Association of Adiponectin and rs1501299 of the ADIPOQ Gene with Prediabetes in Jordan
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Design, Subject Description and Collection of Blood and Serum Samples
2.2. Biochemical Measurements
2.3. DNA Extraction and Genotyping
2.4. Statistical Analysis
3. Results
3.1. Subject Characteristics and Biochemical Profile
3.2. Association of Adiponectin and ADIPOQ Gene Variants with Prediabetes
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Kharroubi, A.T.; Darwish, H.M. Diabetes mellitus: The epidemic of the century. World J. Diabetes 2015, 6, 850–867. [Google Scholar] [CrossRef] [PubMed]
- Ogurtsova, K.; da Rocha Fernandes, J.; Huang, Y.; Linnenkamp, U.; Guariguata, L.; Cho, N.; Cavan, D.; Shaw, J.; Makaroff, L. IDF diabetes atlas: Global estimates for the prevalence of diabetes for 2015 and 2040. Diabetes Res. Clin. Pract. 2017, 128, 40–50. [Google Scholar] [CrossRef] [PubMed]
- Alfaqih, M.A.; Abu-Khdair, Z.; Saadeh, R.; Saadeh, N.; Al-Dwairi, A.; Al-Shboul, O. Serum branched chain amino acids are associated with type 2 diabetes mellitus in Jordan. Korean J. Fam. Med. 2018, 39, 313–317. [Google Scholar] [CrossRef] [PubMed]
- Ajlouni, K.; Khader, Y.S.; Batieha, A.; Ajlouni, H.; El-Khateeb, M. An increase in prevalence of diabetes mellitus in Jordan over 10 years. J. Diabetes Complicat. 2008, 22, 317–324. [Google Scholar] [CrossRef] [PubMed]
- Association, A.D. Diagnosis and classification of diabetes mellitus. Diabetes Care 2014, 37, S81–S90. [Google Scholar] [CrossRef] [PubMed]
- Tabák, A.G.; Herder, C.; Rathmann, W.; Brunner, E.J.; Kivimäki, M. Prediabetes: A high-risk state for diabetes development. Lancet 2012, 379, 2279–2290. [Google Scholar] [CrossRef]
- Haffner, S.M. Insulin resistance, inflammation, and the prediabetic state. Am. J. Cardiol. 2003, 92, 18–26. [Google Scholar] [CrossRef]
- Arita, Y.; Kihara, S.; Ouchi, N.; Takahashi, M.; Maeda, K.; Miyagawa, J.-I.; Hotta, K.; Shimomura, I.; Nakamura, T.; Miyaoka, K. Paradoxical decrease of an adipose-specific protein, adiponectin, in obesity. Biochem. Biophys. Res. Commun. 1999, 257, 79–83. [Google Scholar] [CrossRef] [PubMed]
- Spranger, J.; Kroke, A.; Möhlig, M.; Bergmann, M.M.; Ristow, M.; Boeing, H.; Pfeiffer, A.F. Adiponectin and protection against type 2 diabetes mellitus. Lancet 2003, 361, 226–228. [Google Scholar] [CrossRef]
- Lai, H.; Lin, N.; Xing, Z.; Weng, H.; Zhang, H. Association between the level of circulating adiponectin and prediabetes: A meta-analysis. J. Diabetes Investig. 2015, 6, 416–429. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Alfaqih, M.A.; Khader, Y.S.; Al-Dwairi, A.N.; Alzoubi, A.; Al-Shboul, O.; Hatim, A. Lower levels of serum adiponectin and the T allele of rs1501299 of the ADIPOQ gene are protective against polycystic ovarian syndrome in Jordan. Korean J. Fam. Med. 2018, 39, 108–113. [Google Scholar] [CrossRef] [PubMed]
- Diamanti-Kandarakis, E.; Dunaif, A. Insulin resistance and the polycystic ovary syndrome revisited: An update on mechanisms and implications. Endocr. Rev. 2012, 33, 981–1030. [Google Scholar] [CrossRef] [PubMed]
- Aleidi, S.; Issa, A.; Bustanji, H.; Khalil, M.; Bustanji, Y. Adiponectin serum levels correlate with insulin resistance in type 2 diabetic patients. Saudi Pharm. J. 2015, 23, 250–256. [Google Scholar] [CrossRef] [PubMed]
- Bilir, B.E.; Güldiken, S.; Tunçbilek, N.; Demir, A.M.; Polat, A.; Bilir, B. The effects of fat distribution and some adipokines on insulin resistance. Endokrynol. Polska 2016, 67, 277–282. [Google Scholar] [CrossRef] [PubMed]
- Kong, S.E.; Kang, Y.E.; Joung, K.H.; Lee, J.H.; Kim, H.J.; Ku, B.J. Plasma adiponectin levels in elderly patients with prediabetes. Endocrinol. Metab. 2015, 30, 326–333. [Google Scholar] [CrossRef] [PubMed]
- DeUgarte, C.M.; Bartolucci, A.A.; Azziz, R. Prevalence of insulin resistance in the polycystic ovary syndrome using the homeostasis model assessment. Fertil. Steril. 2005, 83, 1454–1460. [Google Scholar] [CrossRef] [PubMed]
- Cnop, M.; Havel, P.; Utzschneider, K.; Carr, D.; Sinha, M.; Boyko, E.; Retzlaff, B.; Knopp, R.; Brunzell, J.; Kahn, S.E. Relationship of adiponectin to body fat distribution, insulin sensitivity and plasma lipoproteins: Evidence for independent roles of age and sex. Diabetologia 2003, 46, 459–469. [Google Scholar] [CrossRef] [PubMed]
- Böttner, A.; Kratzsch, J.; Müller, G.; Kapellen, T.M.; Blüher, S.; Keller, E.; Blüher, M.; Kiess, W. Gender differences of adiponectin levels develop during the progression of puberty and are related to serum androgen levels. J. Clin. Endocrinol. Metab. 2004, 89, 4053–4061. [Google Scholar] [CrossRef] [PubMed]
- Kern, P.A.; Di Gregorio, G.B.; Lu, T.; Rassouli, N.; Ranganathan, G. Adiponectin expression from human adipose tissue: Relation to obesity, insulin resistance, and tumor necrosis factor-α expression. Diabetes 2003, 52, 1779–1785. [Google Scholar] [CrossRef] [PubMed]
- Jiang, Y.; Owei, I.; Wan, J.; Ebenibo, S.; Dagogo-Jack, S. Adiponectin levels predict prediabetes risk: The pathobiology of prediabetes in a biracial cohort (POP-ABC) study. BMJ Open Diabetes Res. Care 2016, 4, e000194. [Google Scholar] [CrossRef] [PubMed]
- Staels, B.; Fruchart, J.-C. Therapeutic roles of peroxisome proliferator–activated receptor agonists. Diabetes 2005, 54, 2460–2470. [Google Scholar] [CrossRef] [PubMed]
- Lago, R.M.; Singh, P.P.; Nesto, R.W. Congestive heart failure and cardiovascular death in patients with prediabetes and type 2 diabetes given thiazolidinediones: A meta-analysis of randomised clinical trials. Lancet 2007, 370, 1129–1136. [Google Scholar] [CrossRef]
- Nesto, R.W.; Bell, D.; Bonow, R.O.; Fonseca, V.; Grundy, S.M.; Horton, E.S.; Le Winter, M.; Porte, D.; Semenkovich, C.F.; Smith, S. Thiazolidinedione use, fluid retention, and congestive heart failure: A consensus statement from the American heart association and American diabetes association. Circulation 2003, 108, 2941–2948. [Google Scholar] [CrossRef] [PubMed]
- Khabour, O.F.; Mesmar, F.S.; Alatoum, M.A.; Gharaibeh, M.Y.; Alzoubi, K.H. Associations of polymorphisms in adiponectin and leptin genes with men’s longevity. Aging Male 2010, 13, 188–193. [Google Scholar] [CrossRef] [PubMed]
- Klöting, N.; Blüher, M. Extended longevity and insulin signaling in adipose tissue. Exp. Gerontol. 2005, 40, 878–883. [Google Scholar] [CrossRef] [PubMed]
- Hara, K.; Boutin, P.; Mori, Y.; Tobe, K.; Dina, C.; Yasuda, K.; Yamauchi, T.; Otabe, S.; Okada, T.; Eto, K. Genetic variation in the gene encoding adiponectin is associated with an increased risk of type 2 diabetes in the Japanese population. Diabetes 2002, 51, 536–540. [Google Scholar] [CrossRef] [PubMed]
- Ramya, K.; Ayyappa, K.A.; Ghosh, S.; Mohan, V.; Radha, V. Genetic association of ADIPOQ gene variants with type 2 diabetes, obesity and serum adiponectin levels in south Indian population. Gene 2013, 532, 253–262. [Google Scholar] [CrossRef] [PubMed]
- González-Sánchez, J.L.; Zabena, C.A.; Martínez-Larrad, M.T.; Fernández-Pérez, C.; Pérez-Barba, M.; Laakso, M.; Serrano-Ríos, M. An SNP in the adiponectin gene is associated with decreased serum adiponectin levels and risk for impaired glucose tolerance. Obes. Res. 2005, 13, 807–812. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Li, H.; Tanaka, K.; Tsumaki, N.; Yamada, Y. Identification of an enhancer sequence within the first intron required for cartilage-specific transcription of the α2 (XI) collagen gene. J. Biol. Chem. 2000, 275, 12712–12718. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.; Sadée, W. Searching for polymorphisms that affect gene expression and mRNA processing: Example ABCB1 (MDR1). AAPS J. 2006, 8, E515–E520. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.; Johnson, A.D.; Papp, A.C.; Kroetz, D.L.; Sadee, W. Multidrug resistance polypeptide 1 (MDR1, ABCB1) variant 3435c> t affects mRNA stability. Pharmacogenet. Genom. 2005, 15, 693–704. [Google Scholar] [CrossRef]
- Comuzzie, A.G.; Funahashi, T.; Sonnenberg, G.; Martin, L.J.; Jacob, H.J.; Black, A.E.K.; Maas, D.; Takahashi, M.; Kihara, S.; Tanaka, S. The genetic basis of plasma variation in adiponectin, a global endophenotype for obesity and the metabolic syndrome. J. Clin. Endocrinol. Metab. 2001, 86, 4321–4325. [Google Scholar] [CrossRef] [PubMed]
- Park, K.-G.; Park, K.S.; Kim, M.-J.; Kim, H.-S.; Suh, Y.-S.; Ahn, J.D.; Park, K.-K.; Chang, Y.-C.; Lee, I.-K. Relationship between serum adiponectin and leptin concentrations and body fat distribution. Diabetes Res. Clin. Pract. 2004, 63, 135–142. [Google Scholar] [CrossRef] [PubMed]
- Dobbelsteyn, C.; Joffres, M.; MacLean, D.R.; Flowerdew, G. A comparative evaluation of waist circumference, waist-to-hip ratio and body mass index as indicators of cardiovascular risk factors. The Canadian heart health surveys. Int. J. Obes. 2001, 25, 652–661. [Google Scholar] [CrossRef] [PubMed]
- Hsieh, S.; Yoshinaga, H.; Muto, T. Waist-to-height ratio, a simple and practical index for assessing central fat distribution and metabolic risk in Japanese men and women. Int. J. Obes. 2003, 27, 610–616. [Google Scholar] [CrossRef] [PubMed] [Green Version]
SNP ID | Location and Base Change | Forward Primer Reverse Primer | PCR Product Size (bp) | Restriction Enzyme | RFLP Products (bp) |
---|---|---|---|---|---|
rs266729 | Promoter * region (G/A) | ACTGTGGAGATGATATCTGG CATTTTGACAGCTACCTTGG | 412 | Hha1 | GG: 170, 243 AG: 170, 243, 412 AA: 412 |
rs1501299 | Intron 2 * (G/T) | TGACCAGGAAACCACGACTC CCATCTACACTCATCCTTGG | 341 | BsmI | GG: 229, 112 GT: 341, 229, 112 TT: 341 |
rs2241766 | Exon 2 * (T/G) | AGTAGACTCTGCTGAGATGG ACATTCTTACCTGGATCTCC | 333 | BspH1 | TT: 153, 180 TG: 333, 153, 180 GG: 333 |
Variable | Control (n = 130) | Prediabetes (n = 130) | p-Value 1 |
---|---|---|---|
Gender (n) (%) | |||
Males | 53 (41%) | 75 (58%) | |
Females | 77 (59%) | 55 (42%) | 0.0064 |
Age (years) | 53.24 ± 10.79 2 | 50.82 ± 8.73 | 0.0482 |
BMI 3 (kg/m2) | 29.62 ± 5.24 | 33.15 ± 6.26 | <0.0001 |
WC 4 (cm) | 101.70 ± 12.78 | 113.40 ± 13.46 | <0.0001 |
Glucose (mg/dL) | 86.81 ± 11.36 | 118.90 ± 19.78 | <0.0001 |
Cholesterol (mg/dL) | 183.90 ± 39.99 | 185.40 ± 42.32 | 0.7640 |
Triglycerides (mg/dL) | 145.10 ± 114.46 | 153.40 ± 84.43 | 0.5080 |
Adiponectin (µg/mL) | 4.66 ± 2.35 | 3.64 ± 1.49 | <0.0001 |
SNP ID | p-Value |
---|---|
rs266729 | 0.71 |
rs1501299 | 0.13 |
rs2241766 | <0.0001 |
SNP ID | Genotype | Control n (%) | Prediabetes n (%) | p-Value 1 |
---|---|---|---|---|
rs266729 | A/A | 76 (58.5%) | 88 (67.7%) | 0.110 |
A/G | 45 (34.6%) | 39 (30%) | ||
G/G | 9 (6.9%) | 3 (2.3%) | ||
rs1501299 | G/G | 61 (46.9%) | 43 (33.1%) | 0.041 |
G/T | 60 (46.1%) | 70 (53.9%) | ||
T/T | 9 (6.9%) | 17 (13.1%) |
SNP ID | Allele | Control n (%) | Prediabetes n (%) | p-Value 1 |
---|---|---|---|---|
rs266729 | A | 197 (76%) | 215 (83%) | 0.0517 |
G | 63 (24%) | 45 (17%) | ||
rs1501299 | G | 182 (70%) | 156 (33.1%) | 0.0168 |
T | 78 (30%) | 104 (53.9%) |
Variable | OR 1 | 95% CI 2 | p-Value 3 |
---|---|---|---|
Age (years) | 0.961 | 0.931–0.992 | 0.013 |
WC (cm) | 1.085 | 1.056–1.115 | <0.001 |
Adiponectin (μg/mL) | 0.764 | 0.646–0.905 | 0.002 |
rs1501299 | |||
GG | 1 | - | |
GT | 2.350 | 1.231–4.486 | 0.010 |
TT | 4.774 | 1.551–14.693 | 0.006 |
rs266729 | |||
GG | 1 | ||
AG | 1.417 | 0.248–8.104 | 0.695 |
AA | 1.912 | 0.344–10.612 | 0.459 |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Alfaqih, M.A.; Al-Mughales, F.; Al-Shboul, O.; Al Qudah, M.; Khader, Y.S.; Al-Jarrah, M. Association of Adiponectin and rs1501299 of the ADIPOQ Gene with Prediabetes in Jordan. Biomolecules 2018, 8, 117. https://doi.org/10.3390/biom8040117
Alfaqih MA, Al-Mughales F, Al-Shboul O, Al Qudah M, Khader YS, Al-Jarrah M. Association of Adiponectin and rs1501299 of the ADIPOQ Gene with Prediabetes in Jordan. Biomolecules. 2018; 8(4):117. https://doi.org/10.3390/biom8040117
Chicago/Turabian StyleAlfaqih, Mahmoud A., Faheem Al-Mughales, Othman Al-Shboul, Mohammad Al Qudah, Yousef S. Khader, and Muhammad Al-Jarrah. 2018. "Association of Adiponectin and rs1501299 of the ADIPOQ Gene with Prediabetes in Jordan" Biomolecules 8, no. 4: 117. https://doi.org/10.3390/biom8040117
APA StyleAlfaqih, M. A., Al-Mughales, F., Al-Shboul, O., Al Qudah, M., Khader, Y. S., & Al-Jarrah, M. (2018). Association of Adiponectin and rs1501299 of the ADIPOQ Gene with Prediabetes in Jordan. Biomolecules, 8(4), 117. https://doi.org/10.3390/biom8040117