The Effect of Preventing Oxidative Stress and Its Mechanisms in the Extract from Sonchus brachyotus DC. Based on the Nrf2-Keap1-ARE Signaling Pathway
Abstract
:1. Introduction
2. Materials and Methods
2.1. Chemicals and Reagents
2.2. Plant Material
2.3. Extract Preparation
2.4. Cell Culture
2.5. Cell Experiments
2.6. Cell Survival Rate
2.7. Measurement of Oxidative Stress Biochemical Markers
2.8. Quantitative Real-Time PCR
2.9. Western Blot
2.10. Data Analysis
3. Results
3.1. Oxidative Stress Preventive Effect of SBE
3.2. Time–Effect Relationship of SBE Preventing Oxidative Stress
3.3. Effect of SBE on Nrf2 and Keap1 Expression
3.4. Effect of SBE on the Expression of Genes Downstream of the Antioxidant Pathway
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Roberts, C.K.; Sindhu, K.K. Oxidative stress and metabolic syndrome. Life Sci. 2009, 84, 705–712. [Google Scholar] [CrossRef]
- Diaz de Barboza, G.; Guizzardi, S.; Moine, L.; Tolosa de Talamoni, N. Oxidative stress, antioxidants and intestinal calcium absorption. World J. Gastroenterol. 2017, 23, 2841–2853. [Google Scholar] [CrossRef]
- Ushio-Fukai, M.; Ash, D.; Nagarkoti, S.; Belin de Chantemele, E.J.; Fulton, D.J.R.; Fukai, T. Interplay Between Reactive Oxygen/Reactive Nitrogen Species and Metabolism in Vascular Biology and Disease. Antioxid. Redox Signal. 2021, 34, 1319–1354. [Google Scholar] [CrossRef]
- Jayawardena, T.U.; Wang, L.; Sanjeewa, K.K.A.; Kang, S.I.; Lee, J.S.; Jeon, Y.J. Antioxidant Potential of Sulfated Polysaccharides from Padina boryana; Protective Effect against Oxidative Stress in In Vitro and In Vivo Zebrafish Model. Mar. Drugs 2020, 18, 212. [Google Scholar] [CrossRef]
- Prasad, S.; Gupta, S.C.; Tyagi, A.K. Reactive oxygen species (ROS) and cancer: Role of antioxidative nutraceuticals. Cancer Lett. 2017, 387, 95–105. [Google Scholar] [CrossRef]
- Zahari, A.; Ablat, A.; Sivasothy, Y.; Mohamad, J.; Choudhary, M.I.; Awang, K. In vitro antiplasmodial and antioxidant activities of bisbenzylisoquinoline alkaloids from Alseodaphne corneri Kosterm. Asian Pac. J. Trop. Med. 2016, 9, 328–332. [Google Scholar] [CrossRef]
- Ktari, N.; Bkhairia, I.; Nasri, R.; Ben Abdallah Kolsi, R.; Ben Slama-Ben Salem, R.; Ben Amara, I.; Zeghal, N.; Ben Salah, B.; Ben Salah, R.; Nasri, M. Zebra blenny protein hydrolysates as a source of bioactive peptides with prevention effect against oxidative dysfunctions and DNA damage in heart tissues of rats fed a cholesterol-rich diet. Food Res. Int. 2017, 100 Pt 1, 423–432. [Google Scholar] [CrossRef]
- Fiedor, J.; Burda, K. Potential Role of Carotenoids as Antioxidants in Human Health and Disease. Nutrients 2014, 6, 466–488. [Google Scholar] [CrossRef]
- Lu, C.C.; Wei, R.X.; Deng, D.H.; Luo, Z.Y.; Abdulai, M.; Liu, H.H.; Kang, B.; Hu, S.Q.; Li, L.; Xu, H.Y.; et al. Effect of different types of sugar on gut physiology and microbiota in overfed goose. Poult. Sci. 2021, 100, 101208. [Google Scholar] [CrossRef]
- Zhou, X.; Wang, W.; Wang, C.; Zheng, C.; Xu, X.; Ni, X.; Hu, S.; Cai, B.; Sun, L.; Shi, K.; et al. DPP4 Inhibitor Attenuates Severe Acute Pancreatitis-Associated Intestinal Inflammation via Nrf2 Signaling. Oxid. Med. Cell. Longev 2019, 2019, 6181754. [Google Scholar] [CrossRef]
- Ma, Y.; Xiong, Y.L.; Zhai, J.; Zhu, H.; Dziubla, T. Fractionation and evaluation of radical-scavenging peptides from in vitro digests of buckwheat protein. Food Chem. 2010, 118, 582–588. [Google Scholar] [CrossRef] [PubMed]
- Bhattacharyya, A.; Chattopadhyay, R.; Mitra, S.; Crowe, S.E. Oxidative stress: An essential factor in the pathogenesis of gastrointestinal mucosal diseases. Physiol. Rev. 2014, 94, 329–354. [Google Scholar] [CrossRef] [PubMed]
- Pérez, S.; Taléns-Visconti, R.; Rius-Pérez, S.; Finamor, I.; Sastre, J. Redox signaling in the gastrointestinal tract. Free Radic. Biol. Med. 2017, 104, 75–103. [Google Scholar]
- Kong, Y.; Olejar, K.J.; On, S.L.W.; Chelikani, V. The Potential of Lactobacillus spp. for Modulating Oxidative Stress in the Gastrointestinal Tract. Antioxidants 2020, 9, 610. [Google Scholar] [CrossRef]
- Wang, C.; Liu, J.; Su, Y.; Li, M.; Xie, X.; Su, J. Complete Chloroplast Genome Sequence of Sonchus brachyotus Helps to Elucidate Evolutionary Relationships with Related Species of Asteraceae. Biomed. Res. Int. 2021, 2021, 9410496. [Google Scholar] [CrossRef] [PubMed]
- Xia, D.Z.; Yu, X.F.; Zhu, Z.Y.; Zou, Z.D. Antioxidant and antibacterial activity of six edible wild plants (Sonchus spp.) in China. Nat. Prod. Res. 2011, 25, 1893–1901. [Google Scholar] [CrossRef] [PubMed]
- Pan, F.F.; Zhang, H.Y.; Li, X.M.; Yang, P.L.; Zhang, T.C.; Luo, X.G.; Ma, W.J. Effect of quality control on the total antioxidant capacity of the extract from Sonchus brachyotus DC. Int. J. Food Prop. 2018, 21, 1362–1370. [Google Scholar] [CrossRef]
- Yang, J.; Zhou, W.W.; Shi, D.D.; Pan, F.F.; Sun, W.W.; Yang, P.L.; Li, X.M. The Interaction between Oxidative Stress Biomarkers and Gut Microbiota in the Antioxidant Effects of Extracts from Sonchus brachyotus DC. in Oxazolone-Induced Intestinal Oxidative Stress in Adult Zebrafish. Antioxidants 2023, 12, 192. [Google Scholar] [CrossRef]
- Pan, F.F.; Li, X.M.; Zhang, H.Y.; Ma, W.J.; Yang, P.L. Optimization of Extracting Process of Total Alkaloids from Sonchus brachyotus DC. by Response Surface Method. Sci. Technol. Food Ind. 2018, 39, 194–199. [Google Scholar]
- Martinez, M.A.; Ares, I.; Martinez, M.; Lopez-Torres, B.; Maximiliano, J.E.; Rodriguez, J.L.; Martinez-Larranaga, M.R.; Anadon, A.; Peteiro, C.; Rubino, S.; et al. Brown marine algae Gongolaria baccata extract protects Caco-2 cells from oxidative stress induced by tert-butyl hydroperoxide. Food Chem. Toxicol. 2021, 156, 112460. [Google Scholar] [CrossRef]
- Hernandez-Valencia, J.; Garcia-Villa, E.; Arenas-Hernandez, A.; Garcia-Mena, J.; Diaz-Chavez, J.; Gariglio, P. Induction of p53 Phosphorylation at Serine 20 by Resveratrol Is Required to Activate p53 Target Genes, Restoring Apoptosis in MCF-7 Cells Resistant to Cisplatin. Nutrients 2018, 10, 1148. [Google Scholar] [CrossRef]
- Katsube, R.; Noma, K.; Ohara, T.; Nishiwaki, N.; Kobayashi, T.; Komoto, S.; Sato, H.; Kashima, H.; Kato, T.; Kikuchi, S.; et al. Fibroblast activation protein targeted near infrared photoimmunotherapy (NIR PIT) overcomes therapeutic resistance in human esophageal cancer. Sci. Rep. 2021, 11, 1693–1708. [Google Scholar] [CrossRef] [PubMed]
- Naguib, S.; Backstrom, J.R.; Gil, M.; Calkins, D.J.; Rex, T.S. Retinal oxidative stress activates the NRF2/ARE pathway: An early endogenous protective response to ocular hypertension. Redox Biol. 2021, 42, 101883. [Google Scholar] [CrossRef]
- Jia, R.; Gu, Z.; He, Q.; Du, J.; Cao, L.; Jeney, G.; Xu, P.; Yin, G. Anti-oxidative, anti-inflammatory and hepatoprotective effects of Radix Bupleuri extract against oxidative damage in tilapia (Oreochromis niloticus) via Nrf2 and TLRs signaling pathway. Fish Shellfish Immunol. 2019, 93, 395–405. [Google Scholar] [CrossRef]
- Zheng, Y.H.; Yang, J.J.; Tang, P.J.; Zhu, Y.; Chen, Z.; She, C.; Chen, G.; Cao, P.; Xu, X.Y. A novel Keap1 inhibitor iKeap1 activates Nrf2 signaling and ameliorates hydrogen peroxide-induced oxidative injury and apoptosis in osteoblasts. Cell Death Dis. 2021, 12, 679. [Google Scholar] [CrossRef] [PubMed]
- Liang, L.; Luo, M.; Fu, Y.; Zu, Y.; Wang, W.; Gu, C.; Zhao, C.; Li, C.; Efferth, T. Cajaninstilbene acid (CSA) exerts cytoprotective effects against oxidative stress through the Nrf2-dependent antioxidant pathway. Toxicol. Lett. 2013, 219, 254–261. [Google Scholar] [CrossRef] [PubMed]
- Shokeir, A.A.; Hussein, A.M.; Barakat, N.; Abdelaziz, A.; Elgarba, M.; Awadalla, A. Activation of nuclear factor erythroid 2-related factor 2 (Nrf2) and Nrf-2-dependent genes by ischaemic pre-conditioning and post-conditioning: New adaptive endogenous protective responses against renal ischaemia/reperfusion injury. Acta Physiol. 2014, 210, 342–353. [Google Scholar] [CrossRef]
- Fernández-Mendívil, C.; Luengo, E.; Trigo-Alonso, P.; García-Magro, N.; Negredo, P.; López, M.G. Protective role of microglial HO-1 blockade in aging: Implication of iron metabolism. Redox Biol. 2021, 38, 101789. [Google Scholar] [PubMed]
- Kim, W.; Kim, S.H.; Jang, J.H.; Kim, C.; Kim, K.; Suh, Y.G.; Joe, Y.; Chung, H.T.; Cha, Y.N.; Surh, Y.J. Role of heme oxygenase-1 in potentiation of phagocytic activity of macrophages by taurine chloramine: Implications for the resolution of zymosan A-induced murine peritonitis. Cell Immunol. 2018, 327, 36–46. [Google Scholar] [CrossRef]
- Rivera-Pérez, J.; Martínez-Rosas, M.; Conde-Castañón, C.A.; Toscano-Garibay, J.D.; Ruiz-Pérez, N.J.; Flores, P.L.; Mera Jiménez, E.; Flores-Estrada, J. Epigallocatechin 3-Gallate Has a Neuroprotective Effect in Retinas of Rabbits with Ischemia/Reperfusion through the Activation of Nrf2/HO-1. Int. J. Mol. Sci. 2020, 21, 3716. [Google Scholar] [CrossRef]
- Wang, P.; Zhao, Y.; Li, Y.; Wu, J.; Yu, S.; Zhu, J.; Li, L.; Zhao, Y. Sestrin2 overexpression attenuates focal cerebral ischemic injury in rat by increasing Nrf2/HO-1 pathway-mediated angiogenesis. Neuroscience 2019, 410, 140–149. [Google Scholar] [CrossRef] [PubMed]
- Su, X.L.; Wang, J.W.; Jiang, L.; Huang, X.M. In Synergistic Lethality between Beta-lapachone and Proliferating Cell Nuclear Antigen (PCNA) Inhibitor in NQO1-positive Cancer Cells. FASEB Journal. 2021, 35, 111. [Google Scholar] [CrossRef]
- Su, L.; Zhang, J.; Gomez, H.; Kellum, J.A.; Peng, Z. Mitochondria ROS and mitophagy in acute kidney injury. Autophagy 2023, 19, 401–414. [Google Scholar] [CrossRef]
- Schieber, M.; Chandel, N.S. ROS Function in Redox Signaling and Oxidative Stress. Curr. Biol. 2014, 24, R453–R462. [Google Scholar] [CrossRef] [PubMed]
- Chouchani, E.T.; Pell, V.R.; Gaude, E.; Aksentijevic, D.; Sundier, S.Y.; Robb, E.L.; Logan, A.; Nadtochiy, S.M.; Ord, E.N.J.; Smith, A.C.; et al. Ischaemic accumulation of succinate controls reperfusion injury through mitochondrial ROS. Nature 2014, 515, 29–30. [Google Scholar] [CrossRef]
- Dillard, C.J.; Litov, R.E.; Savin, W.M.; Dumelin, E.E.; Tappel, A.L. Effects of exercise, vitamin E, and ozone on pulmonary function and lipid peroxidation. J. Appl. Physiol. Respir. Environ. Exerc. Physiol. 1978, 45, 927–932. [Google Scholar] [CrossRef]
- Dandapat, J.; Chainy, G.B.; Rao, K.J. Lipid peroxidation and antioxidant defence status during larval development and metamorphosis of giant prawn, Macrobrachium rosenbergii. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 2003, 135C, 221–233. [Google Scholar] [CrossRef]
- Liao, C.; Wu, L.; Zhong, W.; Zheng, Q.; Tan, W.; Feng, K.; Feng, X.; Meng, F. Cellular Antioxidant Properties of Ischnoderma Resinosum Polysaccharide. Molecules 2022, 27, 7717. [Google Scholar] [CrossRef]
- Guan, S.; Zhang, X.L.; Ge, D.; Liu, T.Q.; Ma, X.H.; Cui, Z.F. Protocatechuic acid promotes the neuronal differentiation and facilitates survival of phenotypes differentiated from cultured neural stem and progenitor cells. Eur. J. Pharmacol. 2011, 670, 471–478. [Google Scholar] [CrossRef]
- Hayes, J.D.; Dinkova-Kostova, A.T. The Nrf2 regulatory network provides an interface between redox and intermediary metabolism. Trends Biochem. Sci. 2014, 39, 199–218. [Google Scholar] [CrossRef]
- Suzuki, T.; Yamamoto, M. Molecular basis of the Keap1-Nrf2 system. Free Radic. Biol. Med. 2015, 88 Pt B, 93–100. [Google Scholar] [CrossRef]
- Ulasov, A.V.; Rosenkranz, A.A.; Georgiev, G.P.; Sobolev, A.S. Nrf2/Keap1/ARE signaling: Towards specific regulation. Life Sci. 2022, 291, 120111. [Google Scholar] [CrossRef] [PubMed]
- Sardaro, N.; Della Vella, F.; Incalza, M.A.; Di Stasio, D.; Lucchese, A.; Contaldo, M.; Laudadio, C.; Petruzzi, M. Oxidative Stress and Oral Mucosal Diseases: An Overview. In Vivo 2019, 33, 289–296. [Google Scholar] [CrossRef]
- Zhang, W.; Cheng, C.; Sha, Z.; Chen, C.; Yu, C.; Lv, N.; Ji, P.; Wu, X.; Ma, T.; Cheng, H.; et al. Rosmarinic acid prevents refractory bacterial pneumonia through regulating Keap1/Nrf2-mediated autophagic pathway and mitochondrial oxidative stress. Free Radic. Biol. Med. 2021, 168, 247–257. [Google Scholar] [CrossRef]
- Sajadimajd, S.; Khazaei, M. Oxidative Stress and Cancer: The Role of Nrf2. Curr. Cancer Drug Targets 2018, 18, 538–557. [Google Scholar] [CrossRef] [PubMed]
- Gao, B.; Doan, A.; Hybertson, B.M. The clinical potential of influencing Nrf2 signaling in degenerative and immunological disorders. Clin. Pharmacol. 2014, 6, 19–34. [Google Scholar]
- Ucar, B.I.; Ucar, G.; Saha, S.; Buttari, B.; Profumo, E.; Saso, L. Pharmacological Protection against Ischemia-Reperfusion Injury by Regulating the Nrf2-Keap1-ARE Signaling Pathway. Antioxidants 2021, 10, 823. [Google Scholar] [CrossRef]
- Yin, J.; Ren, W.; Liu, G.; Duan, J.L.; Yang, G.; Wu, L.; Li, T.; Yin, Y. Birth oxidative stress and the development of an antioxidant system in newborn piglets. Free. Radic. Res. 2013, 47, 1027–1035. [Google Scholar] [CrossRef]
- Xu, J.; Zhou, L.; Weng, Q.; Xiao, L.; Li, Q. Curcumin analogues attenuate Aβ25-35-induced oxidative stress in PC12 cells via Keap1/Nrf2/HO-1 signaling pathways. Chem.-Biol. Interact. 2019, 305, 171–179. [Google Scholar] [CrossRef]
- Fakhri, S.; Pesce, M.; Patruno, A.; Moradi, S.Z.; Iranpanah, A.; Farzaei, M.H.; Sobarzo-Sinchez, E. Attenuation of Nrf2/Keap1/ARE in Alzheimer’s Disease by Plant Secondary Metabolites: A Mechanistic Review. Molecules 2020, 25, 4926. [Google Scholar] [CrossRef] [PubMed]
- Mittal, S.P.K.; Khole, S.; Jagadish, N.; Ghosh, D.; Gadgil, V.; Sinkar, V.; Ghaskadbi, S.S. Andrographolide protects liver cells from H2O2 induced cell death by upregulation of Nrf-2/HO-1 mediated via adenosine A2a receptor signaling. Biochim. Biophys. Acta Gen. Subj. 2016, 1860, 2377–2390. [Google Scholar] [CrossRef] [PubMed]
- Wang, C.M.; Li, Y.J.; Li, J.J.; Zang, Y.L.; Cui, X.H.; Song, M.; Yang, Q.; Chen, Y.; Li, Q.; Cai, W.Y.; et al. Shenlian extract attenuates TNF-α-induced ECV304 injury by regulating Nrf2 /Keap1 signaling pathway. China J. Chin. Mater. Medica 2021, 46, 3401–3409. [Google Scholar]
- Dang, R.Z.; Wang, M.Y.; Li, X.; Wang, H.Y.; Li, L.; Wu, Q.Y.; Zhao, J.T.; Ji, P.; Zhong, L.M.; Julio, L.; et al. Edaravone ameliorates depressive and anxiety-like behaviors via Sirt1/Nrf2/HO-1/ Gpx4 pathway. J. Neuroinflammation 2022, 19, 41–69. [Google Scholar] [CrossRef] [PubMed]
- Yu, C.W.; Chen, H.; Du, D.H.; Lv, W.T.; Li, S.J.; Li, D.F.; Xu, Z.X.; Gao, M.; Hu, H.L.; Liu, D.C. β-Glucan from Saccharomyces cerevisiae alleviates oxidative stress in LPS-stimulated RAW264.7 cells via Dectin-1/Nrf2/HO-1 signaling pathway. Cell Stress Chaperones 2021, 26, 629–637. [Google Scholar] [CrossRef] [PubMed]
Gene | Primer Sequence (5′–3′) | |
---|---|---|
KEAP1 | F | CCTTCAGCTACACCCTGGAG |
R | AACATGGCCTTGAAGACAGG | |
NFE2L2 | F | AGACAAACATTCAAGCCGCT |
R | CCATCTCTTGTTTGCTGCAG | |
HMOX1 | F | CAGTCTTCGCCCCTGTCTAC |
R | GCTGGTGTGTAGGGGATGAC | |
NQO1 | F | AGTGCAGTGGTGTGATCTCG |
R | GGTGGAGTCACGCCTGTAAT | |
SOD1 | F | GAAGGTGTGGGGAAGCATTA |
R | GAAGGTGTGGGGAAGCATTA | |
CAT | F | ACATGGTCTGGGACTTCTGG |
R | CTTGGGTCGAAGGCTATCTG | |
GPX1 | F | AACCAGTTTGGGCATCAGG |
R | GTTCACCTCGCACTTCTCG | |
GAPDH | F | GACCCCTTCATTGACCTCAAC |
R | CATACCAGGAAATGAGCTTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, M.-J.; Sun, W.-W.; Yang, J.; Shi, D.-D.; Dai, X.-F.; Li, X.-M. The Effect of Preventing Oxidative Stress and Its Mechanisms in the Extract from Sonchus brachyotus DC. Based on the Nrf2-Keap1-ARE Signaling Pathway. Antioxidants 2023, 12, 1677. https://doi.org/10.3390/antiox12091677
Zhang M-J, Sun W-W, Yang J, Shi D-D, Dai X-F, Li X-M. The Effect of Preventing Oxidative Stress and Its Mechanisms in the Extract from Sonchus brachyotus DC. Based on the Nrf2-Keap1-ARE Signaling Pathway. Antioxidants. 2023; 12(9):1677. https://doi.org/10.3390/antiox12091677
Chicago/Turabian StyleZhang, Meng-Jie, Wen-Wen Sun, Juan Yang, Dong-Dong Shi, Xiao-Feng Dai, and Xiu-Mei Li. 2023. "The Effect of Preventing Oxidative Stress and Its Mechanisms in the Extract from Sonchus brachyotus DC. Based on the Nrf2-Keap1-ARE Signaling Pathway" Antioxidants 12, no. 9: 1677. https://doi.org/10.3390/antiox12091677
APA StyleZhang, M.-J., Sun, W.-W., Yang, J., Shi, D.-D., Dai, X.-F., & Li, X.-M. (2023). The Effect of Preventing Oxidative Stress and Its Mechanisms in the Extract from Sonchus brachyotus DC. Based on the Nrf2-Keap1-ARE Signaling Pathway. Antioxidants, 12(9), 1677. https://doi.org/10.3390/antiox12091677