Exploring the Therapeutic Potential of Antibiotics in Hyperglycemia-Induced Macrophage Dysfunctions
Abstract
:1. Introduction
2. Results
2.1. Minimum Inhibitory Concentration (MIC) and Cytotoxicity of Antibiotics on Murine Macrophage Cell Line, RAW 264.7, Under Low and High Glucose Levels
2.2. The Effect of Antibiotics on Macrophage Phagocytosis Under High Glucose Levels
2.3. The Effect of Antibiotics on Macrophage Bactericidal Activity Under High Glucose Levels
2.4. The Effect of Antibiotics on mRNA Expression of Pro-Inflammatory Mediators Under High Glucose Levels
3. Discussion
4. Materials and Methods
4.1. Bacterial Culture
4.2. Macrophage Culture
4.3. Minimum Inhibitory Concentration Determination
4.4. MTT Assay
4.5. Macrophage Phagocytosis and Bacterial Killing Assay
4.6. Quantitative RT-PCR Analysis
4.7. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zhou, B.; Rayner, A.W.; Gregg, E.W.; Sheffer, K.E.; Carrillo-Larco, R.M.; Bennett, J.E.; Shaw, J.E.; Paciorek, C.J.; Singleton, R.K.; Barradas Pires, A.; et al. Worldwide trends in diabetes prevalence and treatment from 1990 to 2022: A pooled analysis of 1108 population-representative studies with 141 million participants. Lancet 2024, 404, 2077–2093. [Google Scholar] [CrossRef]
- Saeedi, P.; Petersohn, I.; Salpea, P.; Malanda, B.; Karuranga, S.; Unwin, N.; Colagiuri, S.; Guariguata, L.; Motala, A.A.; Ogurtsova, K.; et al. Global and regional diabetes prevalence estimates for 2019 and projections for 2030 and 2045: Results from the International Diabetes Federation Diabetes Atlas, 9th edition. Diabetes Res. Clin. Pract. 2019, 157, 107843. [Google Scholar] [CrossRef]
- Reynolds, L.; Luo, Z.; Singh, K. Diabetic complications and prospective immunotherapy. Front. Immunol. 2023, 14, 1219598. [Google Scholar] [CrossRef] [PubMed]
- Akash, M.S.H.; Rehman, K.; Fiayyaz, F.; Sabir, S.; Khurshid, M. Diabetes-associated infections: Development of antimicrobial resistance and possible treatment strategies. Arch. Microbiol. 2020, 202, 953–965. [Google Scholar] [CrossRef]
- Nagendra, L.; Boro, H.; Mannar, V. Bacterial Infections in Diabetes. In Endotext; Feingold, K.R., Anawalt, B., Blackman, M.R., Boyce, A., Chrousos, G., Corpas, E., de Herder, W.W., Dhatariya, K., Dungan, K., Hofland, J., et al., Eds.; MDText.com, Inc.: South Dartmouth, MA, USA, 2000. [Google Scholar]
- Carey, I.M.; Critchley, J.A.; DeWilde, S.; Harris, T.; Hosking, F.J.; Cook, D.G. Risk of Infection in Type 1 and Type 2 Diabetes Compared With the General Population: A Matched Cohort Study. Diabetes Care 2018, 41, 513–521. [Google Scholar] [CrossRef]
- Frydrych, L.M.; Fattahi, F.; He, K.; Ward, P.A.; Delano, M.J. Diabetes and Sepsis: Risk, Recurrence, and Ruination. Front. Endocrinol. 2017, 8, 271. [Google Scholar] [CrossRef] [PubMed]
- Louiselle, A.E.; Niemiec, S.M.; Zgheib, C.; Liechty, K.W. Macrophage polarization and diabetic wound healing. Transl. Res. 2021, 236, 109–116. [Google Scholar] [CrossRef] [PubMed]
- Atri, C.; Guerfali, F.Z.; Laouini, D. Role of Human Macrophage Polarization in Inflammation during Infectious Diseases. Int. J. Mol. Sci. 2018, 19, 1801. [Google Scholar] [CrossRef]
- Morey, M.; O’Gaora, P.; Pandit, A. Hyperglycemia acts in synergy with hypoxia to maintain the pro-inflammatory phenotype of macrophages. PLoS ONE 2019, 14, e0220577. [Google Scholar] [CrossRef]
- Pavlou, S.; Lindsay, J.; Ingram, R.; Xu, H.; Chen, M. Sustained high glucose exposure sensitizes macrophage responses to cytokine stimuli but reduces their phagocytic activity. BMC Microbiol. 2018, 19, 24. [Google Scholar] [CrossRef]
- Grosick, R.; Alvarado-Vazquez, P.A.; Messersmith, A.R.; Romero-Sandoval, E.A. High glucose induces a priming effect in macrophages and exacerbates the production of pro-inflammatory cytokines after a challenge. J. Pain Res. 2018, 11, 1769–1778. [Google Scholar] [CrossRef]
- Cosentino, F.; Hishikawa, K.; Katusic, Z.S.; Lüscher, T.F. High Glucose Increases Nitric Oxide Synthase Expression and Superoxide Anion Generation in Human Aortic Endothelial Cells. Circulation 1997, 96, 25–28. [Google Scholar] [CrossRef] [PubMed]
- Xu, F.; Zhang, C.; Graves, D.T. Abnormal Cell Responses and Role of TNF-α in Impaired Diabetic Wound Healing. BioMed Res. Int. 2013, 2013, 754802. [Google Scholar] [CrossRef] [PubMed]
- Restrepo, B.I.; Twahirwa, M.; Rahbar, M.H.; Schlesinger, L.S. Phagocytosis via complement or Fc-gamma receptors is compromised in monocytes from type 2 diabetes patients with chronic hyperglycemia. PLoS ONE 2014, 9, e92977. [Google Scholar] [CrossRef] [PubMed]
- Al-Ankari, A.S.; Homeida, A.M. Effect of antibacterial growth promoters on the immune system of broiler chicks. Vet. Immunol. Immunopathol. 1996, 53, 277–283. [Google Scholar] [CrossRef] [PubMed]
- Tafalla, C.; Novoa, B.; Alvarez, J.M.; Figueras, A. In vivo and in vitro effect of oxytetracycline treatment on the immune response of turbot, Scophthalmus maximus (L.). J. Fish Dis. 1999, 22, 271–276. [Google Scholar] [CrossRef]
- Majumdar, S.; Flasher, D.; Friend, D.S.; Nassos, P.; Yajko, D.; Hadley, W.K.; Düzgüneş, N. Efficacies of liposome-encapsulated streptomycin and ciprofloxacin against Mycobacterium avium-M. intracellulare complex infections in human peripheral blood monocyte/macrophages. Antimicrob. Agents Chemother. 1992, 36, 2808–2815. [Google Scholar] [CrossRef] [PubMed]
- Oh, Y.K.; Nix, D.E.; Straubinger, R.M. Formulation and efficacy of liposome-encapsulated antibiotics for therapy of intracellular Mycobacterium avium infection. Antimicrob. Agents Chemother. 1995, 39, 2104–2111. [Google Scholar] [CrossRef] [PubMed]
- Wong, J.P.; Schnell, G.; Simpson, M.; Saravolac, E. Effects of liposome-encapsulated ciprofloxacin on phagocytosis, nitric oxide and intracellular killing of Staphylcoccus aureus by murine macrophages. Artif. Cells Blood Substit. Immobil. Biotechnol. 2000, 28, 415–428. [Google Scholar] [CrossRef] [PubMed]
- Ekinci, B.; Coban, A.Y.; Birinci, A.; Durupinar, B.; Erturk, M. In vitro effects of cefotaxime and ceftriaxone on Salmonella typhi within human monocyte-derived macrophages. Clin. Microbiol. Infect. 2002, 8, 810–813. [Google Scholar] [CrossRef]
- Chang, H.R.; Vladoianu, I.R.; Pechère, J.C. Effects of ampicillin, ceftriaxone, chloramphenicol, pefloxacin and trimethoprim-sulphamethoxazole on Salmonella typhi within human monocyte-derived macrophages. J. Antimicrob. Chemother. 1990, 26, 689–694. [Google Scholar] [CrossRef] [PubMed]
- Khan, A.; Slifer, T.; Araujo, F.; Suzuki, Y.; Remington, J. Protection against Lipopolysaccharide-Induced Death by Fluoroquinolones. Antimicrob. Agents Chemother. 2000, 44, 3169–3173. [Google Scholar] [CrossRef] [PubMed]
- Djaldetti, M.; Nachmias, N.; Bessler, H. The effect of antibiotics on cytokine production by mononuclear cells and the cross- Talk with colon cancer cells. J. Pharm. Pharmacogn. Res. 2016, 4, 134–143. [Google Scholar] [CrossRef]
- Dubar, V.; Lopez, I.; Gosset, P.; Aerts, C.; Voisin, C.; Wallaert, B. The penetration of co-trimoxazole into alveolar macrophages and its effect on inflammatory and immunoregulatory functions. J. Antimicrob. Chemother. 1990, 26, 791–802. [Google Scholar] [CrossRef]
- Giovagnoni, G.; Perry, F.; Tugnoli, B.; Piva, A.; Grilli, E.; Arsenault, R.J. A Comparison of the Immunometabolic Effect of Antibiotics and Plant Extracts in a Chicken Macrophage-like Cell Line during a Salmonella Enteritidis Challenge. Antibiotics 2023, 12, 357. [Google Scholar] [CrossRef]
- Kazemzadeh, G.; Ravari, H.; Nabavizadeh, M.; Pasban-Noghabi, S. Evaluating the Effects of Spraying Oxytetracycline on Diabetic Foot Ulcers: A Randomized Clinical Trial. Zahedan J. Res. Med. Sci. 2021, in press. [CrossRef]
- CLSI 2020; Performance Standards for Antimicrobial Susceptibility Testing, 30th ed. CLSI Supplement M100; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2020; 294p.
- Yamada, M.; Suzuki, M.; Noguchi, T.; Yokosawa, T.; Sekiguchi, Y.; Mutoh, N.; Toyama, T.; Hirata, Y.; Hwang, G.-W.; Matsuzawa, A. The Antibiotic Cefotaxime Works as Both an Activator of Nrf2 and an Inducer of HSP70 in Mammalian Cells. BPB Rep. 2020, 3, 16–21. [Google Scholar] [CrossRef]
- Bodaghabadi, N.; Hajigholami, S.; Vaise Malekshahi, Z.; Entezari, M.; Najafi, F.; Shirzad, H.; Sadeghizadeh, M. Preparation and Evaluation of Rifampicin and Co-trimoxazole-loaded Nanocarrier against Brucella melitensis Infection. Iran Biomed. J. 2018, 22, 275–282. [Google Scholar] [CrossRef] [PubMed]
- Isa, T.; Zakaria, Z.A.; Rukayadi, Y.; Mohd Hezmee, M.N.; Jaji, A.Z.; Imam, M.U.; Hammadi, N.I.; Mahmood, S.K. Antibacterial Activity of Ciprofloxacin-Encapsulated Cockle Shells Calcium Carbonate (Aragonite) Nanoparticles and Its Biocompatability in Macrophage J774A.1. Int. J. Mol. Sci. 2016, 17, 713. [Google Scholar] [CrossRef] [PubMed]
- Matera, G.; Berlinghieri, M.C.; Foti, F.; Barreca, G.S.; Focà, A. Effect of RO 23-9424, cefotaxime and fleroxacin on functions of human polymorphonuclear cells and cytokine production by human monocytes. J. Antimicrob. Chemother. 1996, 38, 799–807. [Google Scholar] [CrossRef] [PubMed]
- Vanholder, R.; Dagrosa, E.E.; Van Landschoot, N.; Waterloos, M.A.; Ringoir, S.M. Antibiotics and energy delivery to the phagocytosis-associated respiratory burst in chronic hemodialysis patients: A comparison of cefodizime and cotrimoxazole. Nephron 1993, 63, 65–72. [Google Scholar] [CrossRef] [PubMed]
- Labro, M.T. Interference of antibacterial agents with phagocyte functions: Immunomodulation or “immuno-fairy tales”? Clin. Microbiol. Rev. 2000, 13, 615–650. [Google Scholar] [CrossRef]
- Bongers, S.; Hellebrekers, P.; Leenen, L.P.; Koenderman, L.; Hietbrink, F. Intracellular Penetration and Effects of Antibiotics on Staphylococcus aureus Inside Human Neutrophils: A Comprehensive Review. Antibiotics 2019, 8, 54. [Google Scholar] [CrossRef] [PubMed]
- Lang, L.; Zhang, Y.; Yang, A.; Dong, J.; Li, W.; Zhang, G. Macrophage polarization induced by quinolone antibiotics at environmental residue level. Int. Immunopharmacol. 2022, 106, 108596. [Google Scholar] [CrossRef] [PubMed]
- Uribe-Querol, E.; Rosales, C. Phagocytosis: Our Current Understanding of a Universal Biological Process. Front. Immunol. 2020, 11, 1066. [Google Scholar] [CrossRef] [PubMed]
- Yu, X.; Wu, Y.; Deng, M.; Liu, Y.; Wang, S.; He, X.; Allaire-Leung, M.; Wan, J.; Zou, Y.; Yang, C.; et al. Tetracycline antibiotics as PI3K inhibitors in the Nrf2-mediated regulation of antioxidative stress in zebrafish larvae. Chemosphere 2019, 226, 696–703. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Zhao, H.; Liu, Y.; Li, J.; Nie, X.; Huang, P.; Xing, M. Environmentally relevant concentration of sulfamethoxazole-induced oxidative stress-cascaded damages in the intestine of grass carp and the therapeutic application of exogenous lycopene. Environ. Pollut. 2021, 274, 116597. [Google Scholar] [CrossRef]
- Hu, Y.; Zhou, Y.; Hu, X.; Chen, Q.; Shi, Y.; Zhuang, J.; Wang, Q. Cefotaxime sodium inhibited melanogenesis in B16F10 cells by cAMP/PKA/CREB pathways. Process Biochem. 2021, 110, 63–70. [Google Scholar] [CrossRef]
- Varma, S.; Lal, B.K.; Zheng, R.; Breslin, J.W.; Saito, S.; Pappas, P.J.; Hobson, R.W.; Durán, W.N. Hyperglycemia alters PI3k and Akt signaling and leads to endothelial cell proliferative dysfunction. Am. J. Physiol. Heart Circ. Physiol. 2005, 289, H1744–H1751. [Google Scholar] [CrossRef]
- Huang, X.; Liu, G.; Guo, J.; Su, Z. The PI3K/AKT pathway in obesity and type 2 diabetes. Int. J. Biol. Sci. 2018, 14, 1483–1496. [Google Scholar] [CrossRef]
- Pechkovsky, D.V.; Potapnev, M.P.; Zalutskaya, O.M. Different patterns of cytokine regulation of phagocytosis and bacterial killing by human neutrophils. Int. J. Antimicrob. Agents 1996, 7, 33–40. [Google Scholar] [CrossRef] [PubMed]
- Kimball, A.; Schaller, M.; Joshi, A.; Davis, F.M.; denDekker, A.; Boniakowski, A.; Bermick, J.; Obi, A.; Moore, B.; Henke, P.K.; et al. Ly6C(Hi) Blood Monocyte/Macrophage Drive Chronic Inflammation and Impair Wound Healing in Diabetes Mellitus. Arterioscler. Thromb. Vasc. Biol. 2018, 38, 1102–1114. [Google Scholar] [CrossRef] [PubMed]
- Hirsch, T.; Spielmann, M.; Zuhaili, B.; Koehler, T.; Fossum, M.; Steinau, H.U.; Yao, F.; Steinstraesser, L.; Onderdonk, A.B.; Eriksson, E. Enhanced susceptibility to infections in a diabetic wound healing model. BMC Surg. 2008, 8, 5. [Google Scholar] [CrossRef] [PubMed]
- CLSI 2013; Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals, 4th ed. CLSI Document VET01-04; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2013; 80p.
- Kaneko, M.; Emoto, Y.; Emoto, M. A Simple, Reproducible, Inexpensive, Yet Old-Fashioned Method for Determining Phagocytic and Bactericidal Activities of Macrophages. Yonsei Med. J. 2016, 57, 283–290. [Google Scholar] [CrossRef]
- Srinontong, P.; Kathanya, J.; Juijaitong, P.; Soontonrote, K.; Aengwanich, W.; Wandee, J.; Peanparkdee, M.; Wu, Z. Morus alba L. Leaf Extract Exerts Anti-Inflammatory Effect on Paraquat-Exposed Macrophages. Trends Sci. 2022, 20, 6206. [Google Scholar] [CrossRef]
- Wu, Z.; Nagano, I.; Asano, K.; Takahashi, Y. Infection of non-encapsulated species of Trichinella ameliorates experimental autoimmune encephalomyelitis involving suppression of Th17 and Th1 response. Parasitol. Res. 2010, 107, 1173–1188. [Google Scholar] [CrossRef]
- Srinontong, P.; Wandee, J.; Aengwanich, W. Paraquat modulates immunological function in bone marrow-derived macrophages. Acta Vet. Hung. 2022. ahead of print. [Google Scholar] [CrossRef]
Antibiotics | Results of Minimum Inhibitory Concentration (MIC, μg/mL) * |
---|---|
Escherichia coli ATCC 25922 | |
Oxytetracycline (OTC) | 1 |
Ciprofloxacin (CIP) | 0.125 |
Sulfamethoxazole/trimethoprim (SXT) # | 0.125/2.375 |
Cefotaxime (CTX) | 0.03125 |
Gene | Forward | Reverse | References |
---|---|---|---|
IL-6 | TCCATCCAGTTGCCTTCTTG | CATTTCCACGATTTCCCAGAG | [49] |
TNF-α | TTGAGTGCCAATTCGATGATG | GAGGGCTTGTTGAGATGATGC | [49] |
IL-1β | GACGGACCCCAAAAGATGAAG | CTCCACAGCCACAATGAGTGA | [49] |
iNOS | TTTGTGCGAAGTGTCAGTGG | CCCTTTGTGCTGGGAGTCA | [50] |
GAPDH | GGCATTGTGGAAGGGCTCAT | GACACATTGGGGGTAGGAACAC | [49] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yossapol, M.; Srinontong, P.; Aengwanich, W.; Panil, M.; Somsup, S.; Odoi, J.O.; Wandee, J. Exploring the Therapeutic Potential of Antibiotics in Hyperglycemia-Induced Macrophage Dysfunctions. Antibiotics 2025, 14, 198. https://doi.org/10.3390/antibiotics14020198
Yossapol M, Srinontong P, Aengwanich W, Panil M, Somsup S, Odoi JO, Wandee J. Exploring the Therapeutic Potential of Antibiotics in Hyperglycemia-Induced Macrophage Dysfunctions. Antibiotics. 2025; 14(2):198. https://doi.org/10.3390/antibiotics14020198
Chicago/Turabian StyleYossapol, Montira, Piyarat Srinontong, Worapol Aengwanich, Monchaya Panil, Supissara Somsup, Justice Opare Odoi, and Jaroon Wandee. 2025. "Exploring the Therapeutic Potential of Antibiotics in Hyperglycemia-Induced Macrophage Dysfunctions" Antibiotics 14, no. 2: 198. https://doi.org/10.3390/antibiotics14020198
APA StyleYossapol, M., Srinontong, P., Aengwanich, W., Panil, M., Somsup, S., Odoi, J. O., & Wandee, J. (2025). Exploring the Therapeutic Potential of Antibiotics in Hyperglycemia-Induced Macrophage Dysfunctions. Antibiotics, 14(2), 198. https://doi.org/10.3390/antibiotics14020198