Decoding Microbiome’s Role in Prostate Cancer Progression and Treatment Response
Abstract
1. Introduction
2. Gut Microbiome and Prostate Cancer: Emerging Evidence and Therapeutic Implications
3. Beyond the Gut: Exploring Microbial Signatures in Urine, Feces, Seminal Fluid, and Prostatic Secretions in Prostate Cancer
4. Intratumoral and Intraprostatic Microbiome: Emerging Roles in Prostate Cancer Pathogenesis
5. Mycobiome’s Role: Emerging Insights into Prostate Cancer
6. Virome
7. Discussion
8. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| BPH | Benign prostatic hyperplasia |
| CI | Confidence interval |
| CRPC | Castration-resistant prostate cancer |
| EPS | Expressed prostatic secretion |
| FMT | Fecal microbiota transplantation |
| NGS | Next-generation sequencing |
| OTU | Operational taxonomic unit |
| PCR | Polymerase chain reaction |
| PSA | Prostate-specific antigen |
| TNM | Tumor–node–metastasis classification |
References
- Naghavi, M.; Ong, K.; Aali, A.; Ababneh, H.; Abate, Y.; Abbafati, C.; Abbasgholizadeh, R.; Abbasian, M.; Abbasi-Kangevari, M.; Abbastabar, H.; et al. Global burden of 288 causes of death and life expectancy decomposition in 204 countries and territories and 811 subnational locations, 1990–2021: A systematic analysis for the Global Burden of Disease Study 2021. Lancet 2024, 403, 2100–2132. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ferrari, A.J.; Santomauro, D.; Aali, A.; Abate, Y.; Abbafati, C.; Abbastabar, H.; Abd ElHafeez, S.; Abdelmasseh, M.; Abd-Elsalam, S.; Abdollahi, A.; et al. Global incidence, prevalence, years lived with disability (YLDs), disability-adjusted life-years (DALYs), and healthy life expectancy (HALE) for 371 diseases and injuries in 204 countries and territories and 811 subnational locations, 1990–2021: A systematic analysis for the Global Burden of Disease Study 2021. Lancet 2024, 403, 2133–2161. [Google Scholar] [CrossRef] [Scilit]
- Siegel, R.L.; Giaquinto, A.N.; Jemal, A. Cancer statistics, 2024. CA Cancer J. Clin. 2024, 74, 12–49. [Google Scholar] [CrossRef] [Scilit]
- Sakellakis, M.; Flores, L.; Ramachandran, S. Patterns of indolence in prostate cancer. Exp. Ther. Med. 2022, 23, 351. [Google Scholar] [CrossRef] [Scilit]
- Hamdy, F.C.; Donovan, J.; Lane, J.; Mason, M.; Metcalfe, C.; Holding, P.; Davis, M.; Peters, T.; Turner, E.; Martin, R.; et al. 10-Year Outcomes after Monitoring, Surgery, or Radiotherapy for Localized Prostate Cancer. N. Engl. J. Med. 2016, 375, 1415–1424. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wolfe, A.J.; Brubaker, L. Sterile Urine and the Presence of Bacteria. Eur. Urol. 2015, 68, 173–174. [Google Scholar] [CrossRef] [Scilit]
- Meares, E.M., Jr. Bacterial prostatitis vs ‘prostatosis’. A clinical and bacteriological study. JAMA 1973, 224, 1372–1375. [Google Scholar] [CrossRef] [Scilit]
- Yan, L.; Chen, Y.; Chen, F.; Tao, T.; Hu, Z.; Wang, J.; You, J.; Wong, B.; Chen, J.; Ye, W. Effect of Helicobacter pylori Eradication on Gastric Cancer Prevention: Updated Report from a Randomized Controlled Trial With 26.5 Years of Follow-up. Gastroenterology 2022, 163, 154–162.e3. [Google Scholar] [CrossRef] [Scilit]
- Boumaza, A.; Azzouz, E.B.; Arrindell, J.; Lepidi, H.; Mezouar, S.; Desnues, B. Whipple’s disease and Tropheryma whipplei infections: From bench to bedside. Lancet Infect. Dis. 2022, 22, e280–e291. [Google Scholar] [CrossRef] [Scilit]
- Schiffman, M.; Doorbar, J.; Wentzensen, N.; De Sanjosé, S.; Fakhry, C.; Monk, B.; Stanley, M.; Franceschi, S. Carcinogenic human papillomavirus infection. Nat. Rev. Dis. Primers 2016, 2, 16086. [Google Scholar] [CrossRef] [Scilit]
- Lin, Y.; Mao, Q.; Zheng, X.; Yang, K.; Chen, H.; Zhou, C.; Xie, L. Human papillomavirus 16 or 18 infection and prostate cancer risk: A meta-analysis. Ir. J. Med. Sci. 2011, 180, 497–503. [Google Scholar] [CrossRef] [Scilit]
- Deng, R.; Zheng, H.; Cai, H.; Li, M.; Shi, Y.; Ding, S. Effects of helicobacter pylori on tumor microenvironment and immunotherapy responses. Front. Immunol. 2022, 13, 923477. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sepich-Poore, G.D.; Zitvogel, L.; Straussman, R.; Hasty, J.; Wargo, J.A.; Knight, R. The microbiome and human cancer. Science 2021, 371, eabc4552. [Google Scholar] [CrossRef] [Scilit]
- Chen, G.; Ren, Q.; Zhong, Z.; Li, Q.; Huang, Z.; Zhang, C.; Yuan, H.; Feng, Z.; Chen, B.; Wang, N.; et al. Exploring the gut microbiome’s role in colorectal cancer: Diagnostic and prognostic implications. Front. Immunol. 2024, 15, 1431747. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ağagündüz, D.; Cocozza, E.; Cemali, Ö.; Bayazıt, A.; Nanì, M.; Cerqua, I.; Morgillo, F.; Saygılı, S.; Berni, C.R.; Amero, P.; et al. Understanding the role of the gut microbiome in gastrointestinal cancer: A review. Front. Pharmacol. 2023, 14, 1130562. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hong, W.; Huang, G.; Wang, D.; Xu, Y.; Qiu, J.; Pei, B.; Qian, D.; Meng, X. Gut microbiome causal impacts on the prognosis of breast cancer: A Mendelian randomization study. BMC Genom. 2023, 24, 497. [Google Scholar] [CrossRef] [Scilit]
- Wiertsema, S.P.; van Bergenhenegouwen, J.; Garssen, J.; Knippels, L.M.J. The interplay between the gut microbiome and the immune system in the context of infectious diseases throughout life and the role of nutrition in optimizing treatment strategies. Nutrients 2021, 13, 886. [Google Scholar] [CrossRef] [Scilit]
- Dizman, N.; Meza, L.; Bergerot, P.; Alcantara, M.; Dorff, T.; Lyou, Y.; Frankel, P.; Cui, Y.; Mira, V.; Llamas, M.; et al. Nivolumab plus ipilimumab with or without live bacterial supplementation in metastatic renal cell carcinoma: A randomized phase 1 trial. Nat. Med. 2022, 28, 704–712. [Google Scholar] [CrossRef] [Scilit]
- Wang, I.; Song, L.; Wang, B.Y.; Kalebasty, A.R.; Uchio, E.; Zi, X. Prostate Cancer Immunotherapy: A Review of Recent Advancements with Novel Treatment Methods and Efficacy. Am. J. Clin. Exp. Urol. 2022, 10, 210–233. Available online: www.ajceu.us/ (accessed on 15 August 2022).
- Javier-DesLoges, J.; McKay, R.R.; Swafford, A.D.; Sepich-Poore, G.D.; Knight, R.; Parsons, J.K. The microbiome and prostate cancer. Prostate Cancer Prostatic Dis. 2022, 25, 159–164. [Google Scholar] [CrossRef] [Scilit]
- Golombos, D.A.; Ayangbesan, A.; O’Malley, P.; Lewicki, P.; Barlow, L.; Barbieri, C.; Chan, C.; DuLong, C.; Abu-Ali, G.; Huttenhower, C.; et al. The Role of Gut Microbiome in the Pathogenesis of Prostate Cancer: A Prospective, Pilot Study. Urology 2018, 111, 122–128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Parsaei, M.; Sarafraz, N.; Moaddab, S.Y.; Leylabadlo, H.E. The importance of Faecalibacterium prausnitzii in human health and diseases. New Microbes New Infect. 2021, 43, 100928. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lu, H.; Xu, X.; Fu, D.; Gu, Y.; Fan, R.; Yi, H.; He, X.; Wang, C.; Ouyang, B.; Zhao, P.; et al. Butyrate-producing Eubacterium rectale suppresses lymphomagenesis by alleviating the TNF-induced TLR4/MyD88/NF-κB axis. Cell Host Microbe 2022, 30, 1139–1150.e7. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, Y.; Jiang, H. Compositional differences of gut microbiome in matched hormone-sensitive and castration-resistant prostate cancer. Transl. Androl. Urol. 2020, 9, 1937–1944. [Google Scholar] [CrossRef] [Scilit]
- Wang, T.; Ahmad, S.; Cruz-Lebrón, A.; Ernst, S.E.; Olivos Caicedo, K.Y.; Jeong, Y.; Binion, B.; Mbuvi, P.; Dutta, D.; Francelys, V.; et al. An expanded metabolic pathway for androgen production by commensal bacteria. Nat. Res. 2025, 10, 1084–1098. [Google Scholar] [CrossRef] [Scilit]
- Pernigoni, N.; Zagato, E.; Calcinotto, A.; Troiani, M.; Mestre, R.P.; Calì, B.; Attanasio, G.; Troisi, J.; Minini, M.; Mosole, S.; et al. Commensal bacteria promote endocrine resistance in prostate cancer through androgen biosynthesis. Science 2021, 374, 216–224. [Google Scholar] [CrossRef] [Scilit]
- Alanee, S.; El-Zawahry, A.; Dynda, D.; Dabaja, A.; McVary, K.; Karr, M.; Braundmeier-Fleming, A. A prospective study to examine the association of the urinary and fecal microbiota with prostate cancer diagnosis after transrectal biopsy of the prostate using 16sRNA gene analysis. Prostate 2019, 79, 81–87. [Google Scholar] [CrossRef] [Scilit]
- Yu, H.; Meng, H.; Zhou, F.; Ni, X.; Shen, S.; Das, U.N. Urinary microbiota in patients with prostate cancer and benign prostatic hyperplasia. Arch. Med. Sci. 2015, 11, 385–394. [Google Scholar] [CrossRef] [Scilit]
- Vacca, M.; Celano, G.; Calabrese, F.M.; Portincasa, P.; Gobbetti, M.; De Angelis, M. The controversial role of human gut lachnospiraceae. Microorganisms 2020, 8, 573. [Google Scholar] [CrossRef] [Scilit]
- Shrestha, E.; White, J.; Yu, S.; Kulac, I.; Ertunc, O.; De Marzo, A.; Yegnasubramanian, S.; Mangold, L.; Partin, A.; Sfanos, K. Profiling the Urinary Microbiome in Men with Positive versus Negative Biopsies for Prostate Cancer. J. Urol. 2018, 199, 161–171. [Google Scholar] [CrossRef] [Scilit]
- Hurst, R.; Meader, E.; Gihawi, A.; Rallapalli, G.; Clark, J.; Kay, G.; Webb, M.; Manley, K.; Curley, H.; Walker, H.; et al. Microbiomes of Urine and the Prostate Are Linked to Human Prostate Cancer Risk Groups. Eur. Urol. Oncol. 2022, 5, 412–419. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gonçalves, M.; Pina-Vaz, T.; Fernandes, Â.; Miranda, I.; Silva, C.; Rodrigues, A.; Lisboa, C. Microbiota of Urine, Glans and Prostate Biopsies in Patients with Prostate Cancer Reveals a Dysbiosis in the Genitourinary System. Cancers 2023, 15, 1423. [Google Scholar] [CrossRef] [Scilit]
- Liss, M.; White, J.; Goros, M.; Gelfond, J.; Leach, R.; Johnson-Pais, T.; Lai, Z.; Rourke, E.; Basler, J.; Ankerst, D.; et al. Metabolic Biosynthesis Pathways Identified from Fecal Microbiome Associated with Prostate Cancer. Eur. Urol. Oncol. 2022, 5, 412–419. [Google Scholar] [CrossRef] [Scilit]
- Mjaess, G.; Karam, A.; Roumeguère, T.; Diamand, R.; Aoun, F.; McVary, K.; Moul, J.W.; De Nunzio, C.; Albisinni, S. Urinary microbiota and prostatic diseases: The key for the lock? A systematic review. Prostate Cancer Prostatic Dis. 2023, 26, 451–460. [Google Scholar] [CrossRef] [Scilit]
- Ma, J.; Gnanasekar, A.; Lee, A.; Li, W.; Haas, M.; Wang-Rodriguez, J.; Chang, E.; Rajasekaran, M.; Ongkeko, W. Influence of intratumor microbiome on clinical outcome and immune processes in prostate cancer. Cancers 2020, 12, 2524. [Google Scholar] [CrossRef] [Scilit]
- Wood, L.M.; Guirnalda, P.D.; Seavey, M.M.; Paterson, Y. Cancer immunotherapy using Listeria monocytogenes and listerial virulence factors. Immunol. Res. 2008, 42, 233–245. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Feng, Y.; Jaratlerdsiri, W.; Patrick, S.; Lyons, R.; Haynes, A.; Collins, C.; Stricker, P.; Bornman, M.; Hayes, V. Metagenomic analysis reveals a rich bacterial content in high-risk prostate tumors from African men. Prostate 2019, 79, 1731–1738. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sfanos, K.S.; Sauvageot, J.; Fedor, H.L.; Dick, J.D.; De Marzo, A.M.; Isaacs, W.B. A molecular analysis of prokaryotic and viral DNA sequences in prostate tissue from patients with prostate cancer indicates the presence of multiple and diverse microorganisms. Prostate 2008, 68, 306–320. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Keay, S.; Zhang, C.-O.; Baldwin, B.R.; Alexander, R.B. Polymerase Chain Reaction Amplification of Bacterial 16s rRNA Genes in Prostate Biopsies from Men Without Chronic Prostatitis. Urology 1999, 53, 487–491. [Google Scholar] [CrossRef] [Scilit]
- Krieger, J.N.; Riley, D.E.; Vesella, R.L.; Miner, D.C.; Ross, S.O.; Lange, P.H. Bacterial DNA Sequences in Prostate Tissue from Patients with Prostate Cancer and Chronic Prostatitis. J. Urol. 2000, 164, 1221–1228. [Google Scholar] [CrossRef] [Scilit]
- Hochreiter, W.W.; Duncan, J.L.; Schaeffer, A.J. Evaluation of the Bacterial Flora of the Prostate Using a 16S rRNA Gene Based Polymerase Chain Reaction. J. Urol. 2000, 163, 127–130. [Google Scholar] [CrossRef] [Scilit]
- Alexeyev, O.; Bergh, J.; Marklund, I.; Thellenberg-Karlsson, C.; Wiklund, F.; Grönberg, H.; Bergh, A.; Elgh, F. Association between the presence of bacterial 16S RNA in prostate specimens taken during transurethral resection of prostate and subsequent risk of prostate cancer (Sweden). Cancer Causes Control 2006, 17, 1127–1133. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cavarretta, I.; Ferrarese, R.; Cazzaniga, W.; Saita, D.; Lucianò, R.; Ceresola, E.; Locatelli, I.; Visconti, L.; Lavorgna, G.; Briganti, A.; et al. The Microbiome of the Prostate Tumor Microenvironment. Eur. Urol. 2017, 72, 625–631. [Google Scholar] [CrossRef] [Scilit]
- Davidsson, S.; Mölling, P.; Rider, J.; Unemo, M.; Karlsson, M.; Carlsson, J.; Andersson, S.; Elgh, F.; Söderquis, B.; Andrén, O. Frequency and typing of Propionibacterium acnes in prostate tissue obtained from men with and without prostate cancer. Infect. Agents Cancer 2016, 11, 26. [Google Scholar] [CrossRef] [Scilit]
- Yow, M.; Tabrizi, S.; Severi, G.; Bolton, D.; Pedersen, J.; Giles, G.; Southey, M. Characterisation of microbial communities within aggressive prostate cancer tissues. Infect. Agents Cancer 2017, 12, 4. [Google Scholar] [CrossRef] [Scilit]
- Chen, Y.; Wei, J. Identification of pathogen signatures in prostate cancer using RNA-seq. PLoS ONE 2015, 10, e0128955. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Feng, Y.; Ramnarine, V.; Bell, R.; Volik, S.; Davicioni, E.; Hayes, V.; Ren, S.; Collins, C. Metagenomic and metatranscriptomic analysis of human prostate microbiota from patients with prostate cancer. BMC Genom. 2019, 20, 146. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alluri, L.; Paes Batista da Silva, A.; Verma, S.; Fu, P.; Shen, D.; MacLennan, G.; Gupta, S.; Bissada, N. Presence of Specific Periodontal Pathogens in Prostate Gland Diagnosed with Chronic Inflammation and Adenocarcinoma. Cureus 2021, 13, e17742. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Banerjee, S.; Alwine, J.C.; Wei, Z.; Tian, T.; Shih, N.; Sperling, C.; Guzzo, T.; Feldman, M.D.; Robertson, E.S. Microbiome signatures in prostate cancer. Carcinogenesis 2019, 40, 749–764. [Google Scholar] [CrossRef] [Scilit]
- Miyake, M.; Ohnishi, K.; Hori, S.; Nakano, A.; Nakano, R.; Yano, H.; Ohnishi, S.; Owari, T.; Morizawa, Y.; Itami, Y.; et al. Mycoplasma genitalium infection and chronic inflammation in human prostate cancer: Detection using prostatectomy and needle biopsy specimens. Cells 2019, 8, 212. [Google Scholar] [CrossRef] [Scilit]
- Salachan, P.V.; Rasmussen, M.; Fredsøe, J.; Ulhøi, B.; Borre, M.; Sørensen, K.D. Microbiota of the prostate tumor environment investigated by whole-transcriptome profiling. Genome Med. 2022, 14, 9. [Google Scholar] [CrossRef] [Scilit]
- Sarkar, P.; Malik, S.; Banerjee, A.; Datta, C.; Pal, D.; Ghosh, A.; Saha, A. Differential Microbial Signature Associated with Benign Prostatic Hyperplasia and Prostate Cancer. Front. Cell. Infect. Microbiol. 2022, 12, 894777. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Zhou, Z.; Turner, D.; Lilly, M.; Ou, T.; Jiang, W. Differential Circulating Fungal Microbiome in Prostate Cancer Patients Compared to Healthy Control Individuals. J. Immunol. Res. 2022, 2022, 2574964. [Google Scholar] [CrossRef] [Scilit]
- Abidi, S.H.; Bilwani, F.; Ghias, K.; Abbas, F. Viral etiology of prostate cancer: Genetic alterations and immune response. A literature review. Int. J. Surg. 2018, 52, 136–140. [Google Scholar] [CrossRef] [Scilit]
- Ahmed, M.S.; Salman, N.; Sandhu, S.; Cakir, M.; Seddon, A.; Kuehne, C.; Ashrafi, G. Detection of high-risk Human Papillomavirus in prostate cancer from a UK based population. Sci. Rep. 2023, 13, 7633. [Google Scholar] [CrossRef] [Scilit]
- Michopoulou, V.D.; Derdas, S.; Symvoulakis, E.; Mourmouras, N.; Nomikos, A.; Delakas, D.; Sourvinos, G.; Spandidos, D. Detection of human papillomavirus (HPV) DNA prevalence and p53 codon 72 (Arg72Pro) polymorphism in prostate cancer in a Greek group of patients. Tumor Biol. 2014, 35, 12765–12773. [Google Scholar] [CrossRef] [Scilit]
- Singh, N.; Hussain, S.; Kakkar, N.; Singh, S.K.; Sobti, R.C.; Bharadwaj, M. Implication of high risk Human papillomavirus HR-HPV infection in prostate cancer in Indian population-A pioneering case-control analysis. Sci. Rep. 2015, 5, 7822. [Google Scholar] [CrossRef] [Scilit]
- Ge, X.; Wang, X.; Shen, P. Herpes simplex virus type 2 or human herpesvirus 8 infection and prostate cancer risk: A meta-analysis. Biomed. Rep. 2013, 1, 433–439. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Classon, J.; Stenudd, M.; Zamboni, M.; Alkass, K.; Eriksson, C.; Pedersen, L.; Schörling, A.; Thoss, A.; Bergh, A.; Wikström, P.; et al. Cytomegalovirus infection is common in prostate cancer and antiviral therapies inhibit progression in disease models. Mol. Oncol. 2025. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Keller, E.X.; Delbue, S.; Tognon, M.; Provenzano, M. Polyomavirus BK and prostate cancer: A complex interaction of potential clinical relevance. Rev. Med. Virol. 2015, 25, 366–378. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Silverman, R.H.; Nguyen, C.; Weight, C.J.; Klein, E.A. The human retrovirus XMRV in prostate cancer and chronic fatigue syndrome. Nat. Rev. Urol. 2010, 7, 392–402. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Leiros, G.J.; Galliano, S.R.; Sember, M.E.; Kahn, T.; Schwarz, E.; Eiguchi, K. Detection of human papillomavirus DNA and p53 codon 72 polymorphism in prostate carcinomas of patients from Argentina. BMC Urol. 2005, 5, 15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jensen, J.N.E.; Becker, G.L.; Jackson, J.B.; Rysavy, M.B. Human Papillomavirus and Associated Cancers: A Review. Viruses 2024, 16, 680. [Google Scholar] [CrossRef] [Scilit]
- Spence, A.R.; Rousseau, M.C.; Parent, M.É. Sexual partners, sexually transmitted infections, and prostate cancer risk. Cancer Epidemiol. 2014, 38, 700–707. [Google Scholar] [CrossRef] [Scilit]
- Sfanos, K.S.; Aloia, A.L.; De Marzo, A.M.; Rein, A. XMRV and prostate cancerg—A ‘final’ perspective. Nat. Rev. Urol. 2012, 9, 111–118. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Chen, Y.; Wang, J. Role of Tumor Microenvironment in Prostate Cancer Immunometabolism. Biomolecules 2025, 15, 826. [Google Scholar] [CrossRef] [Scilit]
- Martinez-Fierro, M.; Leach, R.; Gomez-Guerra, L.; Garza-Guajardo, R.; Johnson-Pais, T.; Beuten, J.; Morales-Rodriguez, I.; Hernandez-Ordoñez, M.; Calderon-Cardenas, G.; Ortiz-Lopez, R.; et al. Identification of Viral Infections in the Prostate and Evaluation of Their Association with Cancer. BMC Cancer 2010, 10, 326. [Google Scholar] [CrossRef] [Scilit]
- Thomas, R.M.; Jobin, C. The Microbiome and Cancer: Is the ‘Oncobiome’ Mirage Real? Trends Cancer 2015, 1, 24–35. [Google Scholar] [CrossRef] [Scilit]
- Hatakeyama, M. Helicobacter pylori CagA and gastric cancer: A paradigm for hit-and-run carcinogenesis. Cell Host Microbe 2014, 15, 306–316. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Q.; Liu, Z.; Ma, A.; Li, Z.; Liu, B.; Ma, Q. Computational methods and challenges in analyzing intratumoral microbiome data. Trends Microbiol. 2023, 31, 707–722. [Google Scholar] [CrossRef] [Scilit]

| Reference | Anatomical Site/Region | Experimental Platform | Type of Library (Amplicon-Based vs. Whole-Genome) | Region Amplified | Taxonomy Level |
|---|---|---|---|---|---|
| Golombos DM. et al. [21] | Gut | Illumina NextSeq | Whole-genome | Species | |
| Liu Y et al. [24] | Gut | Illumina MiSeq | Amplicon-based | 16S rRNA (V3–V4 region) | Genus |
| Alanee et al. [27] | Urine and fecal | Illumina MiSeq | Amplicon-based | 16S rRNA (V3–V5) | Species |
| Shrestha E. et al. [30] | Urine | Illumina HiSeq | Amplicon-based | 16S rRNA (V6) | Species |
| Hurst R. et al. [31] | Urine | Illumina MiSeq | Whole-genome | Species | |
| Feng Y. et al. [37] | PCa tissue | Illumina HiSeq | Whole-genome | Genus | |
| O. Alexeyev et al. [42] | PCa tissue | Cycle sequencing (Applied Biosystems) | Amplicon-based | 16S rRNA | Species |
| Cavarretta I. et al. [43] | PCa tissue | Pyrosequencing | Amplicon-based | 16S rRNA (V3–V5) | Species |
| Yow MA et al. [45] | PCa tissue | Illumina MiSeq | Amplicon-based | 16S rRNA (V2–V3 and V4) | Species |
| Feng Y. et al. [47] | PCa tissue | Illumina HiSeq | Whole-genome | Genus | |
| Wang X. et al. [49,53] | Plasma | sequenced by MR DNA (Shallowater, TX, USA). | Amplicon-based | fungal ITS sequence | Species |
| Banerjee S, et al. [49] | PCa tissue | sequenced by TransPlex (Sigma-Aldrich, St. Louis, MO, USA) | Whole-genome and transcriptome amplification | Genus/species | |
| Chen Y. et al. [46] | PCa tissue | Illumina mRNA-seq | Whole genome | Species | |
| Gonçalves et al. [32] | Urine, glans, PCa tissue | Illumina MiSeq | Amplicon-based | 16S rRNA (V3–V4) | Genus |
| Salachan et al. [51] | PCa tissue | Illumina NovaSeq or NextSeq 500. | Whole-transcriptome profiling | Species | |
| Sarkar et al. [52] | Prostate (BPH & PCa) | Ion GeneStudio S5 System | Amplicon-based | 16S rRNA | Species |
| Reference | Target Region | PCR Type | Primers | Region Amplified | Taxonomy Level |
|---|---|---|---|---|---|
| Yu H et al. [28] | Prostatic secretions, urine, and seminal fluid | Conventional PCR and qPCR | 41F: 5′-GTATTACCGCGGCTGCTGG-3′; 534R: 5′-ACTCCTACGGGAGGCAGCAG-3′ with a 40-bp GC clamp: 5′CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGG3′ | 16S rRNA (V3) | Species |
| VS8F: 5′-GGCGGATTAGACTTCGGCTA-3′, VS9R: 5′-CGTTTTGGCACTATTTGCCC-3′ | E. coli | ||||
| Ent1F: 5′-TACTGACAAACCATTCATGATG-3′, Ent2R: 5′-AACTTCGTCACCAACGCGAAC-3′ | Enterococcus | ||||
| Shrestha E. et al. [30] | Urine | qPCR Real-time PCR | F: 5′-GCGTGAGTGACGGTAATGGGTA-3′ R: 5′-TTCCGACGCGATCAACCA-3′. | P. acnes | Species |
| F: 5′-CATTGATAACGAAGCTCTTTACGAT-3′ R: 5′-GCATGTTGTGCCGGACATAACCAT-3′ | T. vaginalis | ||||
| Hurst R. et al. [31] | Urine | qPCR | F: 5′-GCGAACAAACGTCAAGGAAC-3′ R: 5′-GCCTTTCCATTGAGGGCTTC-3′ | Fenollaria sp. | Species |
| F: 5′-CACCGAAGACCAAGGCGTTA-3′ R: 5′-GGTGCCGACCGTAGAAACTT-3′ | Peptoniphilus sp. | ||||
| F: 5′-GCGTTGATGAAGCCCTCTCTAT-3′ R: 5′-ACCTTTAGCCTTAGGACGGAA-3′ | Peptoniphilus harei | ||||
| F: 5′-CGCTCGCAAACAGGTTGAAT-3′ R: 5′-GGGCAGCATTTTCCGAAGC-3′ | Varibaculum sp. | ||||
| F: 5′-CGATCATACCTGGACGAGCC-3′ R: 5′-TCGGCTACATACGTGGTTGG-3′ | Porphyromonas asaccharolytica | ||||
| F: 5′-TCTGAATGGGCAGTTGAAGGA-3′ R: 5-AGCTTCCCCTCCTTCTTTCTT-3′ | Fusobacterium nucleatum | ||||
| F: 5′-ATGAGCCCGATGAAGGTTCG-3′ R: 5′-CTACCGCAGAGGCAACTACC-3′ | Propionimicrobium lymphophilum | ||||
| F: 5′-GGATGACCTTGGTGGGGTAG-3′ R: 5-CACACAAATGGTGGTCACGG-3′ | Cutibacterium acnes | ||||
| Sfanos et al. [38] | PCa tissue | Conventional PCR | 1E 5′-TCAAATGAATTGACGGGGGC-3′ 13B 5′-AGGCCCGGGAACGTATTCAC-3′ | 16S rDNA | Species |
| Conventional PCR | CtMOMP-F: 5′-CCTGTGGGGAATCCTGCTGAA-3′ CtMOMP-R: 5′-GTCGAAAACAAAGTCACCATAGTA-3′ | C. trachomatis | Species | ||
| PA-F 5′-GGGTTGTAAACCGCTTTCGCTG-3′ PA-R 5′-GGCACACCCATCTCTGAGCAC-3′ | P. acnes | ||||
| BTUB9-F 5′-CATTGATAACGAAGCTCTTTACGAT-3′ BTUB2-R 5′-GCATGTTGTGCCGGACATAACCAT-3′ | T. vaginalis | ||||
| Nested PCR | BKV-F 5′-TTTTGGAACCTGGAGTAGCTCAGAGGTTT-3′ BKV-R 5′-GCTTGACTAAGAAACTGGTGTAGAT-3′ BKVnes-F (nes) 5′-CCTCTTTGCCCAGATACCCTGTACT-3′ BKVnes-R(nes) 5′-GAGAATCTGCTGTTGCTTCTTCATC-3′ | BKV | |||
| Conventional PCR | EBV-EBER-F 5′-CCCTAGTGGTTTCGGACACA-3′ EBV-EBER-R 5′-ACTTGCAAATGCTCTAGGCG-3′ | EBV | |||
| CMVpp65-375-F 5′-CATCAACGTGCACCACTACC-3′ CMVpp65-562-R 5′-ACACGAACGCTGACGTGTAG-3′ | CMV | ||||
| GP5+-F 5′-TTTGTTACTGTGGTAGATACTAC-3′ GP6+-R 5′-GAAAAATAAACTGTAAATCATATTC-3′ | HPV | ||||
| Nested PCR | GAG-O-F 5′-CGCGTCTGATTTGTTTTGTT-3′ GAG-O-R 5′-CCGCCTCTTCTTCATTGTTC-3′ GAG-I-F (nes) 5′-TCTCGAGATCATGGGACAGA-3′ GAG-I-R (nes) 5′-AGAGGGTAAGGGCAGGGTAA-3 | XMRV | |||
| Keay S. et al. [39] | PCa tissue | Conventional PCR and nested PCR | F: 5′-CACAAGCGGTGGAGCATGTGGTT-3′ R: 5′-CCTACGGYTACCTTGTTACCACT-3′, where Y equals C or T F: 5′-GGAATTCTGCAACGCGAAGAACCTTACCT-3′ R: 5′-GCGGATCCTGGTKTGACGGGCGGTGTGTA-3′, where K equals G or T | 16s rRNA | Species |
| Hochreiter W. et al. [41] | PCa tissue | Conventional PCR and nested PCR | 1492RPL: 5′-GGTTACCTTGTTACGACTT-3′ 8FPL: 5′-AGTTTGATCCTGGCTCAG-3′ 91E: 5′-TCAAAKGAATTGACGGGGGC-3′ 13B: 5′-AGGCCCGGGAACGTATTCAC-3′ | 16s rRNA | Genus |
| Alexeyev O. et al. [42] | PCa tissue | Conventional PCR and nested PCR | 16SFa: 5′-GCTCAGATTGAACGCTGG-3′ 16SFb: 5′-GCTCAGGAYGAACGCTGG-3′ 16SR: 5′-TACTGCTGCCTCCCGTA-3′ 16SFac: 5′-CAGATTGAACGCTGG-3′ 16SFbc: 5′-CAGGAYGAACGCTGG-3′ 16SRc:5′-TGCTGCCTCCCGTA-3′ | 16s rRNA | Species |
| Cavarretta I. et al. [43] | PCa tissue | Conventional PCR, nested PCR, and qPCR | 16S-F8: 5′-AGAGTTTGATCCTGGCTCAG-3′ 16S-R1093: 5′-GTTGCGCTCGTTGCGGGAC-3′ 16S-F331: 5′-ACT CCT ACG GGA GGC AGC-3′ 16S-R920: 5′-CCG TCA ATT CMT TTG AGT TT-3′ 926F: 5′-AAA CTC AAA KGA ATT GAC GG-3′ 1062R: 5′-CTC ACR RCA CGA GCT GAC-3′ | V3-V5 16s rRNA | Species |
| Alluri LSC, et al. [48] | Prostate Gland | Real-time qPCR | Commercially available website-integrated DNA technology (IDT) | Not specified | Species |
| Banerjee S, et al. [49] | PCa tissue | Conventional PCR | F: 5′-TAGGTGCCAACCTATGGAACAGA-3′ R: 5′-GGAAAGTCTTTAGGGTCTTCTACC-3′ | Polyomavirus FP | Genus /species |
| F: 5′-TACCAGTGGAATGTTCTACCNCARGGN-3′ R: 5′-ATCAGATCCTACTAACDRTCRTCCATRTA-3′ | Retrovirus FP | ||||
| F: 5′-CCAGACGGCAAGGTTTTTATCC-3′ R: 5′-TTGAGCTCTAGGCACGTTA-3′ | KSHV FP | ||||
| F: 5′-AGT AGT GTT GCA GCA CTA TAT TGG-3′ R: 5′-ATG CCC ATT GTA CCA TTT CTG AC-3′ | HPV18_E1 FP | ||||
| F: 5′-ACC ATT ATC CCC ATA CAA CAA TG-3′ R: 5′-CTC TTG GTG ATA TGG AAA TGT TGG-3 | Helicobacter cagA FP | ||||
| F: 5′-GCG AAT CCT TTT AAA GCC GGT CTC-3′ R: 5′-TGT TAC CGA CTT TCA TGA CGT G-3′ | Mycobacterium FP | ||||
| F: 5′-TCG TTA CCT GTG TTA GCC AGA G-3′ R: 5′-TCC TTA GAC TCA TAC AGA TAT GCC-3′ | Schistosoma FP | ||||
| F: 5′-TGT GAC CAA AGC AGT CAT TCG-3′ R: 5′-GTG TGT ATG TGT GTG GAA TAA CC-3′ | Trypanosoma FP | ||||
| F: 5′-TTC AGA AGG AAG TAC CAG TAG G-3′ R: 5′-TGA TTG TGC AAA TCC GAA TCG AG-3′ | Trichosporon FP | ||||
| F: 5′-TGC GTT TGA ATA CTA CAG CAT GG-3′ R: 5′-CTT CGC AGT TGT TTG TCT CCA G-3′ | Plasmodium FP | ||||
| F: 5′-CAA GTG TCT GCC TTA TCA ACC TTC-3′ R: 5′-TGC CTT CCT TGG ATG TGG TAG-3′ | Trichinella FP | ||||
| F: 5′-GAT AGC CGT GTT AAT TCT ATG GC-3′ R: 5′-TCA GAA ACT TGA ATG ATC CAT CGC-3′ | Sarcocystis FP | ||||
| Miyake et al. [50] | PCa tissue | Conventional PCR | F: 5′-GCGACGTCATCGGTAAATACC-3′ R: 5′-CGCCATACGGACGATGGT-3′ | Neisseria gonorrhoeae | Genus |
| F: 5′-TGATGTATCCAGCCCAAATGC-3′ R: 5′-AATCCAGTTCTTCTCTGCCTCTCTAC-3′ | Chlamydia trachomatis | ||||
| F: 5′-GAGAAATACCTTGATGGTCAGCAA-3′ R: 5′-GTTAATATCATATAAAGCTCTACCGTTGTTATC-3′ | Mycoplasma genitalium (short amplicon) | ||||
| F: 5′-AGTTGATGAAACCTTAACCCCTTGG-3′ R: 5′-CCGTTGAGGGGTTTTCCATTTTTGC-3′ | Mycoplasma genitalium (long amplicon) | ||||
| F: 5′-GATCACATTTCCACTTATTTGAAACA-3′ R: 5′-AAACGACGTCCATAAGCAACTTTA-3 | Mycoplasma hyorhinis | ||||
| F: 5′-ACACCATGGGAGCTGGTAAT-3′ R: 5′-CTTCTCGACTTTCAGA-3′ | Ureaplasma urealyticum | ||||
| F: 5′-CACAGTTATGCACAGAGCTGC-3′ R: 5′-CATATATTCATGCAATGTAGGTGTA-3′ | HPV16 | ||||
| F: 5′-CACTTCACTGCAAGACATAGA-3′ R: 5′-GTTGTGAAATCGTCGTTTTTCA-3′ | HPV18 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sakellakis, M.; Resta, P.; Papagianni, E.; Procter, K.A.; Belouka, I.; Gioti, K.; Anthouli-Anagnostopoulou, F.; Chaniotis, D.; Beloukas, A. Decoding Microbiome’s Role in Prostate Cancer Progression and Treatment Response. Diseases 2025, 13, 294. https://doi.org/10.3390/diseases13090294
Sakellakis M, Resta P, Papagianni E, Procter KA, Belouka I, Gioti K, Anthouli-Anagnostopoulou F, Chaniotis D, Beloukas A. Decoding Microbiome’s Role in Prostate Cancer Progression and Treatment Response. Diseases. 2025; 13(9):294. https://doi.org/10.3390/diseases13090294
Chicago/Turabian StyleSakellakis, Minas, Panagiota Resta, Evangelia Papagianni, Kassandra A. Procter, Irene Belouka, Katerina Gioti, Fragkiski Anthouli-Anagnostopoulou, Dimitrios Chaniotis, and Apostolos Beloukas. 2025. "Decoding Microbiome’s Role in Prostate Cancer Progression and Treatment Response" Diseases 13, no. 9: 294. https://doi.org/10.3390/diseases13090294
APA StyleSakellakis, M., Resta, P., Papagianni, E., Procter, K. A., Belouka, I., Gioti, K., Anthouli-Anagnostopoulou, F., Chaniotis, D., & Beloukas, A. (2025). Decoding Microbiome’s Role in Prostate Cancer Progression and Treatment Response. Diseases, 13(9), 294. https://doi.org/10.3390/diseases13090294

