Overcoming Tumor Resistance to Oncolyticvaccinia Virus with Anti-PD-1-Based Combination Therapy by Inducing Antitumor Immunity in the Tumor Microenvironment
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. CVV Amplification and Purification
2.3. WST-1 Assay
2.4. Animal Experiments
2.5. Flow Cytometry and Immunophenotyping of Splenocytes
2.6. Hematoxylin and Eosin Staining, Immunohistochemistry, and Immunofluorescence Staining
2.7. Real-Time Polymerase Chain Reaction
2.8. Statistical Analysis
3. Results
3.1. Cytotoxicity of CVV in Various Cancer Cell Lines
3.2. Monotherapy and Combination Therapy of CVV and Anti-PD-1 and Their Therapeutic Efficacy
3.3. Responders and Nonresponders According to Tumor Burden
3.4. Prolonged Survival Due to CVV+Anti-PD-1 Combination Therapy
3.5. Simultaneous Combination Therapy Enhanced CD8+ PD-1+ T-Cell Infiltration in the TME
3.6. PD-1 and PD-L1 Expression in the TME and Its Correlation with Therapeutic Efficacy
3.7. M2 and M1 Polarization of TAMs in the TME
3.8. Activation of the Central Immune System by Simultaneous Combination Therapy
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Badrinath, N.; Heo, J.; Yoo, S.Y. Viruses as nanomedicine for cancer. Int. J. Nanomed. 2016, 11, 4835–4847. [Google Scholar]
- Kaufman, H.L.; Kohlhapp, F.J.; Zloza, A. Oncolytic viruses: A new class of immunotherapy drugs. Nat. Rev. Drug Discov. 2015, 14, 642–662. [Google Scholar] [CrossRef] [PubMed]
- Heo, J.; Reid, T.; Ruo, L.; Breitbach, C.J.; Rose, S.; Bloomston, M.; Cho, M.; Lim, H.Y.; Chung, H.C.; Kim, C.W.; et al. Randomized dose-finding clinical trial of oncolytic immunotherapeutic vaccinia jx-594 in liver cancer. Nat. Med. 2013, 19, 329–336. [Google Scholar] [CrossRef]
- Kim, J.H.; Oh, J.Y.; Park, B.H.; Lee, D.E.; Kim, J.S.; Park, H.E.; Roh, M.S.; Je, J.E.; Yoon, J.H.; Thorne, S.H.; et al. Systemic armed oncolytic and immunologic therapy for cancer with jx-594, a targeted poxvirus expressing gm-csf. Mol. Ther. 2006, 14, 361–370. [Google Scholar] [CrossRef] [PubMed]
- Park, B.-H.; Hwang, T.; Liu, T.-C.; Sze, D.Y.; Kim, J.-S.; Kwon, H.-C.; Oh, S.Y.; Han, S.-Y.; Yoon, J.-H.; Hong, S.-H.; et al. Use of a targeted oncolytic poxvirus, jx-594, in patients with refractory primary or metastatic liver cancer: A phase i trial. Lancet Oncol. 2008, 9, 533–542. [Google Scholar] [CrossRef]
- Park, S.H.; Breitbach, C.J.; Lee, J.; Park, J.O.; Lim, H.Y.; Kang, W.K.; Moon, A.; Mun, J.H.; Sommermann, E.M.; Maruri Avidal, L.; et al. Phase 1b trial of biweekly intravenous pexa-vec (jx-594), an oncolytic and immunotherapeutic vaccinia virus in colorectal cancer. Mol. Ther. 2015, 23, 1532–1540. [Google Scholar] [CrossRef]
- Wojton, J.; Kaur, B. Impact of tumor microenvironment on oncolytic viral therapy. Cytokine Growth Factor Rev. 2010, 21, 127–134. [Google Scholar] [CrossRef] [Green Version]
- Gajewski, T.F.; Schreiber, H.; Fu, Y.X. Innate and adaptive immune cells in the tumor microenvironment. Nat. Immunol. 2013, 14, 1014–1022. [Google Scholar] [CrossRef] [Green Version]
- Balkwill, F.R.; Capasso, M.; Hagemann, T. The tumor microenvironment at a glance. J. Cell. Sci. 2012, 125, 5591–5596. [Google Scholar] [CrossRef] [Green Version]
- Joyce, J.A.; Fearon, D.T. T cell exclusion, immune privilege, and the tumor microenvironment. Science 2015, 348, 74–80. [Google Scholar] [CrossRef] [Green Version]
- Ceeraz, S.; Nowak, E.C.; Noelle, R.J. B7 family checkpoint regulators in immune regulation and disease. Trends Immunol. 2013, 34, 556–563. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sharma, P.; Allison, J.P. The future of immune checkpoint therapy. Science 2015, 348, 56–61. [Google Scholar] [CrossRef] [PubMed]
- Makkouk, A.; Weiner, G.J. Cancer immunotherapy and breaking immune tolerance: New approaches to an old challenge. Cancer Res. 2015, 75, 5–10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sun, Y. Tumor microenvironment and cancer therapy resistance. Cancer Lett. 2016, 380, 205–215. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jenkins, R.W.; Barbie, D.A.; Flaherty, K.T. Mechanisms of resistance to immune checkpoint inhibitors. Br. J. Cancer 2018, 118, 9–16. [Google Scholar] [CrossRef] [Green Version]
- Buller, R.M.L.; Smith, G.L.; Cremer, K.; Notkins, A.; Moss, B. Decreased virulence of recombinant vaccinia virus expression vectors is associated with a thymidine kinase-negative phenotype. Nature 1985, 317, 813–815. [Google Scholar] [CrossRef]
- Heo, J.; Breitbach, C.J.; Moon, A.; Kim, C.W.; Patt, R.; Kim, M.K.; Lee, Y.K.; Oh, S.Y.; Woo, H.Y.; Parato, K.; et al. Sequential therapy with jx-594, a targeted oncolytic poxvirus, followed by sorafenib in hepatocellular carcinoma: Preclinical and clinical demonstration of combination efficacy. Mol. Ther. 2011, 19, 1170–1179. [Google Scholar] [CrossRef] [Green Version]
- Shen, Y.; Nemunaitis, J. Fighting cancer with vaccinia virus: Teaching new tricks to an old dog. Mol. Ther. 2005, 11, 180–195. [Google Scholar] [CrossRef]
- Guo, Z.S.; Lu, B.; Guo, Z.; Giehl, E.; Feist, M.; Dai, E.; Liu, W.; Storkus, W.J.; He, Y.; Liu, Z.; et al. Vaccinia virus-mediated cancer immunotherapy: Cancer vaccines and oncolytics. J. Immunother. Cancer 2019, 7, 6. [Google Scholar] [CrossRef]
- LaRocca, C.J.; Warner, S.G. Oncolytic viruses and checkpoint inhibitors: Combination therapy in clinical trials. Clin. Transl. Med. 2018, 7, 35. [Google Scholar] [CrossRef] [Green Version]
- Liu, Z.; Ravindranathan, R.; Kalinski, P.; Guo, Z.S.; Bartlett, D.L. Rational combination of oncolytic vaccinia virus and pd-l1 blockade works synergistically to enhance therapeutic efficacy. Nat. Commun. 2017, 8, 14754. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rojas, J.J.; Sampath, P.; Hou, W.; Thorne, S.H. Defining effective combinations of immune checkpoint blockade and oncolytic virotherapy. Clin. Cancer Res. 2015, 21, 5543–5551. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yoo, S.Y.; Bang, S.Y.; Jeong, S.N.; Kang, D.H.; Heo, J. A cancer-favoring oncolytic vaccinia virus shows enhanced suppression of stem-cell like colon cancer. Oncotarget 2016, 7, 16479–16489. [Google Scholar] [CrossRef] [PubMed]
- Badrinath, N.; Jeong, Y.I.; Woo, H.Y.; Bang, S.Y.; Kim, C.; Heo, J.; Kang, D.H.; Yoo, S.Y. Local delivery of a cancer-favoring oncolytic vaccinia virus via poly (lactic-co-glycolic acid) nanofiber for theranostic purposes. Int. J. Pharm. 2018, 552, 437–442. [Google Scholar] [CrossRef] [PubMed]
- Yoo, S.Y.; Badrinath, N.; Lee, H.L.; Heo, J.; Kang, D.H. A cancer-favoring, engineered vaccinia virus for cholangiocarcinoma. Cancers (Basel) 2019, 11, 1667. [Google Scholar] [CrossRef] [Green Version]
- Yoo, S.Y.; Jeong, S.N.; Kang, D.H.; Heo, J. Evolutionary cancer-favoring engineered vaccinia virus for metastatic hepatocellular carcinoma. Oncotarget 2017, 8, 71489–71499. [Google Scholar] [CrossRef] [Green Version]
- Lin, H.; Wei, S.; Hurt, E.M.; Green, M.D.; Zhao, L.; Vatan, L.; Szeliga, W.; Herbst, R.; Harms, P.W.; Fecher, L.A.; et al. Host expression of pd-l1 determines efficacy of pd-l1 pathway blockade-mediated tumor regression. J. Clin. Investig. 2018, 128, 805–815. [Google Scholar] [CrossRef] [Green Version]
- Tang, H.; Liang, Y.; Anders, R.A.; Taube, J.M.; Qiu, X.; Mulgaonkar, A.; Liu, X.; Harrington, S.M.; Guo, J.; Xin, Y.; et al. Pd-l1 on host cells is essential for pd-l1 blockade-mediated tumor regression. J. Clin. Investig. 2018, 128, 580–588. [Google Scholar] [CrossRef] [Green Version]
- Zamarin, D.; Ricca, J.M.; Sadekova, S.; Oseledchyk, A.; Yu, Y.; Blumenschein, W.M.; Wong, J.; Gigoux, M.; Merghoub, T.; Wolchok, J.D. Pd-l1 in tumor microenvironment mediates resistance to oncolytic immunotherapy. J. Clin. Investig. 2018, 128, 1413–1428. [Google Scholar] [CrossRef] [Green Version]
- Lau, J.; Cheung, J.; Navarro, A.; Lianoglou, S.; Haley, B.; Totpal, K.; Sanders, L.; Koeppen, H.; Caplazi, P.; McBride, J.; et al. Tumour and host cell pd-l1 is required to mediate suppression of anti-tumour immunity in mice. Nat. Commun. 2017, 8, 14572. [Google Scholar] [CrossRef]
- Kleinovink, J.W.; Marijt, K.A.; Schoonderwoerd, M.J.A.; van Hall, T.; Ossendorp, F.; Fransen, M.F. Pd-l1 expression on malignant cells is no prerequisite for checkpoint therapy. Oncoimmunology 2017, 6, e1294299. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.Q.; Xu, J.; Zhou, Z.G.; Jin, L.L.; Yu, X.J.; Xiao, G.; Lin, J.; Zhuang, S.M.; Zhang, Y.J.; Zheng, L. Expression patterns of programmed death ligand 1 correlate with different microenvironments and patient prognosis in hepatocellular carcinoma. Br. J. Cancer 2018, 119, 80–88. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Haabeth, O.A.W.; Blake, T.R.; McKinlay, C.J.; Tveita, A.A.; Sallets, A.; Waymouth, R.M.; Wender, P.A.; Levy, R. Local delivery of Ox40l, Cd80, and Cd86 mRNA kindles global anticancer immunity. Cancer Res. 2019, 79, 1624. [Google Scholar] [PubMed] [Green Version]
- Bak, S.P.; Barnkob, M.S.; Bai, A.; Higham, E.M.; Wittrup, K.D.; Chen, J. Differential requirement for cd70 and cd80/cd86 in dendritic cell-mediated activation of tumor-tolerized cd8 t cells. J. Immunol. 2012, 189, 1708–1716. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Eissa, I.R.; Bustos-Villalobos, I.; Ichinose, T.; Matsumura, S.; Naoe, Y.; Miyajima, N.; Morimoto, D.; Mukoyama, N.; Zhiwen, W.; Tanaka, M.; et al. The current status and future prospects of oncolytic viruses in clinical trials against melanoma, glioma, pancreatic, and breast cancers. Cancers (Basel) 2018, 10, 356. [Google Scholar] [CrossRef] [Green Version]
- Woller, N.; Gurlevik, E.; Fleischmann-Mundt, B.; Schumacher, A.; Knocke, S.; Kloos, A.M.; Saborowski, M.; Geffers, R.; Manns, M.P.; Wirth, T.C.; et al. Viral infection of tumors overcomes resistance to pd-1-immunotherapy by broadening neoantigenome-directed t-cell responses. Mol. Ther. 2015, 23, 1630–1640. [Google Scholar] [CrossRef] [Green Version]
- Ribas, A.; Dummer, R.; Puzanov, I.; VanderWalde, A.; Andtbacka, R.H.I.; Michielin, O.; Olszanski, A.J.; Malvehy, J.; Cebon, J.; Fernandez, E.; et al. Oncolytic virotherapy promotes intratumoral t cell infiltration and improves anti-pd-1 immunotherapy. Cell 2017, 170, 1109–1119 e1110. [Google Scholar] [CrossRef] [Green Version]
- Duraiswamy, J.; Kaluza, K.M.; Freeman, G.J.; Coukos, G. Dual blockade of pd-1 and ctla-4 combined with tumor vaccine effectively restores t-cell rejection function in tumors. Cancer Res. 2013, 73, 3591–3603. [Google Scholar] [CrossRef] [Green Version]
- Tumeh, P.C.; Harview, C.L.; Yearley, J.H.; Shintaku, I.P.; Taylor, E.J.; Robert, L.; Chmielowski, B.; Spasic, M.; Henry, G.; Ciobanu, V.; et al. Pd-1 blockade induces responses by inhibiting adaptive immune resistance. Nature 2014, 515, 568–571. [Google Scholar] [CrossRef]
- Gordon, S.R.; Maute, R.L.; Dulken, B.W.; Hutter, G.; George, B.M.; McCracken, M.N.; Gupta, R.; Tsai, J.M.; Sinha, R.; Corey, D.; et al. Pd-1 expression by tumour-associated macrophages inhibits phagocytosis and tumour immunity. Nature 2017, 545, 495–499. [Google Scholar] [CrossRef]
- Fernandez-Poma, S.M.; Salas-Benito, D.; Lozano, T.; Casares, N.; Riezu-Boj, J.I.; Mancheno, U.; Elizalde, E.; Alignani, D.; Zubeldia, N.; Otano, I.; et al. Expansion of tumor-infiltrating cd8(+) t cells expressing pd-1 improves the efficacy of adoptive t-cell therapy. Cancer Res. 2017, 77, 3672–3684. [Google Scholar] [CrossRef] [Green Version]
- Gros, A.; Robbins, P.F.; Yao, X.; Li, Y.F.; Turcotte, S.; Tran, E.; Wunderlich, J.R.; Mixon, A.; Farid, S.; Dudley, M.E.; et al. Pd-1 identifies the patient-specific cd8(+) tumor-reactive repertoire infiltrating human tumors. J. Clin. Investig. 2014, 124, 2246–2259. [Google Scholar] [CrossRef] [PubMed]
- Spitzer, M.H.; Carmi, Y.; Reticker-Flynn, N.E.; Kwek, S.S.; Madhireddy, D.; Martins, M.M.; Gherardini, P.F.; Prestwood, T.R.; Chabon, J.; Bendall, S.C.; et al. Systemic immunity is required for effective cancer immunotherapy. Cell 2017, 168, 487–502 e415. [Google Scholar] [CrossRef] [PubMed]
- Noguchi, T.; Ward, J.P.; Gubin, M.M.; Arthur, C.D.; Lee, S.H.; Hundal, J.; Selby, M.J.; Graziano, R.F.; Mardis, E.R.; Korman, A.J.; et al. Temporally distinct pd-l1 expression by tumor and host cells contributes to immune escape. Cancer Immunol. Res. 2017, 5, 106–117. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Juneja, V.R.; McGuire, K.A.; Manguso, R.T.; LaFleur, M.W.; Collins, N.; Haining, W.N.; Freeman, G.J.; Sharpe, A.H. Pd-l1 on tumor cells is sufficient for immune evasion in immunogenic tumors and inhibits cd8 t cell cytotoxicity. J. Exp. Med. 2017, 214, 895–904. [Google Scholar] [CrossRef]
- Tang, F.; Zheng, P. Tumor cells versus host immune cells: Whose pd-l1 contributes to pd-1/pd-l1 blockade mediated cancer immunotherapy? Cell Biosci. 2018, 8, 34. [Google Scholar] [CrossRef]
- Simon, S.; Labarriere, N. Pd-1 expression on tumor-specific t cells: Friend or foe for immunotherapy? Oncoimmunology 2017, 7, e1364828. [Google Scholar] [CrossRef]
- Xu, M.; Liu, M.; Du, X.; Li, S.; Li, H.; Li, X.; Li, Y.; Wang, Y.; Qin, Z.; Fu, Y.X.; et al. Intratumoral delivery of il-21 overcomes anti-her2/neu resistance through shifting tumor-associated macrophages from m2 to m1 phenotype. J. Immunol. 2015, 194, 4997–5006. [Google Scholar] [CrossRef] [Green Version]
- Driessens, G.; Kline, J.; Gajewski, T.F. Costimulatory and coinhibitory receptors in anti-tumor immunity. Immunol. Rev. 2009, 229, 126–144. [Google Scholar] [CrossRef]
- Hui, E.; Cheung, J.; Zhu, J.; Su, X.; Taylor, M.J.; Wallweber, H.A.; Sasmal, D.K.; Huang, J.; Kim, J.M.; Mellman, I.; et al. T cell costimulatory receptor cd28 is a primary target for pd-1-mediated inhibition. Science 2017, 355, 1428–1433. [Google Scholar] [CrossRef]
- Kamphorst, A.O.; Wieland, A.; Nasti, T.; Yang, S.; Zhang, R.; Barber, D.L.; Konieczny, B.T.; Daugherty, C.Z.; Koenig, L.; Yu, K.; et al. Rescue of exhausted cd8 t cells by pd-1-targeted therapies is cd28-dependent. Science 2017, 355, 1423–1427. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kowalsky, S.J.; Liu, Z.; Feist, M.; Berkey, S.E.; Ma, C.; Ravindranathan, R.; Dai, E.; Roy, E.J.; Guo, Z.S.; Bartlett, D.L. Superagonist il-15-armed oncolytic virus elicits potent antitumor immunity and therapy that are enhanced with pd-1 blockade. Mol. Ther. 2018, 26, 2476–2486. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, Z.; Ravindranathan, R.; Li, J.; Kalinski, P.; Guo, Z.S.; Bartlett, D.L. Cxcl11-armed oncolytic poxvirus elicits potent antitumor immunity and shows enhanced therapeutic efficacy. Oncoimmunology 2016, 5, e1091554. [Google Scholar] [CrossRef] [PubMed]
- Fend, L.; Remy-Ziller, C.; Foloppe, J.; Kempf, J.; Cochin, S.; Barraud, L.; Accart, N.; Erbs, P.; Fournel, S.; Préville, X. Oncolytic virotherapy with an armed vaccinia virus in an orthotopic model of renal carcinoma is associated with modification of the tumor microenvironment. Oncoimmunology 2016, 5, e1080414. [Google Scholar] [CrossRef] [Green Version]
- Matuszewska, K.; Santry, L.A.; Van Vloten, J.P.; AuYeung, A.W.; Major, P.P.; Lawler, J.; Wootton, S.K.; Bridle, B.W.; Petrik, J. Combining vascular normalization with an oncolytic virus enhances immunotherapy in a preclinical model of advanced-stage ovarian cancer. Clin. Cancer Res. 2019, 25, 1624–1638. [Google Scholar] [CrossRef] [Green Version]
Name * | Sequence (5′–3′) |
---|---|
Mouse CD8 Forward (mCD8a_F) | CAGAGACCAGAAGATTGTCG |
Mouse CD8 Reverse (mCD8a_R) | TGATCAAGGACAGCAGAAGG |
Mouse PD-1 Forward (mPD-1_F) | CACAGTGTCAGAGGGAGCAA |
Mouse PD-1 Reverse (mPD-1_R) | TTGGGCAGCTGTATGATCTG |
Mouse PD-L1 Forward (mPD-L1-F) | CGAATCACGCTGAAAGTCAA |
Mouse PD-L1 Reverse (mPD-L1-R) | GCTGGTCACATTGAGAAGCA |
Mouse CD86 Forward (mCD86-F) | GCCCATTTACAAAGGCTCAA |
Mouse CD86 Reverse (mCD86-R) | TGTTCCTGTCAAAGCTCGTG |
Mouse iNOS Forward (miNOS-F) | CTCACTGGGACAGCACAGAA |
Mouse iNOS Reverse (miNOS-R) | GGTCAAACTCTTGGGGTTCA |
Mouse Arg1 Forward (mArg1-F) | CGCCTTTCTCAAAAGGACAG |
Mouse Arg1 Reverse (mArg1-R) | ACAGACCGTGGGTTCTTCAC |
Mouse IL-10 Forward (mIL-10-F) | GCCTTATCGGAAATGATCCA |
Mouse IL-10 Reverse (mIL-10-R) | TTTTCACAGGGGAGAAATCG |
Mouse β-Actin Forward (BAT-Fw) | GTCCCTCACCCTCCCAAAAG |
Mouse β-Actin Reverse (BAT-Re) | GCTGCCTCAACACCTCAACCC |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yoo, S.Y.; Badrinath, N.; Jeong, S.-N.; Woo, H.Y.; Heo, J. Overcoming Tumor Resistance to Oncolyticvaccinia Virus with Anti-PD-1-Based Combination Therapy by Inducing Antitumor Immunity in the Tumor Microenvironment. Vaccines 2020, 8, 321. https://doi.org/10.3390/vaccines8020321
Yoo SY, Badrinath N, Jeong S-N, Woo HY, Heo J. Overcoming Tumor Resistance to Oncolyticvaccinia Virus with Anti-PD-1-Based Combination Therapy by Inducing Antitumor Immunity in the Tumor Microenvironment. Vaccines. 2020; 8(2):321. https://doi.org/10.3390/vaccines8020321
Chicago/Turabian StyleYoo, So Young, Narayanasamy Badrinath, Su-Nam Jeong, Hyun Young Woo, and Jeong Heo. 2020. "Overcoming Tumor Resistance to Oncolyticvaccinia Virus with Anti-PD-1-Based Combination Therapy by Inducing Antitumor Immunity in the Tumor Microenvironment" Vaccines 8, no. 2: 321. https://doi.org/10.3390/vaccines8020321