Lutein Exerts Antioxidant and Anti-Inflammatory Effects and Influences Iron Utilization of BV-2 Microglia
Abstract
1. Introduction
2. Materials and Methods
2.1. Isolation of Lutein
2.2. Cell Culture and Treatments
2.3. Cell Viability Assay
2.4. Detection of the Reactive Oxygen Species
2.5. Real-Time PCR
2.6. Enzyme-Linked Immunosorbent Assay (ELISA) Measurements
2.7. Measurements of Total Iron
2.8. Measurements of Heme Concentration
2.9. Western Blotting
2.10. Statistical Analysis
3. Results
3.1. Lutein Suppresses the H2O2-Induced ROS in BV-2 Cells
3.2. Lutein Modifies the mRNA Expressions of Antioxidant Enzymes Catalase, Superoxide Dismutase 2 and Heme Oxygenase-1
3.3. Lutein Increases Heme Content of BV-2 Cells
3.4. Lutein Modulates the Expression of Genes Involved in Mitochondrial Iron Metabolism under Normal and H2O2-Induced Stress Conditions in BV-2 Cells
3.5. Lutein Alters the Anti-Inflammatory and Pro-Inflammatory Cytokine Secretions in H2O2-Induced Stress in BV-2 Cells
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Maoka, T. Carotenoids as natural functional pigments. J. Nat. Med. 2020, 74, 1–16. [Google Scholar] [CrossRef]
- Koushan, K.; Rusovici, R.; Li, W.; Ferguson, L.R.; Chalam, K.V. The role of lutein in eye-related disease. Nutrients 2013, 5, 1823–1839. [Google Scholar] [CrossRef] [PubMed]
- Buscemi, S.; Corleo, D.; Di Pace, F.; Petroni, M.L.; Satriano, A.; Marchesini, G. The effect of lutein on eye and extra-eye health. Nutrients 2018, 10, 1321. [Google Scholar] [CrossRef]
- He, R.R.; Tsoi, B.; Lan, F.; Yao, N.; Yao, X.S.; Kurihara, H. Antioxidant properties of lutein contribute to the protection against lipopolysaccharide-induced uveitis in mice. Chin. Med. 2011, 6, 38. [Google Scholar] [CrossRef]
- Zhang, Z.W.; Xu, X.C.; Liu, T.; Yuan, S. Mitochondrion-permeable antioxidants to treat ROS-burst-mediated acute diseases. Oxid. Med. Cell. Longev. 2016, 2016, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Reuter, S.; Gupta, S.C.; Chaturvedi, M.M.; Aggarwal, B.B. Oxidative stress, inflammation, and cancer: How are they linked? Free Radic. Biol. Med. 2010, 49, 1603–1616. [Google Scholar] [CrossRef]
- Bohn, T. Carotenoids and markers of oxidative stress in human observational studies and intervention trials: Implications for chronic diseases. Antioxidants 2019, 8, 179. [Google Scholar] [CrossRef] [PubMed]
- Fiedor, J.; Burda, K. Potential role of carotenoids as antioxidants in human health and disease. Nutrients 2014, 6, 466–488. [Google Scholar] [CrossRef] [PubMed]
- Rojo, A.I.; McBean, G.; Cindric, M.; Egea, J.; López, M.G.; Rada, P.; Zarkovic, N.; Cuadrado, A. Redox control of microglial function: Molecular mechanisms and functional significance. Antioxid. Redox Signal. 2014, 21, 1766–1801. [Google Scholar] [CrossRef] [PubMed]
- Yin, J.; Valin, K.L.; Dixon, M.L.; Leavenworth, J.W. The role of microglia and macrophages in CNS homeostasis, autoimmunity, and cancer. J. Immunol. Res. 2017, 2017, 5150678. [Google Scholar] [CrossRef]
- Laffer, B.; Bauer, D.; Wasmuth, S.; Busch, M.; Jalilvand, T.V.; Thanos, S.; Meyer zu Hörste, G.; Loser, K.; Langmann, T.; Heiligenhaus, A.; et al. Loss of IL-10 promotes differentiation of microglia to a M1 phenotype. Front. Cell. Neurosci. 2019, 13, 430. [Google Scholar] [CrossRef]
- Burmeister, A.R.; Marriott, I. The interleukin-10 family of cytokines and their role in the CNS. Front. Cell. Neurosci. 2018, 12, 458. [Google Scholar] [CrossRef] [PubMed]
- Amor, S.; Puentes, F.; Baker, D.; Van Der Valk, P. Inflammation in neurodegenerative diseases. Immunology 2010, 129, 154–169. [Google Scholar] [CrossRef]
- Harms, A.S.; Lee, J.K.; Nguyen, T.A.; Chang, J.; Ruhn, K.M.; Treviño, I.; Tansey, M.G. Regulation of microglia effector functions by tumor necrosis factor signaling. Glia 2012, 60, 189–202. [Google Scholar] [CrossRef] [PubMed]
- Horowitz, M.P.; Greenamyre, J.T. Mitochondrial iron metabolism and its role in neurodegeneration. J. Alzheimer’s Dis. 2010, 20, S551–S568. [Google Scholar] [CrossRef]
- Shimizu, T.; Nojiri, H.; Kawakami, S.; Uchiyama, S.; Shirasawa, T. Model mice for tissue-specific deletion of the manganese superoxide dismutase gene. Geriatr. Gerontol. Int. 2010, 10, S70–S79. [Google Scholar] [CrossRef]
- Borrelli, A.; Schiattarella, A.; Bonelli, P.; Tuccillo, F.M.; Buonaguro, F.M.; Mancini, A. The functional role of MnSOD as a biomarker of human diseases and therapeutic potential of a new isoform of a human recombinant MnSOD. Biomed. Res. Int. 2014, 2014, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Nandi, A.; Yan, L.J.; Jana, C.K.; Das, N. Role of catalase in oxidative stress- and age-associated degenerative diseases. Oxid. Med. Cell. Longev. 2019, 2019, 1–19. [Google Scholar] [CrossRef] [PubMed]
- Duvigneau, J.C.; Esterbauer, H.; Kozlov, A.V. Role of heme oxygenase as a modulator of heme-mediated pathways. Antioxidants 2019, 8, 475. [Google Scholar] [CrossRef]
- Takahashi, T.; Shimizu, H.; Morimatsu, H.; Maeshima, K.; Inoue, K.; Akagi, R.; Matsumi, M.; Katayama, H.; Morita, K. Heme oxygenase-1 is an essential cytoprotective component in oxidative tissue injury induced by hemorrhagic shock. J. Clin. Biochem. Nutr. 2009, 44, 28–40. [Google Scholar] [CrossRef] [PubMed]
- Nnah, I.C.; Wessling-Resnick, M. Brain Iron homeostasis: A focus on microglial Iron. Pharmaceuticals 2018, 11, 129. [Google Scholar] [CrossRef] [PubMed]
- Paul, B.T.; Manz, D.H.; Torti, F.M.; Torti, S.V. Mitochondria and Iron: Current questions. Expert Rev. Hematol. 2017, 10, 65–79. [Google Scholar] [CrossRef] [PubMed]
- Hamza, I.; Dailey, H.A. One ring to rule them all: Trafficking of heme and heme synthesis intermediates in the metazoans. Biochim. Biophys. Acta Mol. Cell Res. 2012, 1823, 1617–1632. [Google Scholar] [CrossRef]
- Fujiwara, T.; Harigae, H. Biology of heme in mammalian erythroid cells and related disorders. Biomed. Res. Int. 2015, 2015, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Srour, B.; Gervason, S.; Monfort, B.; D’Autréaux, B. Mechanism of iron–sulfur cluster assembly: In the intimacy of iron and sulfur encounter. Inorganics 2020, 8, 55. [Google Scholar] [CrossRef]
- Sukhbaatar, N.; Weichhart, T. Iron regulation: Macrophages in control. Pharmaceuticals 2018, 11, 137. [Google Scholar] [CrossRef] [PubMed]
- Riemer, J.; Hoepken, H.H.; Czerwinska, H.; Robinson, S.R.; Dringen, R. Colorimetric ferrozine-based assay for the quantitation of iron in cultured cells. Anal. Biochem. 2004, 331, 370–375. [Google Scholar] [CrossRef] [PubMed]
- ImageJ. Available online: https://imagej.nih.gov/ij/ (accessed on 23 September 1997).
- Bajpai, V.K.; Alam, M.B.; Quan, K.T.; Kwon, K.R.; Ju, M.K.; Choi, H.J.; Lee, J.S.; Yoon, J.I.; Majumder, R.; Rather, I.A.; et al. Antioxidant efficacy and the upregulation of Nrf2-mediated HO-1 expression by (+)-lariciresinol, a lignan isolated from Rubia philippinensis, through the activation of p38. Sci. Rep. 2017, 7, 46035. [Google Scholar] [CrossRef]
- Scandalios, J.G. Oxidative stress: Molecular perception and transduction of signals triggering antioxidant gene defenses. Braz. J. Med. Biol. Res. 2005, 38, 995–1014. [Google Scholar] [CrossRef]
- Forrester, S.J.; Kikuchi, D.S.; Hernandes, M.S.; Xu, Q.; Griendling, K.K. Reactive oxygen species in metabolic and inflammatory signaling. Circ. Res. 2018, 122, 877–902. [Google Scholar] [CrossRef] [PubMed]
- Simpson, D.S.A.; Oliver, P.L. ROS generation in microglia: Understanding oxidative stress and inflammation in neurodegenerative disease. Antioxidants 2020, 9, 743. [Google Scholar] [CrossRef]
- Berlett, B.S.; Stadtman, E.R. Protein oxidation in aging, disease, and oxidative stress. J. Biol. Chem. 1997, 272, 20313–20316. [Google Scholar] [CrossRef] [PubMed]
- Jurga, A.M.; Paleczna, M.; Kuter, K.Z. Overview of general and discriminating markers of differential microglia phenotypes. Front. Cell. Neurosci. 2020, 14, 198. [Google Scholar] [CrossRef]
- Wang, W.Y.; Tan, M.S.; Yu, J.T.; Tan, L. Role of pro-inflammatory cytokines released from microglia in Alzheimer’s disease. Ann. Transl. Med. 2015, 3, 136. [Google Scholar] [CrossRef]
- Kim, Y.S.; Joh, T.H. Microglia, major player in the brain inflammation: Their roles in the pathogenesis of Parkinson’s disease. Exp. Mol. Med. 2006, 38, 333–347. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.R.; Nakanishi, K.; Itagaki, Y.; Sparrow, J.R. Photooxidation of A2-PE, a photoreceptor outer segment fluorophore, and protection by lutein and zeaxanthin. Exp. Eye Res. 2006, 82, 828–839. [Google Scholar] [CrossRef]
- Xie, K.; Ngo, S.; Rong, J.; Sheppard, A. Modulation of mitochondrial respiration underpins neuronal differentiation enhanced by lutein. Neural Regen. Res. 2019, 14, 87–99. [Google Scholar] [CrossRef] [PubMed]
- Kabba, J.A.; Xu, Y.; Christian, H.; Ruan, W.; Chenai, K.; Xiang, Y.; Zhang, L.; Saavedra, J.M.; Pang, T. Microglia: Housekeeper of the central nervous system. Cell. Mol. Neurobiol. 2018, 38, 53–71. [Google Scholar] [CrossRef] [PubMed]
- Uttara, B.; Singh, A.; Zamboni, P.; Mahajan, R. Oxidative stress and neurodegenerative diseases: A review of upstream and downstream antioxidant therapeutic options. Curr. Neuropharmacol. 2009, 7, 65–74. [Google Scholar] [CrossRef]
- Chen, X.; Guo, C.; Kong, J. Oxidative stress in neurodegenerative diseases. Neural Regen. Res. 2012, 7, 376–385. [Google Scholar] [CrossRef] [PubMed]
- Lobo, V.; Patil, A.; Phatak, A.; Chandra, N. Free radicals, antioxidants and functional foods: Impact on human health. Pharmacogn. Rev. 2010, 4, 118–126. [Google Scholar] [CrossRef]
- Hasanuzzaman, M.; Bhuyan, M.H.M.B.; Zulfiqar, F.; Raza, A.; Mohsin, S.M.; Al Mahmud, J.; Fujita, M.; Fotopoulos, V. Reactive oxygen species and antioxidant defense in plants under abiotic stress: Revisiting the crucial role of a universal defense regulator. Antioxidants 2020, 9, 681. [Google Scholar] [CrossRef] [PubMed]
- Giordano, F.J. Oxygen, oxidative stress, hypoxia, and heart failure. J. Clin. Investig. 2005, 115, 500–508. [Google Scholar] [CrossRef] [PubMed]
- Salim, S. Oxidative stress and the central nervous system. J. Pharmacol. Exp. Ther. 2017, 360, 201–205. [Google Scholar] [CrossRef] [PubMed]
- Ren, X.; Zou, L.; Zhang, X.; Branco, V.; Wang, J.; Carvalho, C.; Holmgren, A.; Lu, J. Redox signaling mediated by thioredoxin and glutathione systems in the central nervous system. Antioxid. Redox Signal. 2017, 27, 989–1010. [Google Scholar] [CrossRef] [PubMed]
- Ransy, C.; Vaz, C.; Lombès, A.; Bouillaud, F. Use of H2O2 to cause oxidative stress, the catalase issue. Int. J. Mol. Sci. 2020, 21, 9149. [Google Scholar] [CrossRef]
- Wang, Y.; Branicky, R.; Noë, A.; Hekimi, S. Superoxide dismutases: Dual roles in controlling ROS damage and regulating ROS signaling. J. Cell Biol. 2018, 217, 1915–1928. [Google Scholar] [CrossRef]
- Fukai, T.; Ushio-Fukai, M. Superoxide dismutases: Role in redox signaling, vascular function, and diseases. Antioxid. Redox Signal. 2011, 15, 1583–1606. [Google Scholar] [CrossRef] [PubMed]
- Mikhak, B.; Hunter, D.J.; Spiegelman, D.; Platz, E.A.; Wu, K.; Erdman, J.W.; Giovannucci, E. Manganese superoxide dismutase (MnSOD) gene polymorphism, interactions with carotenoid levels and prostate cancer risk. Carcinogenesis 2008, 29, 2335–2340. [Google Scholar] [CrossRef]
- Ji, G.; Lv, K.; Chen, H.; Wang, T.; Wang, Y.; Zhao, D.; Qu, L.; Li, Y. MiR-146a Regulates SOD2 Expression in H2O2 Stimulated PC12 Cells. PLoS ONE 2013, 8, e69351. [Google Scholar] [CrossRef]
- Kaneko, Y.S.; Ota, A.; Nakashima, A.; Mori, K.; Nagatsu, I.; Nagatsu, T. Regulation of oxidative stress in long-lived lipopolysaccharide-activated microglia. Clin. Exp. Pharmacol. Physiol. 2012, 39, 599–607. [Google Scholar] [CrossRef] [PubMed]
- El Assar, M.; Angulo, J.; Rodríguez-Mañas, L. Oxidative stress and vascular inflammation in aging. Free Radic. Biol. Med. 2013, 65, 380–401. [Google Scholar] [CrossRef] [PubMed]
- Fresta, C.G.; Fidilio, A.; Lazzarino, G.; Musso, N.; Grasso, M.; Merlo, S.; Amorini, A.M.; Bucolo, C.; Tavazzi, B.; Lazzarino, G.; et al. Modulation of pro-oxidant and pro-inflammatory activities of m1 macrophages by the natural dipeptide carnosine. Int. J. Mol. Sci. 2020, 21, 776. [Google Scholar] [CrossRef]
- Kamoshita, M.; Toda, E.; Osada, H.; Narimatsu, T.; Kobayashi, S.; Tsubota, K.; Ozawa, Y. Lutein acts via multiple antioxidant pathways in the photo-stressed retina. Sci. Rep. 2016, 6, 30226. [Google Scholar] [CrossRef]
- Mukherjee, S.; Forde, R.; Belton, A.; Duttaroy, A. SOD2, the principal scavenger of mitochondrial superoxide, is dispensable for embryogenesis and imaginal tissue development but essential for adult survival. Fly (Austin) 2011, 5, 39–46. [Google Scholar] [CrossRef]
- Lee, K.H.; Cha, M.; Lee, B.H. Neuroprotective effect of antioxidants in the brain. Int. J. Mol. Sci. 2020, 21, 7152. [Google Scholar] [CrossRef]
- Fujimura, M.; Morita-Fujimura, Y.; Kawase, M.; Copin, J.C.; Calagui, B.; Epstein, C.J.; Chan, P.H. Manganese superoxide dismutase mediates the early release of mitochondrial cytochrome C and subsequent DNA fragmentation after permanent focal cerebral ischemia in mice. J. Neurosci. 1999, 19, 3414–3422. [Google Scholar] [CrossRef]
- Durante, W. Protective role of heme oxygenase-1 against inflammation in atherosclerosis. Front. Biosci. 2011, 16, 2372–2388. [Google Scholar] [CrossRef]
- Sun, G.Y.; Chen, Z.; Jasmer, K.J.; Chuang, D.Y.; Gu, Z.; Hannink, M.; Simonyi, A. Quercetin attenuates inflammatory responses in BV-2 microglial cells: Role of MAPKs on the Nrf2 pathway and induction of heme oxygenase-1. PLoS ONE 2015, 10, e0141509. [Google Scholar] [CrossRef]
- Ko, W.; Yoon, C.S.; Kim, K.W.; Lee, H.; Kim, N.; Woo, E.R.; Kim, Y.C.; Kang, D.G.; Lee, H.S.; Oh, H.; et al. Neuroprotective and anti-inflammatory effects of kuwanon c from cudrania tricuspidata are mediated by heme oxygenase-1 in ht22 hippocampal cells, raw264.7 macrophage, and bv2 microglia. Int. J. Mol. Sci. 2020, 21, 4839. [Google Scholar] [CrossRef] [PubMed]
- Matz, P.G.; Weinstein, P.R.; Sharp, F.R. Heme oxygenase-1 and heat shock protein 70 induction in glia and neurons throughout rat brain after experimental intracerebral hemorrhage. Neurosurgery 1997, 40, 152–162. [Google Scholar] [CrossRef]
- Gozzelino, R.; Jeney, V.; Soares, M.P. Mechanisms of cell protection by heme oxygenase-1. Annu. Rev. Pharmacol. Toxicol. 2010, 50, 323–354. [Google Scholar] [CrossRef] [PubMed]
- Parfenova, H.; Leffler, C.W.; Basuroy, S.; Liu, J.; Fedinec, A.L. Antioxidant roles of heme oxygenase, carbon monoxide, and bilirubin in cerebral circulation during seizures. J. Cereb. Blood Flow Metab. 2012, 32, 1024–1034. [Google Scholar] [CrossRef]
- Korolnek, T.; Hamza, I. Like iron in the blood of the people: The requirement for heme trafficking in iron metabolism. Front. Pharmacol. 2014, 2014, 126. [Google Scholar] [CrossRef] [PubMed]
- Donegan, R.K.; Moore, C.M.; Hanna, D.A.; Reddi, A.R. Handling heme: The mechanisms underlying the movement of heme within and between cells. Free Radic. Biol. Med. 2019, 133, 88–100. [Google Scholar] [CrossRef]
- Ndayisaba, A.; Kaindlstorfer, C.; Wenning, G.K. Iron in neurodegeneration—Cause or consequence? Front. Neurosci. 2019, 13, e00180. [Google Scholar] [CrossRef]
- Paradkar, P.N.; Zumbrennen, K.B.; Paw, B.H.; Ward, D.M.; Kaplan, J. Regulation of mitochondrial iron import through differential turnover of mitoferrin 1 and mitoferrin 2. Mol. Cell. Biol. 2009, 29, 1007–1016. [Google Scholar] [CrossRef] [PubMed]
- Li, F.Y.; Nikali, K.; Gregan, J.; Leibiger, I.; Leibiger, B.; Schweyen, R.; Larsson, C.; Suomalainen, A. Characterization of a novel human putative mitochondrial transporter homologous to the yeast mitochondrial RNA splicing proteins 3 and 4. FEBS Lett. 2001, 494, 79–84. [Google Scholar] [CrossRef]
- Hunter, G.A.; Al-Karadaghi, S.; Ferreira, G.C. Ferrochelatase: The convergence of the porphyrin biosynthesis and iron transport pathways. J. Porphyr. Phthalocyanines 2011, 15, 350–356. [Google Scholar] [CrossRef]
- Sachar, M.; Anderson, K.E.; Ma, X. Protoporphyrin IX: The good, the bad, and the ugly. J. Pharmacol. Exp. Ther. 2016, 356, 267–275. [Google Scholar] [CrossRef]
- Santambrogio, P.; Biasiotto, G.; Sanvito, F.; Olivieri, S.; Arosio, P.; Levi, S. Mitochondrial ferritin expression in adult mouse tissues. J. Histochem. Cytochem. 2007, 55, 1129–1137. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.; Yang, M.; Guan, H.; Liu, Z.; Zhao, S.; Takeuchi, S.; Yanagisawa, D.; Tooyama, I. Mitochondrial ferritin in neurodegenerative diseases. Neurosci. Res. 2013, 77, 1–7. [Google Scholar] [CrossRef]
- Rouault, T.A. Mitochondrial iron overload: Causes and consequences. Curr. Opin. Genet. Dev. 2016, 38, 31–37. [Google Scholar] [CrossRef]
- Tong, W.H.; Rouault, T.A. Functions of mitochondrial ISCU and cytosolic ISCU in mammalian iron-sulfur cluster biogenesis and iron homeostasis. Cell Metab. 2006, 3, 199–210. [Google Scholar] [CrossRef] [PubMed]
- Lill, R.; Dutkiewicz, R.; Elsässer, H.P.; Hausmann, A.; Netz, D.J.A.; Pierik, A.J.; Stehling, O.; Urzica, E.; Mühlenhoff, U. Mechanisms of iron-sulfur protein maturation in mitochondria, cytosol and nucleus of eukaryotes. Biochim. Biophys. Acta Mol. Cell Res. 2006, 1763, 652–667. [Google Scholar] [CrossRef]
- Linton, K.J.; Higgins, C.F. Structure and function of ABC transporters: The ATP switch provides flexible control. Pflug. Arch. Eur. J. Physiol. 2007, 453, 555–567. [Google Scholar] [CrossRef]
- Richardson, D.R.; Lane, D.J.R.; Becker, E.M.; Huang, M.L.H.; Whitnall, M.; Rahmanto, Y.S.; Sheftel, A.D.; Ponka, P. Mitochondrial iron trafficking and the integration of iron metabolism between the mitochondrion and cytosol. Proc. Natl. Acad. Sci. USA 2010, 107, 10775–10782. [Google Scholar] [CrossRef] [PubMed]
- Bordt, E.A.; Polster, B.M. NADPH oxidase- and mitochondria-derived reactive oxygen species in proinflammatory microglial activation: A Bipartisan affair? Free Radic. Biol. Med. 2014, 76, 34–46. [Google Scholar] [CrossRef]
- Wu, W.; Li, Y.; Wu, Y.; Zhang, Y.; Wang, Z.; Liu, X. Lutein suppresses inflammatory responses through Nrf2 activation and NF-κB inactivation in lipopolysaccharide-stimulated BV-2 microglia. Mol. Nutr. Food Res. 2015, 59, 1663–1673. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.E.; Clark, R.M.; Park, Y.; Lee, J.; Fernandez, M.L. Lutein decreases oxidative stress and inflammation in liver and eyes of guinea pigs fed a hypercholesterolemic diet. Nutr. Res. Pract. 2012, 6, 113–119. [Google Scholar] [CrossRef]
- Ip, W.K.E.; Hoshi, N.; Shouval, D.S.; Snapper, S.; Medzhitov, R. Anti-inflammatory effect of IL-10 mediated by metabolic reprogramming of macrophages. Science (80-) 2017, 356, 513–519. [Google Scholar] [CrossRef]
- Meng, J.; Ni, J.; Wu, Z.; Jiang, M.; Zhu, A.; Qing, H.; Nakanishi, H. The critical role of IL-10 in the antineuroinflammatory and antioxidative effects of Rheum tanguticum on activated microglia. Oxid. Med. Cell. Longev. 2018, 2018, 1–12. [Google Scholar] [CrossRef]
- DePaula-Silva, A.B.; Gorbea, C.; Doty, D.J.; Libbey, J.E.; Sanchez, J.M.S.; Hanak, T.J.; Cazalla, D.; Fujinami, R.S. Differential transcriptional profiles identify microglial- and macrophage-specific gene markers expressed during virus-induced neuroinflammation. J. Neuroinflamm. 2019, 16, 152. [Google Scholar] [CrossRef] [PubMed]
- Giustarini, D.; Dalle-Donne, I.; Tsikas, D.; Rossi, R. Oxidative stress and human diseases: Origin, link, measurement, mechanisms, and biomarkers. Crit. Rev. Clin. Lab. Sci. 2009, 46, 241–281. [Google Scholar] [CrossRef] [PubMed]
- Wang, M.; Tsao, R.; Zhang, S.; Dong, Z.; Yang, R.; Gong, J.; Pei, Y. Antioxidant activity, mutagenicity/anti-mutagenicity, and clastogenicity/anti-clastogenicity of lutein from marigold flowers. Food Chem. Toxicol. 2006, 44, 1522–1529. [Google Scholar] [CrossRef] [PubMed]
















| Target Gene | Gene Accession Number | Sequence 5′ → 3′ |
|---|---|---|
| β-actin forward | NM_007393.5 | CTGTCGAGTCGCGTCCA |
| β-actin reverse | TCATCCATGGCGAACTGGTG | |
| CAT forward | NM_009804.2 | AGAGGAAACGCCTGTGTGAG |
| CAT reverse | GCGTGTAGGTGTGAATTGCG | |
| FECH forward | NM_007998.8 | ACCACAGGCAGCAGCTTAAA |
| FECH reverse | CCTGTCGATTGTGCTCCACT | |
| FTMT forward | NM_026286.3 | TTAGGTCCCCTACTGGCCTC |
| FTMT reverse | CCAGGTTGATTTGGCGGTTG | |
| HO-1 forward | NM_010442.2 | GTCAAGCACAGGGTGACAGA |
| HO-1 reverse | ATCACCTGCAGCTCCTCAAA | |
| Iba1 forward | NM_019467.3 | GGAAAGTCAGCCAGTCCTCC |
| Iba1 reverse | CATCACTTCCACATCAGCTTTTGA | |
| IL-1β forward | NM_008361.4 | TGCCACCTTTTGACAGTGATG |
| IL-1β reverse | TGATGTGCTGCTGCGAGATT | |
| IL-4 forward | NM_021283.2 | CTCGAATGTACCAGGAGCCA |
| IL-4 reverse | AGGACGTTTGGCACATCCAT | |
| TGFβ forward | NM_011577.2 | CTGCTGACCCCCACTGATAC |
| TGFβ reverse | AGCCCTGTATTCCGTCTCCT | |
| MFRN2 forward | NM_145156.1 | CCACTGTCACCACGCACAT |
| MFRN2 reverse | GCCTCCAACACGTTCCGATA | |
| NFS1 forward | NM_010911.2 | GATTGGAGCTGATCCTCGGG |
| NFS1 reverse | AGAACCTGGCCACTCCCTTA | |
| SOD2 forward | NM_013671.3 | GAACAATCTCAACGCCACCG |
| SOD2 reverse | GCTGAAGAGCGACCTGAGTT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pap, R.; Pandur, E.; Jánosa, G.; Sipos, K.; Agócs, A.; Deli, J. Lutein Exerts Antioxidant and Anti-Inflammatory Effects and Influences Iron Utilization of BV-2 Microglia. Antioxidants 2021, 10, 363. https://doi.org/10.3390/antiox10030363
Pap R, Pandur E, Jánosa G, Sipos K, Agócs A, Deli J. Lutein Exerts Antioxidant and Anti-Inflammatory Effects and Influences Iron Utilization of BV-2 Microglia. Antioxidants. 2021; 10(3):363. https://doi.org/10.3390/antiox10030363
Chicago/Turabian StylePap, Ramóna, Edina Pandur, Gergely Jánosa, Katalin Sipos, Attila Agócs, and József Deli. 2021. "Lutein Exerts Antioxidant and Anti-Inflammatory Effects and Influences Iron Utilization of BV-2 Microglia" Antioxidants 10, no. 3: 363. https://doi.org/10.3390/antiox10030363
APA StylePap, R., Pandur, E., Jánosa, G., Sipos, K., Agócs, A., & Deli, J. (2021). Lutein Exerts Antioxidant and Anti-Inflammatory Effects and Influences Iron Utilization of BV-2 Microglia. Antioxidants, 10(3), 363. https://doi.org/10.3390/antiox10030363

