Different Sources of Copper Effect on Intestinal Epithelial Cell: Toxicity, Oxidative Stress, and Metabolism
Abstract
1. Introduction
2. Materials and Methods
2.1. Reagents
2.2. Apparatus and Procedures
2.3. Cell Culture and Treatment
2.4. Cell Viability Assay
2.5. EdU Retention Assay
2.6. Determination of Copper Uptake
2.7. Measurement of ROS
2.8. Measurement of GSH and GSSG
2.9. Measurement of SOD Activity
2.10. Measurement of MDA Content
2.11. Quantitative Real-Time Polymerase Chain Reaction (RT-qPCR)
2.12. Western Blot Analysis
2.13. Statistical Analysis
3. Results
3.1. The Effects of Copper on Cell Viability
3.2. Copper Uptake in Cells
3.3. The Effects of Copper on Oxidative Stress and Antioxidant Activity
3.4. The mRNA Expression of CTR1, ATOX1, ATP7A, ASCT2, and PepT1 Genes
3.5. The Effects of Copper on CTR1 and PepT1 Protein Expression
4. Discussion
Author Contributions
Funding
Conflicts of Interest
References
- Thit, A.; Selck, H.; Bjerregaard, H.F. Toxic mechanisms of copper oxide nanoparticles in epithelial kidney cells. Toxicol. In Vitro 2015, 29, 1053–1059. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, J.; Zhu, X.; Guo, Y.; Wang, Z.; Zhao, B.; Yin, Y.; Liu, G. Influence of Dietary Copper on Serum Growth-Related Hormone Levels and Growth Performance of Weanling Pigs. Biol. Trace Elem. Res. 2016, 172, 134–139. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shelton, N.W.; Tokach, M.D.; Nelssen, J.L.; Goodband, R.D.; Dritz, S.S.; DeRouchey, J.M.; Hill, G.M. Effects of copper sulfate, tri-basic copper chloride, and zinc oxide on weanling pig performance. J. Anim. Sci. 2011, 89, 2440–2451. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sanchez, W.; Palluel, O.; Meunier, L.; Coquery, M.; Porcher, J.M.; Ait-Aissa, S. Copper-induced oxidative stress in three-spined stickleback: Relationship with hepatic metal levels. Env. Toxicol. Pharm. 2005, 19, 177–183. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fuentealba, I.; Haywood, S.; Foster, J. Cellular mechanisms of toxicity and tolerance in the copper-loaded rat. II. Pathogenesis of copper toxicity in the liver. Exp. Mol. Pathol. 1989, 50, 26–37. [Google Scholar] [CrossRef] [Scilit]
- Announcement of the Ministry of Agriculture and Rural Affairs of the People’s Republic of China No. 2625; Ministry of Agriculture and Rural Affairs of the People’s Republic of China: Beijing, China, 2018.
- European Community Council Regulation No. 1039/2018; Official Journal of the European Union: Brussels, Belgium, 2018.
- Huang, Y.L.; Ashwell, M.S.; Fry, R.S.; Lloyd, K.E.; Flowers, W.L.; Spears, J.W. Effect of dietary copper amount and source on copper metabolism and oxidative stress of weanling pigs in short-term feeding. J. Anim. Sci. 2015, 93, 2948–2955. [Google Scholar] [CrossRef] [Scilit]
- Gaetke, L.M.; Chow, C.K. Copper toxicity, oxidative stress, and antioxidant nutrients. Toxicology 2003, 189, 147–163. [Google Scholar] [CrossRef] [Scilit]
- Arnal, N.; Astiz, M.; de Alaniz, M.J.T.; Marra, C.A. Clinical parameters and biomarkers of oxidative stress in agricultural workers who applied copper-based pesticides. Ecotox. Environ. Saf. 2011, 74, 1779–1786. [Google Scholar] [CrossRef] [Scilit]
- Jomova, K.; Baros, S.; Valko, M. Redox active metal-induced oxidative stress in biological systems. Transit. Metal. Chem. 2012, 37, 127–134. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Ma, Y.L.; Zhao, J.M.; Vazquez-Anon, M.; Stein, H.H. Stein. Digestibility and retention of zinc, copper, manganese, iron, calcium, and phosphorus in pigs fed diets containing inorganic or organic minerals. J. Anim. Sci. 2014, 92, 3407–3415. [Google Scholar] [CrossRef] [Scilit]
- Huang, Y.; Yoo, J.S.; Kim, H.J.; Wang, Y.; Chen, Y.J.; Cho, J.H.; Kim, I.H. The Effects of Different Copper (Inorganic and Organic) and Energy (Tallow and Glycerol) Sources on Growth Performance, Nutrient Digestibility, and Fecal Excretion Profiles in Growing Pigs. Asian. Austral. J. Anim. 2010, 23, 573–579. [Google Scholar] [CrossRef] [Scilit]
- Kim, B.; Nevitt, T.; Thiele, D.J. Mechanisms for copper acquisition, distribution and regulation. Nat. Chem. Biol. 2008, 4, 176–185. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brandao Pereira, T.C.; Campos, M.M.; Bogo, M.R. Copper toxicology, oxidative stress and inflammation using zebrafish as experimental model. J. Appl. Toxicol. 2016, 36, 876–885. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- La Fontaine, S.; Mercer, J.F.B. Trafficking of the copper-ATPases, ATP7A and ATP7B: Role in copper homeostasis. Arch. Biochem. Biophys. 2007, 463, 149–167. [Google Scholar] [CrossRef] [Scilit]
- Keenan, J.; O’Sullivan, F.; Henry, M.; Breen, L.; Doolan, P.; Sinkunaite, L.; Meleady, P.; Clynes, M.; Horgan, K.; Murphy, R. Acute exposure to organic and inorganic sources of copper: Differential response in intestinal cell lines. Food. Sci. Nutr. 2018, 6, 2499–2514. [Google Scholar] [CrossRef] [Scilit]
- Sampels, S.; Kroupova, H.K.; Linhartova, P. Effect of cadmium on uptake of iron, zinc and copper and mRNA expression of metallothioneins in HepG2 cells in vitro. Toxicol. In Vitro 2017, 44, 372–376. [Google Scholar] [CrossRef] [Scilit]
- Blahova, L.; Kohoutek, J.; Lebedova, J.; Blaha, L.; Vecera, Z.; Buchtova, M.; Misek, I.; Hilscherova, K. Simultaneous determination of reduced and oxidized glutathione in tissues by a novel liquid chromatography-mass spectrometry method: Application in an inhalation study of Cd nanoparticles. Anal. Bioanal. Chem. 2014, 406, 5867–5876. [Google Scholar] [CrossRef] [Scilit]
- Nzengue, Y.; Steiman, R.; Rachidi, W.; Favier, A.; Guiraud, P. Oxidative stress induced by cadmium in the C6 cell line: Role of copper and zinc. Biol. Trace Elem. Res. 2012, 146, 410–419. [Google Scholar] [CrossRef] [Scilit]
- Ren, H.; Meng, Q.; Yepuri, N.; Du, X.; Sarpong, J.O.; Cooney, R.N. Protective effects of glutathione on oxidative injury induced by hydrogen peroxide in intestinal epithelial cells. J. Surg. Res. 2018, 222, 39–47. [Google Scholar] [CrossRef] [Scilit]
- Johnson, F.; Giulivi, C. Superoxide dismutases and their impact upon human health. Mol. Aspects. Med. 2005, 26, 340–352. [Google Scholar] [CrossRef] [Scilit]
- Abreu, I.A.; Cabelli, D.E. Superoxide dismutases-a review of the metal-associated mechanistic variations. Biochim. Biophys. Acta 2010, 1804, 263–274. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gaetke, L.M.; Chow, H.S.; Chow, C.K. Copper: Toxicological relevance and mechanisms. Arch. Toxicol. 2014, 88, 1929–1938. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Banerjee, B.D.; Seth, V.; Bhattacharya, A.; Pasha, S.T.; Chakraborty, A.K. Biochemical effects of some pesticides on lipid peroxidation and free-radical scavengers. Toxicol. Lett. 1999, 107, 33–47. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Chen, J.; Tang, Z.; Li, Y.; Hu, L.; Pan, J. The Effects of Copper on Brain Microvascular Endothelial Cells and Claudin via Apoptosis and Oxidative Stress. Biol. Trace Elem. Res. 2016, 174, 132–141. [Google Scholar] [CrossRef] [Scilit]
- Yang, F.; Pei, R.N.; Zhang, Z.W.; Liao, J.Z. Copper induces oxidative stress and apoptosis through mitochondria mediated pathway in chicken hepatocytes. Toxicol. In Vitro 2019, 54, 310–316. [Google Scholar] [CrossRef] [Scilit]
- Husain, N.; Mahmood, R. Copper (II) generates ROS and RNS, impairs antioxidant system and damages membrane and DNA in human blood cells. Environ. Sci. Pollut. Res. 2019, 26, 20654–20668. [Google Scholar] [CrossRef] [Scilit]
- Prohaska, J.R. Role of copper transporters in copper homeostasis. Am. J. Clin. Nutr. 2008, 88, 826S–829S. [Google Scholar] [CrossRef] [Scilit]
- Kuo, M.T.; Fu, S.; Savaraj, N.; Chen, H.H.W. Role of the Human High-Affinity Copper Transporter in Copper Homeostasis Regulation and Cisplatin Sensitivity in Cancer Chemotherapy. Cancer Res. 2012, 72, 4616–4621. [Google Scholar] [CrossRef] [Scilit]
- Nose, Y.; Kim, B.; Thiele, D.J. Ctr1 drives intestinal copper absorption and is essential for growth, iron metabolism, and neonatal cardiac function. Cell. Metab. 2006, 4, 235–244. [Google Scholar] [CrossRef] [Scilit]
- Safaei, R. Role of copper transporters in the uptake and efflux of platinum containing drugs. Cancer Lett. 2006, 234, 34–39. [Google Scholar] [CrossRef] [Scilit]
- Vest, K.E.; Paskavitz, A.L.; Lee, J.B.; Padilla-Benavides, T. Dynamic changes in copper homeostasis and post-transcriptional regulation of Atp7a during myogenic differentiation. Metallomics 2018, 10, 309–322. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, J.; Prohaska, J.R.; Thiele, D.J. Essential role for mammalian copper transporter Ctr1 in copper homeostasis and embryonic development. Proc. Natl. Acad. Sci. 2001, 98, 6842–6847. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ashida, K.; Katsura, T.; Motohashi, H.; Saito, H.; Inui, K. Thyroid hormone regulates the activity and expression of the peptide transporter PEPT1 in Caco-2 cells. Am. J. Physiol. Gastrointest. Liver. Physiol. 2002, 282, G617–G623. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Buddington, R.K.; Elnif, J.; Puchal-Gardiner, A.A.; Sangild, P.T. Intestinal apical amino acid absorption during development of the pig. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2001, 280, R241–R247. [Google Scholar] [CrossRef] [Scilit]
- Cheng, J.; Luo, Z.; Chen, G.H.; Wei, C.C.; Zhuo, M.Q. Identification of eight copper (Cu) uptake related genes from yellow catfish Pelteobagrus fulvidraco, and their tissue expression and transcriptional responses to dietborne Cu exposure. J. Trace. Elem. Med. Biol. 2017, 44, 256–265. [Google Scholar] [CrossRef] [Scilit]
- Liao, Z.; Guan, W.T.; Chen, F.; Hou, D.X.; Wang, C.; Lv, Y.T.; Qiao, H.Z.; Chen, J.; Han, J.H. Ferrous bisglycinate increased iron transportation through DMT1 and PepT1 in pig intestinal epithelial cells compared with ferrous sulphate. J. Anim. Feed. Sci. 2014, 23, 153–159. [Google Scholar] [CrossRef] [Scilit]









| Name | GenBank Accession No. | Primer Sequence (5′-3′) | Product Size (bp) |
|---|---|---|---|
| β-actin | AJ312193.1 | F:GGATGCAGAAGGAGATCACG | 130 |
| R:ATCTGCTGGAAGGTGGACAG | |||
| CTR1 | AF320815.2 | F:CTGGACCAAATGGAACTATCC | 107 |
| R:CTGATGACCACCTGGATGATA | |||
| ATOX1 | NC_010458.4 | F:CCGAAGCACGAGTTCTCC | 109 |
| R:TGTTGGGCAGGTCAATGTC | |||
| ASCT2 | DQ231578.1 | F:CAAGATTGTGGAGATGGAGGAT | 132 |
| R:TTGCGAGTGAAGAGGAAGTAGAT | |||
| PepT1 | AY180903.1 | F:CCCAGGCTTGCTACCCAC | 144 |
| R:ACCCGATGCACTTGACGA | |||
| ATP7A | AY011428.1 | F:GGCTGCTTCATCTGTTTCAGTA | 100 |
| R:TTTCTGTCCCATCTGGCTT |
| Copper Sources | GSH (nM/mg) | GSSG (nM/mg) | GSH/GSSG |
|---|---|---|---|
| Control | 1.35 ± 0.15 a | 0.028 ± 0.003 a | 47.53 ± 0.11 a |
| 30 μM CuSO4 | 0.94 ± 0.09 b | 0.091 ± 0.03 b | 12.68 ± 1.33 b |
| 30 μM Cu-Gly | 0.99 ± 0.12 b | 0.043 ± 0.008 c | 22.02 ± 0.84 cd |
| 30 μM Cu-Pro | 0.72 ± 0.08 b | 0.038 ± 0.007 ac | 19.76 ± 1.08 c |
| 120 μM CuSO4 | 0.74 ± 0.08 b | 0.056 ± 0.011 cd | 14.81 ± 0.65 b |
| 120 μM Cu-Gly | 0.82 ± 0.07 b | 0.037 ± 0.006 ac | 22.05 ± 1.33 c |
| 120 μM Cu-Pro | 0.84 ± 0.05 b | 0.032 ± 0.004 ac | 24.63 ± 0.46 d |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, R.; Wen, Y.; Lin, G.; Meng, C.; He, P.; Wang, F. Different Sources of Copper Effect on Intestinal Epithelial Cell: Toxicity, Oxidative Stress, and Metabolism. Metabolites 2020, 10, 11. https://doi.org/10.3390/metabo10010011
Li R, Wen Y, Lin G, Meng C, He P, Wang F. Different Sources of Copper Effect on Intestinal Epithelial Cell: Toxicity, Oxidative Stress, and Metabolism. Metabolites. 2020; 10(1):11. https://doi.org/10.3390/metabo10010011
Chicago/Turabian StyleLi, Runxian, Yang Wen, Gang Lin, Chengzhen Meng, Pingli He, and Fenglai Wang. 2020. "Different Sources of Copper Effect on Intestinal Epithelial Cell: Toxicity, Oxidative Stress, and Metabolism" Metabolites 10, no. 1: 11. https://doi.org/10.3390/metabo10010011
APA StyleLi, R., Wen, Y., Lin, G., Meng, C., He, P., & Wang, F. (2020). Different Sources of Copper Effect on Intestinal Epithelial Cell: Toxicity, Oxidative Stress, and Metabolism. Metabolites, 10(1), 11. https://doi.org/10.3390/metabo10010011
