. https://doi.org/10.3390/plants11151968
Chicago/Turabian StyleDe Paolis, Angelo, Monica De Caroli, Makarena Rojas, Lorenzo Maria Curci, Gabriella Piro, and Gian-Pietro Di Sansebastiano. 2022. "Evaluation of Dittrichia viscosa Aquaporin Nip1.1 Gene as Marker for Arsenic-Tolerant Plant Selection" Plants 11, no. 15: 1968. https://doi.org/10.3390/plants11151968