Chitosan-Stabilized Selenium Nanoparticles and Metformin Synergistically Rescue Testicular Oxidative Damage and Steroidogenesis-Related Genes Dysregulation in High-Fat Diet/Streptozotocin-Induced Diabetic Rats
Abstract
:1. Introduction
2. Materials and Methods
2.1. Tested Compounds
2.2. Experimental Animals
2.3. Animals and Experimental Design
2.4. Sampling
2.5. Semen Evaluation
2.6. Hormonal Assay
2.7. Analysis of Oxidants/Antioxidants Status of Testicular Tissue
2.8. Real-Time Quantitative PCR (RT-qPCR) Analysis
2.9. Histopathological Studies
2.10. Data Analysis
3. Results
3.1. Effect of MF and/or CH-SeNPs on Spermiogram
3.2. Effect of MF and/or CH-SeNPs on Male Reproductive Hormones
3.3. Effect of MF and/or CH-SeNPs on Testicular Antioxidants and Lipid Peroxidation Level
3.4. Effect of MF and/or CH-SeNPs on Gene Expression in Testicular Tissue
3.5. Histopathological Findings
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kerner, W.; Brückel, J. Definition, classification and diagnosis of diabetes mellitus. Exp. Clin. Endocrinol. Diabetes 2014, 122, 384–386. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ogurtsova, K.; da Rocha Fernandes, J.; Huang, Y.; Linnenkamp, U.; Guariguata, L.; Cho, N.H.; Cavan, D.; Shaw, J.; Makaroff, L. IDF Diabetes Atlas: Global estimates for the prevalence of diabetes for 2015 and 2040. Diabetes Res. Clin. Pract. 2017, 128, 40–50. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Padhi, S.; Nayak, A.K.; Behera, A. Type II diabetes mellitus: A review on recent drug based therapeutics. Biomed. Pharmacother. 2020, 131, 110708. [Google Scholar] [CrossRef] [PubMed]
- Barkabi-Zanjani, S.; Ghorbanzadeh, V.; Aslani, M.; Ghalibafsabbaghi, A.; Chodari, L. Diabetes mellitus and the impairment of male reproductive function: Possible signaling pathways. Diabetes Metab. Syndr. Clin. Res. Rev. 2020, 14, 1307–1314. [Google Scholar] [CrossRef]
- Kautzky-Willer, A.; Harreiter, J.; Pacini, G. Sex and Gender Differences in Risk, Pathophysiology and Complications of Type 2 Diabetes Mellitus. Endocr. Rev. 2016, 37, 278–316. [Google Scholar] [CrossRef] [Green Version]
- Maiorino, M.I.; Bellastella, G.; Esposito, K. Diabetes and sexual dysfunction: Current perspectives. Diabetes Metab. Syndr. Obes. Targets Ther. 2014, 7, 95. [Google Scholar]
- La Vignera, S.; Calogero, A.; Condorelli, R.; Lanzafame, F.; Giammusso, B.; Vicari, E. Andrological characterization of the patient with diabetes mellitus. Minerva Endocrinol. 2009, 34, 1–9. [Google Scholar]
- Al-Roujeaie, A.; Abuohashish, H.; Ahmed, M.; Alkhamees, O. Effect of rutin on diabetic-induced erectile dysfunction: Possible involvement of testicular biomarkers in male rats. Andrologia 2017, 49, e12737. [Google Scholar] [CrossRef]
- Shi, G.-J.; Zheng, J.; Wu, J.; Qiao, H.-Q.; Chang, Q.; Niu, Y.; Sun, T.; Li, Y.-X.; Yu, J.-Q. Beneficial effects of Lycium barbarum polysaccharide on spermatogenesis by improving antioxidant activity and inhibiting apoptosis in streptozotocin-induced diabetic male mice. Food Funct. 2017, 8, 1215–1226. [Google Scholar] [CrossRef]
- Li, Z.-M.; Liu, N.; Jiang, Y.-P.; Yang, J.-M.; Zheng, J.; Sun, M.; Li, Y.-X.; Sun, T.; Wu, J.; Yu, J.-Q. Vitexin alleviates streptozotocin-induced sexual dysfunction and fertility impairments in male mice via modulating the hypothalamus–pituitary–gonadal axis. Chem. Biol. Interact. 2019, 297, 119–129. [Google Scholar] [CrossRef]
- Soliman, G.A.; Saeedan, A.S.; Abdel-Rahman, R.F.; Ogaly, H.A.; Abd-Elsalam, R.M.; Abdel-Kader, M.S. Olive leaves extract attenuates type II diabetes mellitus-induced testicular damage in rats: Molecular and biochemical study. Saudi Pharm. J. 2019, 27, 326–340. [Google Scholar] [CrossRef] [PubMed]
- Halim, M.; Halim, A. The effects of inflammation, aging and oxidative stress on the pathogenesis of diabetes mellitus (type 2 diabetes). Diabetes Metab. Syndr. Clin. Res. Rev. 2019, 13, 1165–1172. [Google Scholar] [CrossRef] [PubMed]
- Aitken, R.J.; Gibb, Z.; Baker, M.A.; Drevet, J.; Gharagozloo, P. Causes and consequences of oxidative stress in spermatozoa. Reprod. Fertil. Dev. 2016, 28, 1–10. [Google Scholar] [CrossRef] [PubMed]
- LaRoche, A.S.; Kim, G. Chapter 2—Clinical Presentation of Youth Onset Type 2 Diabetes Mellitus. In Pediatric Type II Diabetes; Kim, G., Ed.; Elsevier: Amsterdam, The Netherlands, 2019; pp. 9–14. [Google Scholar] [CrossRef]
- Reed, M.J.; Meszaros, K.; Entes, L.J.; Claypool, M.D.; Pinkett, J.G.; Gadbois, T.M.; Reaven, G.M. A new rat model of type 2 diabetes: The fat-fed, streptozotocin-treated rat. Metab. Clin. Exp. 2000, 49, 1390–1394. [Google Scholar] [CrossRef] [PubMed]
- Magalhães, D.A.; Kume, W.T.; Correia, F.S.; Queiroz, T.S.; Allebrandt Neto, E.W.; Santos, M.P.D.; Kawashita, N.H.; França, S.A. High-fat diet and streptozotocin in the induction of type 2 diabetes mellitus: A new proposal. An. Acad. Bras. Cienc. 2019, 91, e20180314. [Google Scholar] [CrossRef] [Green Version]
- Srinivasan, K.; Viswanad, B.; Asrat, L.; Kaul, C.L.; Ramarao, P. Combination of high-fat diet-fed and low-dose streptozotocin-treated rat: A model for type 2 diabetes and pharmacological screening. Pharmacol. Res. 2005, 52, 313–320. [Google Scholar] [CrossRef]
- Campbell, I.W. Chapter 18—Metformin use in gestational diabetes. In Obesity and Obstetrics (Second Edition); Mahmood, T.A., Arulkumaran, S., Chervenak, F.A., Eds.; Elsevier: Amsterdam, The Netherlands, 2020; pp. 173–178. [Google Scholar] [CrossRef]
- Masoudi, F.A.; Inzucchi, S.E.; Wang, Y.; Havranek, E.P.; Foody, J.M.; Krumholz, H.M. Thiazolidinediones, metformin, and outcomes in older patients with diabetes and heart failure: An observational study. Circulation 2005, 111, 583–590. [Google Scholar] [CrossRef] [Green Version]
- Li, Y.; Ryu, C.; Munie, M.; Noorulla, S.; Rana, S.; Edwards, P.; Gao, H.; Qiao, X. Association of metformin treatment with reduced severity of diabetic retinopathy in type 2 diabetic patients. J. Diabetes Res. 2018, 2018. [Google Scholar] [CrossRef] [Green Version]
- Liu, Y.; Yang, Z.; Kong, D.; Zhang, Y.; Yu, W.; Zha, W. Metformin Ameliorates Testicular Damage in Male Mice with Streptozotocin-Induced Type 1 Diabetes through the PK2/PKR Pathway. Oxidative Med. Cell. Longev. 2019, 2019, 5681701. [Google Scholar] [CrossRef]
- Abd El-Hakim, Y.M.; Mohamed, W.A.; El-Metwally, A.E. Spirulina platensis attenuates furan reprotoxicity by regulating oxidative stress, inflammation, and apoptosis in testis of rats. Ecotoxicol. Environ. Saf. 2018, 161, 25–33. [Google Scholar] [CrossRef]
- Abd-Elhakim, Y.M.; Ghoneim, M.H.; Ebraheim, L.L.; Imam, T.S. Taurine and hesperidin rescues carbon tetrachloride-triggered testicular and kidney damage in rat via modulating oxidative stress and inflammation. Life Sci. 2020, 254, 117782. [Google Scholar] [CrossRef] [PubMed]
- Behairy, A.; El-Sharkawy, N.I.; Saber, T.M.; Soliman, M.M.; Metwally, M.M.M.; Abd El-Rahman, G.I.; Abd-Elhakim, Y.M.; El Deib, M.M. The Modulatory Role of Vitamin C in Boldenone Undecylenate Induced Testicular Oxidative Damage and Androgen Receptor Dysregulation in Adult Male Rats. Antioxidants 2020, 9, 1053. [Google Scholar] [CrossRef] [PubMed]
- Mohamed, A.A.-R.; Abdellatief, S.A.; Khater, S.I.; Ali, H.; Al-Gabri, N.A. Fenpropathrin induces testicular damage, apoptosis, and genomic DNA damage in adult rats: Protective role of camel milk. Ecotoxicol. Environ. Saf. 2019, 181, 548–558. [Google Scholar] [CrossRef] [PubMed]
- Elewa, Y.H.A.; Mohamed, A.A.-R.; Galal, A.A.A.; El-naseery, N.I.; Ichii, O.; Kon, Y. Food Yellow4 reprotoxicity in relation to localization of DMC1 and apoptosis in rat testes: Roles of royal jelly and cod liver oil. Ecotoxicol. Environ. Saf. 2019, 169, 696–706. [Google Scholar] [CrossRef]
- Chen, W.; Li, Y.; Yang, S.; Yue, L.; Jiang, Q.; Xia, W. Synthesis and antioxidant properties of chitosan and carboxymethyl chitosan-stabilized selenium nanoparticles. Carbohydr. Polym. 2015, 132, 574–581. [Google Scholar] [CrossRef]
- Chen, J.; Shi, X.; Zhan, Y.; Qiu, X.; Du, Y.; Deng, H. Construction of horizontal stratum landform-like composite foams and their methyl orange adsorption capacity. Appl. Surf. Sci. 2017, 397, 133–143. [Google Scholar] [CrossRef]
- Wang, H.; Zhang, J.; Yu, H. Elemental selenium at nano size possesses lower toxicity without compromising the fundamental effect on selenoenzymes: Comparison with selenomethionine in mice. Free Radic. Biol. Med. 2007, 42, 1524–1533. [Google Scholar] [CrossRef]
- Zhang, J.; Wang, X.; Xu, T. Elemental selenium at nano size (Nano-Se) as a potential chemopreventive agent with reduced risk of selenium toxicity: Comparison with se-methylselenocysteine in mice. Toxicol. Sci. 2008, 101, 22–31. [Google Scholar] [CrossRef] [Green Version]
- Zhang, J.-S.; Gao, X.-Y.; Zhang, L.-D.; Bao, Y.-P. Biological effects of a nano red elemental selenium. Biofactors 2001, 15, 27–38. [Google Scholar] [CrossRef]
- Chen, T.; Wong, Y.-S.; Zheng, W.; Bai, Y.; Huang, L. Selenium nanoparticles fabricated in Undaria pinnatifida polysaccharide solutions induce mitochondria-mediated apoptosis in A375 human melanoma cells. Colloids Surf. B Biointerfaces 2008, 67, 26–31. [Google Scholar] [CrossRef]
- Al-Quraishy, S.; Dkhil, M.A.; Moneim, A.E.A. Anti-hyperglycemic activity of selenium nanoparticles in streptozotocin-induced diabetic rats. Int. J. Nanomed. 2015, 10, 6741. [Google Scholar]
- Tu, H.; Yu, Y.; Chen, J.; Shi, X.; Zhou, J.; Deng, H.; Du, Y. Highly cost-effective and high-strength hydrogels as dye adsorbents from natural polymers: Chitosan and cellulose. Polym. Chem. 2017, 8, 2913–2921. [Google Scholar] [CrossRef]
- Abd El-Hack, M.E.; El-Saadony, M.T.; Shafi, M.E.; Zabermawi, N.M.; Arif, M.; Batiha, G.E.; Khafaga, A.F.; Abd El-Hakim, Y.M.; Al-Sagheer, A.A. Antimicrobial and antioxidant properties of chitosan and its derivatives and their applications: A review. Int. J. Biol. Macromol. 2020, 164, 2726–2744. [Google Scholar] [CrossRef] [PubMed]
- Taylor, S. Advances in Food and Nutrition Research; Elsevier: Amsterdam, The Netherlands, 2011. [Google Scholar]
- Luo, Y.; Zhang, B.; Cheng, W.-H.; Wang, Q. Preparation, characterization and evaluation of selenite-loaded chitosan/TPP nanoparticles with or without zein coating. Carbohydr. Polym. 2010, 82, 942–951. [Google Scholar] [CrossRef]
- Abdel-Rahman Mohamed, A.; Khater, S.I.; Hamed Arisha, A.; Metwally, M.M.M.; Mostafa-Hedeab, G.; El-Shetry, E.S. Chitosan-stabilized selenium nanoparticles alleviate cardio-hepatic damage in type 2 diabetes mellitus model via regulation of caspase, Bax/Bcl-2, and Fas/FasL- pathway. Gene 2020, 145288. [Google Scholar] [CrossRef]
- Abdulmalek, S.A.; Balbaa, M. Synergistic effect of nano-selenium and metformin on type 2 diabetic rat model: Diabetic complications alleviation through insulin sensitivity, oxidative mediators and inflammatory markers. PLoS ONE 2019, 14, e0220779. [Google Scholar] [CrossRef] [Green Version]
- Gheibi, S.; Bakhtiarzadeh, F.; Ghasemi, A. A review of high fat diet-streptozotocin model for induction of type 2 diabetes in rat. Iran. J. Endocrinol. Metab. 2016, 18, 135–148. [Google Scholar]
- Vickers, N.J. Animal Communication: When I’m Calling You, Will You Answer Too? Curr. Biol. 2017, 27, R713–R715. [Google Scholar] [CrossRef]
- Akbarzadeh, A.; Norouzian, D.; Mehrabi, M.; Jamshidi, S.; Farhangi, A.; Verdi, A.A.; Mofidian, S.; Rad, B.L. Induction of diabetes by streptozotocin in rats. Indian J. Clin. Biochem. 2007, 22, 60–64. [Google Scholar] [CrossRef] [Green Version]
- Meng, X.; Ma, X.; Tian, Y.; Jiang, Q.; Wang, L.; Shi, R.; Ding, L.; Pang, S. Metformin improves the glucose and lipid metabolism via influencing the level of serum total bile acids in rats with streptozotocin-induced type 2 diabetes mellitus. Eur. Rev. Med. Pharm. Sci. 2017, 21, 2232–2237. [Google Scholar]
- Zeng, S.; Ke, Y.; Liu, Y.; Shen, Y.; Zhang, L.; Li, C.; Liu, A.; Shen, L.; Hu, X.; Wu, H. Synthesis and antidiabetic properties of chitosan-stabilized selenium nanoparticles. Colloids Surf. B Biointerfaces 2018, 170, 115–121. [Google Scholar] [CrossRef] [PubMed]
- Slott, V.L.; Suarez, J.D.; Perreault, S.D. Rat sperm motility analysis: Methodologic considerations. Reprod. Toxicol. 1991, 5, 449–458. [Google Scholar] [CrossRef]
- Robb, G.; Amann, R.; Killian, G. Daily sperm production and epididymal sperm reserves of pubertal and adult rats. Reproduction 1978, 54, 103–107. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Filler, R. Methods for evaluation of rat epididymal sperm morphology. In Methods in Toxicology: Male Reproductive Toxicology; Chapin, R.E., Heildel, J.J., Eds.; Academic Press: San Diego, CA, USA, 1993; pp. 334–343. [Google Scholar]
- Zirkin, B.R.; Chen, H. Regulation of Leydig cell steroidogenic function during aging. Biol. Reprod. 2000, 63, 977–981. [Google Scholar] [CrossRef] [Green Version]
- Nair, V.; Turner, G.A. The thiobarbituric acid test for lipid peroxidation: Structure of the adduct with malondialdehyde. Lipids 1984, 19, 804–805. [Google Scholar] [CrossRef]
- Misra, H.P.; Fridovich, I. The role of superoxide anion in the autoxidation of epinephrine and a simple assay for superoxide dismutase. J. Biol. Chem. 1972, 247, 3170–3175. [Google Scholar]
- Sinha, A.K. Colorimetric assay of catalase. Anal. Biochem. 1972, 47, 389–394. [Google Scholar] [CrossRef]
- Arisha, A.H.; Ahmed, M.M.; Kamel, M.A.; Attia, Y.A.; Hussein, M.M. Morin ameliorates the testicular apoptosis, oxidative stress, and impact on blood–testis barrier induced by photo-extracellularly synthesized silver nanoparticles. Environ. Sci. Pollut. Res. 2019, 26, 28749–28762. [Google Scholar] [CrossRef]
- Khamis, T.; Abdelalim, A.F.; Abdallah, S.H.; Saeed, A.A.; Edress, N.M.; Arisha, A.H. Early intervention with breast milk mesenchymal stem cells attenuates the development of diabetic-induced testicular dysfunction via hypothalamic Kisspeptin/Kiss1r-GnRH/GnIH system in male rats. Biochim. Biophys. Acta (BBA) Mol. Basis Dis. 2020, 1866, 165577. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Suvarna, K.S.; Layton, C.; Bancroft, J.D. Bancroft’s Theory and Practice of Histological Techniques E-Book; Elsevier Health Sciences: Philadelphia, PA, USA; St. Louis, MO, USA, 2018. [Google Scholar]
- Eskander, E.; Ahmed, H.; Estefan, S. Hypoglycemic and insulinotropic action of gastropods (Lambis-lambis-L) extracts on alloxan diabetic male rats. Arab J. Lab. Med. 2000, 26, 185–201. [Google Scholar]
- Steinbrenner, H.; Speckmann, B.; Pinto, A.; Sies, H. High selenium intake and increased diabetes risk: Experimental evidence for interplay between selenium and carbohydrate metabolism. J. Clin. Biochem. Nutr. 2010, 48, 40–45. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Safhi, M.M.; Anwer, T.; Khan, G.; Siddiqui, R.; Moni Sivakumar, S.; Alam, M.F. The combination of canagliflozin and omega-3 fatty acid ameliorates insulin resistance and cardiac biomarkers via modulation of inflammatory cytokines in type 2 diabetic rats. Korean J. Physiol. Pharmacol. 2018, 22, 493–501. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Grunewald, S.; Said, T.; Paasch, U.; Glander, H.J.; Agarwal, A. Relationship between sperm apoptosis signalling and oocyte penetration capacity. Int. J. Androl. 2008, 31, 325–330. [Google Scholar] [CrossRef]
- Yi, W.E.I.; Xiang-Liang, T.; Yu, Z.; Bin, L.; Lian-Ju, S.; Chun-Lan, L.; Tao, L.I.N.; Da-Wei, H.E.; Sheng-de, W.U.; Guang-Hui, W.E.I. DEHP exposure destroys blood-testis barrier (BTB) integrity of immature testes through excessive ROS-mediated autophagy. Genes Dis. 2018, 5, 263–274. [Google Scholar] [CrossRef]
- Chen, N.; Su, P.; Wang, M.; Li, Y.-M. Ascorbic acid inhibits cadmium-induced disruption of the blood-testis barrier by regulating oxidative stress-mediated p38 MAPK pathways. Environ. Sci. Pollut. Res. 2018, 25, 21713–21720. [Google Scholar] [CrossRef]
- Condorelli, R.A.; La Vignera, S.; Mongioì, L.M.; Alamo, A.; Calogero, A.E. Diabetes mellitus and infertility: Different pathophysiological effects in type 1 and type 2 on sperm function. Front. Endocrinol. 2018, 9, 268. [Google Scholar] [CrossRef] [Green Version]
- La Vignera, S.; Condorelli, R.; Vicari, E.; D’Agata, R.; Calogero, A.E. Diabetes mellitus and sperm parameters. J. Androl. 2012, 33, 145–153. [Google Scholar] [CrossRef]
- Owumi, S.E.; Adedara, I.A.; Farombi, E.O.; Oyelere, A.K. Protocatechuic acid modulates reproductive dysfunction linked to furan exposure in rats. Toxicology 2020, 442, 152556. [Google Scholar] [CrossRef]
- Bertoldo, M.J.; Guibert, E.; Tartarin, P.; Guillory, V.; Froment, P. Effect of metformin on the fertilizing ability of mouse spermatozoa. Cryobiology 2014, 68, 262–268. [Google Scholar] [CrossRef]
- Zhou, G.; Myers, R.; Li, Y.; Chen, Y.; Shen, X.; Fenyk-Melody, J.; Wu, M.; Ventre, J.; Doebber, T.; Fujii, N. Role of AMP-activated protein kinase in mechanism of metformin action. J. Clin. Investig. 2001, 108, 1167–1174. [Google Scholar] [CrossRef] [PubMed]
- Tartarin, P.; Guibert, E.; Touré, A.; Ouiste, C.; Leclerc, J.; Sanz, N.; Brière, S.; Dacheux, J.-L.; Delaleu, B.; McNeilly, J.R. Inactivation of AMPKα1 induces asthenozoospermia and alters spermatozoa morphology. Endocrinology 2012, 153, 3468–3481. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Martin-Hidalgo, D.; de Llera, A.H.; Yeste, M.; Gil, M.C.; Bragado, M.J.; Garcia-Marin, L.J. Adenosine monophosphate-activated kinase, AMPK, is involved in the maintenance of the quality of extended boar semen during long-term storage. Theriogenology 2013, 80, 285–294. [Google Scholar] [CrossRef] [PubMed]
- De Llera, A.H.; Martin-Hidalgo, D.; Gil, M.C.; Garcia-Marin, L.J.; Bragado, M.J. AMP-activated kinase AMPK is expressed in boar spermatozoa and regulates motility. PLoS ONE 2012, 7, e38840. [Google Scholar]
- Liu, L.; He, Y.; Xiao, Z.; Tao, W.; Zhu, J.; Wang, B.; Liu, Z.; Wang, M. Effects of selenium nanoparticles on reproductive performance of male Sprague-Dawley rats at supranutritional and nonlethal levels. Biol. Trace Elem. Res. 2017, 180, 81–89. [Google Scholar] [CrossRef]
- Schoeller, E.L.; Schon, S.; Moley, K.H. The effects of type 1 diabetes on the hypothalamic, pituitary and testes axis. Cell Tissue Res. 2012, 349, 839–847. [Google Scholar] [CrossRef] [Green Version]
- Al Hayek, A.A.; Robert, A.A.; Alshammari, G.; Hakami, H.; Al Dawish, M.A. Assessment of hypogonadism in men with type 2 diabetes: A cross-sectional study from Saudi Arabia. Clin. Med. Insights Endocrinol. Diabetes 2017, 10, 1179551417710209. [Google Scholar] [CrossRef] [Green Version]
- Ahangarpour, A.; Oroojan, A.A.; Heidari, H.; Ghaedi, E.; Taherkhani, R. effects of hydro-alcoholic extract from arctium lappa l.(burdock) root on gonadotropins, testosterone, and sperm count and viability in male mice with nicotinamide/streptozotocin-induced type 2 diabetes. Malays. J. Med. Sci. 2015, 22, 25. [Google Scholar]
- Nasrolahi, O.; Khaneshi, F.; Rahmani, F.; Razi, M. Honey and metformin ameliorated diabetes-induced damages in testes of rat; correlation with hormonal changes. Iran. J. Reprod. Med. 2013, 11, 1013. [Google Scholar]
- Faure, M.; Bertoldo, M.J.; Khoueiry, R.; Bongrani, A.; Brion, F.; Giulivi, C.; Dupont, J.; Froment, P. Metformin in reproductive biology. Front. Endocrinol. 2018, 9, 675. [Google Scholar] [CrossRef] [Green Version]
- Hozyen, H.F.; Khalil, H.M.A.; Ghandour, R.A.; Al-Mokaddem, A.K.; Amer, M.S.; Azouz, R.A. Nano selenium protects against deltamethrin-induced reproductive toxicity in male rats. Toxicol. Appl. Pharmacol. 2020, 408, 115274. [Google Scholar] [CrossRef] [PubMed]
- Han, X.X.; Jiang, Y.P.; Liu, N.; Wu, J.; Yang, J.M.; Li, Y.X.; Sun, M.; Sun, T.; Zheng, P.; Jian-Qiang, Y. Protective effects of Astragalin on spermatogenesis in streptozotocin-induced diabetes in male mice by improving antioxidant activity and inhibiting inflammation. Biomed. Pharmacother. 2019, 110, 561–570. [Google Scholar] [CrossRef] [PubMed]
- Matough, F.A.; Budin, S.B.; Hamid, Z.A.; Alwahaibi, N.; Mohamed, J. The role of oxidative stress and antioxidants in diabetic complications. Sultan Qaboos Univ. Med. J. 2012, 12, 5. [Google Scholar] [CrossRef] [PubMed]
- Chodari, L.; Smailnejad, S.; Fallahi, M.; Khalaji, N.; Ghorbanzadeh, V. Oxidative stress is markedly reduced by combined voluntary exercise and testosterone in the heart of diabetic rats. Acta Endocrinol. 2019, 15, 173. [Google Scholar] [CrossRef]
- Cabrales, P.; Vázquez, M.A.S.; Vázquez, B.Y.S.; Rodríguez-Morán, M.; Intaglietta, M.; Guerrero-Romero, F. Blood pressure reduction due to hemoglobin glycosylation in type 2 diabetic patients. Vasc. Health Risk Manag. 2008, 4, 917. [Google Scholar] [CrossRef] [Green Version]
- Adeshara, K.A.; Bangar, N.S.; Doshi, P.R.; Diwan, A.; Tupe, R.S. Action of metformin therapy against advanced glycation, oxidative stress and inflammation in type 2 diabetes patients: 3 months follow-up study. Diabetes Metab. Syndr. Clin. Res. Rev. 2020, 14, 1449–1458. [Google Scholar] [CrossRef]
- Beisswenger, P.; Ruggiero-Lopez, D. Metformin inhibition of glycation processes. Diabetes Metab. 2003, 29, S95–S96. [Google Scholar] [CrossRef]
- Rossmeisl, M.; Rim, J.S.; Koza, R.A.; Kozak, L.P. Variation in type 2 diabetes-related traits in mouse strains susceptible to diet-induced obesity. Diabetes 2003, 52, 1958–1966. [Google Scholar] [CrossRef] [Green Version]
- Premalatha, R.; Jubendradass, R.; Rani, S.J.A.; Srikumar, K.; Mathur, P.P. A phytooxysterol, 28-homobrassinolide modulates rat testicular steroidogenesis in normal and diabetic rats. Reprod. Sci. 2013, 20, 589–596. [Google Scholar] [CrossRef] [Green Version]
- Bremer, A.; Miller, W. Chapter 13–Regulation of Steroidogenesis. Cell. Endocrinol. Health Dis. 2014, 207–227. [Google Scholar] [CrossRef]
- Chien, Y.; Cheng, W.-C.; Wu, M.-R.; Jiang, S.-T.; Shen, C.-K.J.; Chung, B.-c. Misregulated progesterone secretion and impaired pregnancy in Cyp11a1 transgenic mice. Biol. Reprod. 2013, 89, 91–110. [Google Scholar] [CrossRef] [PubMed]
- Nna, V.; Bakar, A.; Ahmad, A.; Mohamed, M. Down-regulation of steroidogenesis-related genes and its accompanying fertility decline in streptozotocin-induced diabetic male rats: Ameliorative effect of metformin. Andrology 2019, 7, 110–123. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mindnich, R.; Haller, F.; Halbach, F.; Moeller, G.; De Angelis, M.H.; Adamski, J. Androgen metabolism via 17β-hydroxysteroid dehydrogenase type 3 in mammalian and non-mammalian vertebrates: Comparison of the human and the zebrafish enzyme. J. Mol. Endocrinol. 2005, 35, 305–316. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lardone, M.; Piottante, A.; Valdevenito, R.; Ebensperger, M.; Castro, A. Histological and hormonal testicular function in oligo/azoospermic infertile men. Andrologia 2013, 45, 379–385. [Google Scholar] [CrossRef]
- Palmeira, C.M.; Santos, D.L.; Seiça, R.; Moreno, A.J.; Santos, M.S. Enhanced mitochondrial testicular antioxidant capacity in Goto-Kakizaki diabetic rats: Role of coenzyme Q. Am. J. Physiol. Cell Physiol. 2001, 281, C1023–C1028. [Google Scholar] [CrossRef]
- Sahin, E.; Colla, S.; Liesa, M.; Moslehi, J.; Müller, F.L.; Guo, M.; Cooper, M.; Kotton, D.; Fabian, A.J.; Walkey, C. Telomere dysfunction induces metabolic and mitochondrial compromise. Nature 2011, 470, 359–365. [Google Scholar] [CrossRef] [Green Version]
- Rajender, S.; Rahul, P.; Mahdi, A.A. Mitochondria, spermatogenesis and male infertility. Mitochondrion 2010, 10, 419–428. [Google Scholar] [CrossRef]
- Ghasemnejad-berenji, M.; Ghazi-Khansari, M.; Pashapour, S.; Jafari, A.; Yazdani, I.; Ghasemnejad-berenji, H.; Saeedi Saravi, S.S.; Sadeghpour, S.; Nobakht, M.; Abdollahi, A.; et al. Synergistic effect of rapamycin and metformin against germ cell apoptosis and oxidative stress after testicular torsion/detorsion-induced ischemia/reperfusion in rats. Biomed. Pharmacother. 2018, 105, 645–651. [Google Scholar] [CrossRef]
- Abd ElShaheed, A.; El-Shamy, K.; Mekhael, T.; Adly, F.; Boulos, R.; Ibrahim, S.; Fadl, N. 455 Improvement of Serum Testosterone in Diabetic Rats Treated with Metformin and Nigella Sativa. Arch. Dis. Child. 2012, 97, A133. [Google Scholar] [CrossRef] [Green Version]
Gene | Forward Primer (5′–3′) | Reverse Primer (5′–3′) | Accession No | Product Size |
---|---|---|---|---|
StAr | CCCAAATGTCAAGGAAATCA | AGGCATCTCCCCAAAGTG | NM_031558.3 | 187 |
CYP11A1 | AAGTATCCGTGATGTGGG | TCATACAGTGTCGCCTTTTCT | NM_017286.3 | 127 |
CYP17A1 | TGGCTTTCCTGGTGCACAATC | TGAAAGTTGGTGTTCGGCTGAAG | NM_012753.2 | 90 |
HSD17B3 | AGTGTGTGAGGTTCTCCCGGTACCT | TACAACATTGAGTCCATGTCTGGCCAG | NM_054007.1 | 161 |
CYP19A1 | GCTGAGAGACGTGGAGACCTG | CTCTGTCACCAACAACAGTGTGG | NM_017085.2 | 178 |
PGC1-α | ATGTGTCGCCTTCTTGCTCT | ATCTACTGCCTGGGGACCTT | NM_031347.1 | 180 |
SIRT1 | GGCACCGATCCTCGAACAAT | CGCTTTGGTGGTTCTGAAAGG | NM_001372090.1 | 119 |
GAPDH | GGCACAGTCAAGGCTGAGAATG | ATGGTGGTGAAGACGCCAGTA | NM_017008.4 | 143 |
Lesion | Control | HFD/STZ | HFD/STZ+MF | HFD/STZ+CH-SeNPs | HFD/STZ+MF+CH-SeNps |
---|---|---|---|---|---|
Spermatogonial cells/ST | 66.90 a± 1.16 | 48.50 c ± 0.96 | 59.80 b ± 1.16 | 49.90 c ± 0.92 | 62.50 b ± 0.86 |
Spermatocytes/ST | 147.30 a ± 1.46 | 105.10 d ± 1.37 | 128.30 c ± 3.25 | 111.50 e ± 1.42 | 140.70 b ± 1.80 |
Spermatid/ST | 221.30 a ± 5.14 | 170.40 c ± 2.97 | 199.30 b ± 1.04 | 174.70 c ± 2.41 | 212.60 a ± 3.69 |
Sertoli cells/ST | 30.50 a ± 0.48 | 26.20 b ± 0.88 | 29.30 a ± 0.70 | 26.60 b ± 0.78 | 29.80 a ± 0.59 |
Leydig cells/intertubular area | 13.60 a ± 0.45 | 10.40 b ± 0.45 | 12.30 a ± 0.52 | 10.80 b ± 0.39 | 12.60 a ± 0.43 |
Height of germinal epithelium | 83.22 a ± 1.70 | 58.09 c ± 1.94 | 77.04 b ± 2.50 | 55.55 c ± 1.83 | 80.16 ab ± 2.02 |
Numbers of STs/10X | 14.20 b ± 0.36 | 18.20 a ± 0.33 | 14.80 b ± 0.44 | 17.20 a ± 0.47 | 14.50 b ±0.22 |
Mean diameter of ST | 255.36 a ± 1.37 | 224.74 b ± 4.67 | 248.23 a ± 1.63 | 229.27 b ± 1.87 | 252.93 a ± 1.06 |
STs with vacuolated germinal epithelium | 0.00 d ± 0.00 | 7.38 a ± 0.32 | 4.04 c ± 0.23 | 5.57 b ± 0.33 | 3.55 c ± 0.28 |
STs with desquamated germinal epithelium | 0.00 d ± 0.00 | 20.10 a ± 1.32 | 11.14 b ± 1.23 | 17.10 a ± 1.77 | 3.74 c ± 0.42 |
STs with depleted germ cells | 0.00 e ± 0.00 | 15.88 a ±1.34 | 7.36 c ± 0.23 | 11.91 b ± 0.75 | 3.58 d ± 0.33 |
STs with necrotic and or complete loss of germinal epithelium | 0.00 e ± 0.00 | 4.83 a ± 0.43 | 2.05 c ± 0.17 | 3.53 b ± 0.22 | 1.10 d ± 0.10 |
STs with multinucleated giant cell formation | 0.00 b ± 0.00 | 3.07 a ± 1.19 | 1.00 b ± 0.12 | 1.31 b ± 0.07 | 0.40 b ± 0.17 |
STs with spermatid retention | 0.00 c ± 0.00 | 0.86 ab ± 0.31 | 0.75 abc ± 0.33 | 1.09 a ± 0.31 | 0.25 bc ± 0.17 |
STs with uneven, or redundant or broken basal lamina | 0.00 e ± 0.00 | 14.47 a ± 1.01 | 7.40 c ±0.43 | 10.94 b ± 1.00 | 3.06 d ± 0.45 |
Interstitial leukocytic infiltration | 0.00 b ± 0.00 | 10.66 a ± 1.71 | 3.00 b ± 0.92 | 9.00 a ± 1.58 | 1.00 b ± 0.51 |
Interstitial edema | 0.00 b ±0.00 | 12.67 a ± 1.47 | 2.33 b ± 1.00 | 10.67 a ± 2.42 | 3.33 b ± 1.99 |
Interstitial congestion | 0.00 d ± 0.00 | 15.33 a ± 1.87 | 4.33 c ± 0.71 | 9.97 b ± 1.78 | 2.66 c d ± 0.83 |
Interstitial hemorrhage | 0.00 b ± 0.00 | 2.33 a ± 0.71 | 1.00 b ± 0.51 | 0.67 b ± 0.44 | 0.33 b ± 0.33 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Abd El-Hakim, Y.M.; Abdel-Rahman Mohamed, A.; Khater, S.I.; Hamed Arisha, A.; Metwally, M.M.M.; Nassan, M.A.; Hassan, M.E. Chitosan-Stabilized Selenium Nanoparticles and Metformin Synergistically Rescue Testicular Oxidative Damage and Steroidogenesis-Related Genes Dysregulation in High-Fat Diet/Streptozotocin-Induced Diabetic Rats. Antioxidants 2021, 10, 17. https://doi.org/10.3390/antiox10010017
Abd El-Hakim YM, Abdel-Rahman Mohamed A, Khater SI, Hamed Arisha A, Metwally MMM, Nassan MA, Hassan ME. Chitosan-Stabilized Selenium Nanoparticles and Metformin Synergistically Rescue Testicular Oxidative Damage and Steroidogenesis-Related Genes Dysregulation in High-Fat Diet/Streptozotocin-Induced Diabetic Rats. Antioxidants. 2021; 10(1):17. https://doi.org/10.3390/antiox10010017
Chicago/Turabian StyleAbd El-Hakim, Yasmina M., Amany Abdel-Rahman Mohamed, Safaa I. Khater, Ahmed Hamed Arisha, Mohamed M. M. Metwally, Mohamed A. Nassan, and Manal Ewaiss Hassan. 2021. "Chitosan-Stabilized Selenium Nanoparticles and Metformin Synergistically Rescue Testicular Oxidative Damage and Steroidogenesis-Related Genes Dysregulation in High-Fat Diet/Streptozotocin-Induced Diabetic Rats" Antioxidants 10, no. 1: 17. https://doi.org/10.3390/antiox10010017
APA StyleAbd El-Hakim, Y. M., Abdel-Rahman Mohamed, A., Khater, S. I., Hamed Arisha, A., Metwally, M. M. M., Nassan, M. A., & Hassan, M. E. (2021). Chitosan-Stabilized Selenium Nanoparticles and Metformin Synergistically Rescue Testicular Oxidative Damage and Steroidogenesis-Related Genes Dysregulation in High-Fat Diet/Streptozotocin-Induced Diabetic Rats. Antioxidants, 10(1), 17. https://doi.org/10.3390/antiox10010017