You are currently viewing a new version of our website. To view the old version click .
Brain Sciences
  • Article
  • Open Access

26 February 2025

Phylogeny and Molecular Characterisation of PRNP in Red-Tailed Phascogale (Phascogale calura)

,
,
,
,
and
School of Medicine, Western Sydney University, Sydney, NSW 2560, Australia
*
Author to whom correspondence should be addressed.
This article belongs to the Section Molecular and Cellular Neuroscience

Abstract

Background/Objectives: The normal cellular prion protein (PrPC) is a cell-surface glycoprotein, mainly localised in neurons of the central nervous system (CNS). The human PRNP gene encodes 253 amino acid residues of precursor PrPC. Several studies that investigated the role of PRNP and PrPC in placental mammals, such as humans and mice, failed to reveal its exact function. Methods: In this study, we sequenced and characterised the PRNP gene and PrPC of the marsupial, P. calura, as a strategy to gain molecular insights into its structure and physicochemical properties. Placentals are separated from marsupials by approximately 125 million years of independent evolution. Results: Standard Western blotting analysis of PrPC phascogale displayed the typical un-, mono-, and di-glycosylated bands recognized in placentals. Furthermore, we showed that phascogale PRNP gene has two exons, similar to all the marsupials and placentals of the PRNP genes studied. Of note, the phascogale PRNP gene contained distinctive repeats in the PrPC tail region comparable to the closely related Tasmanian devil (Sarcophilus harrisii) and more distantly related to the grey short-tailed opossum (Monodelphis domestica), common wombat (Vombatus ursinus), and Tammar wallaby (Macropus eugenii); however, its specific composition and numbers were different from placentals. Of importance, comparisons of the phascogale’s PrPC physicochemical properties with other monotremes, marsupials, and placentals confirmed the Monotremata–Marsupialia–Placentalia evolutionary distance. We found that the protein instability index, a method used to predict the stability of a protein in vivo (Stable: <40; Instable >40), showed that the PrPC of all marsupials tested, including phascogale, were highly stable compared with the birds, reptiles, amphibians, and fish that were shown to be highly unstable. However, the instability index predicted that all placental species, including human (Homo sapiens), mouse (Mus musculus), bank vole (Myodes glareolus), rhinoceros (Rhinocerotidae), dog (Canis lupus familiaris), flying fox (Pteropus vampyrus), whale (Physeter catodon), cattle (Bos taurus), and sheep (Ovis aries), were either slightly unstable or nearly unstable. Further, our analysis revealed that despite their predicted high PrPC stability, P. calura exhibited substantial N-terminal disorder (53.76%), while species with highly unstable PrPCs based on their instability index, such as Danio rerio, Oryzias latipes, and Astyanax mexicanus, displayed even higher levels of N-terminal disorder (up to 75.84%). These findings highlight a discrepancy between overall predicted stability and N-terminal disorder, suggesting a potential compensatory role of disorder in modulating prion protein stability and function. Conclusions: These results suggest that the high stability of marsupial prion proteins indicates a vital role in maintaining protein homeostasis; however more work is warranted to further depict the exact function.

1. Introduction

The normal cellular prion protein (PrPC) is a cell-surface glycoprotein, mainly localised in the neurons of the central nervous system (CNS), with low levels of expression in peripheral organs [1]. The human PRNP is encoded to generate a precursor PrPC, which is 253 amino acid residues long [2]. The precursor PrPC contains two primary domains, a disordered N-terminal region and a structured C-terminal domain, which are processed through two cleavage events [2,3]. The N-terminal region consists of an octarepeat and a hydrophobic region, and the C-terminal domain contains three α-helices, two β-sheets, and a signal sequence attached to a glycosylphosphatidylinositol (GPI) lipid anchor [3]. The cleavage event produces a mature PrPC (208 amino acids in length) linked to the cell membrane via a C-terminal GPI lipid anchor [2,3,4]. PrPC has an aggregated, β-sheet-rich counterpart, referred to as scrapie prion protein (PrPSc) [5,6]. The conversion of PrPC to PrPSc can occur via three different processes, including mutations of the PRNP gene that facilitate conversion of the normal to the diseased isoform, horizontal infection with biological materials containing PrPSc, or spontaneous conversion of unknown origin [7,8]. The misfolding of PrPC results in the development of multiple neurodegenerative diseases, such as kuru and Creutzfeldt–Jakob disease (CJD) in humans, scrapie of goats and sheep, and bovine spongiform encephalopathy in cattle [7,9,10]. PrPSc contains the same amino acid sequence as PrPC; however, it has different physicochemical features such as increased proportion of β-sheet structures, reduced solubility in non-ionic detergents, and partial resistance to protease digestion, such as proteinase K (PK) and thermolysin (THL) [11,12]. PK treatment digests the N-terminal end between residues 23 and 89 to create the truncated PrPSc isoform, termed PrP27-30 or PrPres, although it has been documented that PrPSc could be sensitive to PK digestion [13]. Prior to PK digestion, PrPC normally exhibits a 3-band pattern, including mono-, di- and unglycosylated forms of PrP ranging between approximately 25 and 39 kDa [14]. In comparison, when PrPSc is treated with PK, a 3-band pattern profile between 18 and 30 kDa is displayed on Western blot [15]. In contrast, treatments with THL also digests PrPC while preserving the full length PrPSc isoform, composed of PK-resistant and PK-sensitive PrPSc [11,16].
There are various types of PrPSc that have been classified based on their codon 129 status, molecular mass, fragment size when separated through SDS-PAGE, and degree of glycosylation [17]. Type 1, 2, and 6 of PrPSc are from sporadic CJD, type 3 is found in acquired CJD [17,18], and type 4 and 5 are associated with variant CJD [18,19,20,21]. Sporadic CJD cases are typically found to be homozygous for either methionine or valine at codon 129 in human PrP, which is associated with genetic susceptibility to prion disease [22,23,24]. Following protease digestion, the 3-band pattern of the types 1–6 range are approximately between 16 and 40 kDa [17,18,20]. Metal ion binding to PrPSc samples can alter the protein conformation and cause a band pattern shift [25]. There are discrepancies in the classification of PrPSc types due to the heterogeneity associated with the PrPSc samples used [26]. The classification of PrPSc types is based on glycoform profiles that have been reported as types 1–3 [17] and other types, types 1 and 2 [26]. Types 1–2 identified by Hill and colleagues (2003) equate to the single type PrPSc [26], and type 3 [17] corresponds to type 2 [26].
The function of the prion protein is not well understood, with multiple reports identifying a diverse repertoire of PrPC functions, such as copper binding [27], T cell activation [28], and cell proliferation and differentiation [29,30]. A previous report from Premzl and colleagues (2005) described the PRNP gene structure of the Australian marsupial, Tammar wallaby following comparative genomics with a number of species. Interestingly, the authors showed that the Tammar wallaby displayed distinct repeats in the N terminal region [31], which has been linked to changes in conformational flexibility and phenotypic variability [32]. Comparison of the Tammar wallaby PRNP with other species also identified putative regulatory regions [33] and a possible interaction of PrPC with MZF-1, MEF2, MyT1, Oct-1, and NFAT transcription factors, indicating its involvement in synaptic plasticity and signal transduction [31,34,35]. A previous study also compared the expression pattern of PrPC in the CNS between the metatherian South American short-tailed opossum (Monodelphis domestica) and mouse [36]. This study found PrPC expression varied between different regions of the CNS and during brain development between both species. This suggests differences in neurodevelopment between opossum and mouse and potentially extending to other species encoding PrPC. Additionally, these differences in PrPC expression and distribution may also affect other features such as the susceptibility to prions [36].
In this study, we focused on the characterisation of PrPC in P. calura [37], hereafter referred to as phascogale PrPC. The physicochemical properties of phascogale PrPC were examined and compared with placentals, such as human and mouse, which are separated from marsupials by approximately 125 million years [38,39]. P. calura is an arboreal, insectivorous marsupial, belonging to the Dasyuridae [40]. The males of this species follow a semelparous reproduction pattern where total mortality among the adult males occurs after a single breeding period [41]. Previous molecular and histological studies on P. calura have primarily focused on investigating the cause of premature death in adult males after breeding [42,43], in the development of the P. calura’s immune tissues [44,45], and on various components of the immune system, such as the major histocompatibility complex and T-cell receptors [46,47]. This work is the first report describing the characterisation of PrPC in P. calura. Our study shows a comparative analysis of the molecular and physicochemical properties of phascogale PrPC with other species. The results of this comparative analysis confirm the evolutionary distance of the PrPC sequence and stability in Monotremata, Marsupialia, and Placentalia. The comparison of the predicted instability index between species showed the highest stable form of PrPC was found in P. calura and other marsupials. The presence of varying molecular and physicochemical properties in different species can provide insight into the evolution of the protein sequence and stability of PrPC. By extension, this might help with the understanding of the function(s) of PrPC.

2. Materials and Methods

2.1. Animal and Ethics

The 6 male and 2 female phascogale brain tissues used in this study are not subject to animal ethics guidelines. In accordance with the 3Rs, brain tissues were sourced from another independent study performed in accordance with the Australian Code for the Care and Use of Animals for Scientific Purposes and the New South Wales Animal Research Act and its Regulations. All protocols and standard operating procedures were approved by the WSU Animal Care and Ethics Committee and the NSW NPWS [46]. A full ethics statement under which the previous study was conducted can be found in [46].

2.2. Tissue Preparation and Homogenisation

Prior to removing of whole brains, P. calura carcasses were stored at −80 °C until further use. Whole brains were then removed from 6 males and 2 females, weighed, and homogenised in phosphate buffered saline (PBS) (Precellys 24 lysis and homogenisation machine, Bertin technologies, Montigny-le-Bretonneux, France) and aliquoted as 10% (w/v) stock solutions until further use.

2.3. Enzymatic Digestion with Proteinase K

Brain homogenates (10% w/v) were treated with proteinase K (PK). Samples were treated with 50 µg/mL PK, then placed on a shaker at 37 °C for 1 h.

2.4. Western Blotting Analysis

Brain tissues from phascogales were homogenised (10% w/v in PBS) using a Precellys® 24 tissue homogeniser (Thermo Fisher Scientific, Scoresby, VIC, Australia), and centrifuged for 15 min at 1000× g. The supernatants were stored at −80 °C until use. Homogenates were diluted to 0.5% in complete Lysis-M buffer with Pefabloc SC plus protease inhibitors (Roche, Millers Point, NSW, Australia). Brain homogenates (10% w/v) were mixed with Laemmlie buffer (0.5%) (BioRad Laboratories, South Granville, NSW, Australia), then boiled at 95 °C for 5 min. Samples were loaded and separated by SDS-PAGE in 12% Tris-Glycine eXtended (TGX) gels (BioRad Laboratories Australia). Electrophoresis was conducted at 200 V for 5 min, and reduced to 100 V for 125 min. Next, proteins were transferred onto polyvynilidine fluoride (PVDF) membranes (BioRad Laboratories Australia) by electroblotting at 18 V for 2.5 h. Membranes were blocked with 5% skimmed milk on a shaker (42 rpm) for 1 h at RT. Membranes were then incubated overnight with the following anti-prion antibodies: SAF32 (1 µg/mL) or SAF70 (1 µg/mL). The membranes were then washed with phosphate buffer saline with 0.05% Tween 20 (PBST) prior to incubation with secondary anti-mouse IgG (1:3000) (Sigma Life Science, Melbourne, VIC, Australia). The membranes were then coated with ECL chemiluminescent substrate (ClarityTM Western ECL substrate, BioRad Australia) for 5 min. Finally, membranes were imaged on iBright FL1000 (Thermo Fisher Scientific Australia).

2.5. Primer Design, DNA Extraction, PCR Amplification and Sequencing

Sequencing primers for phascogale PRNP were designed using the Tasmanian devil PRNP as a template (NCBI gene ID: 100927381). Using the Tasmanian devil PRNP as the DNA template sequence, the physical properties were determined using Oligocalc (version 3.27). Next, using the properties determined by Oligocalc, primers were generated by NCBI Primer-BLAST. Primer pairs generated by NCBI Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/ (accessed on 4 February 2022)) were validated using the in silico validation tool, Gene Runner (version 6.5.52).
DNA was extracted according to the manufacturer’s directions of the DNeasy Blood & Tissue Kit (Qiagen, Clayton, VIC, Australia). The concentration and purity of the extracted DNA was measured on a Qubit Flurometer (Thermo Fisher Scientific, Inc. Waltham, MA, USA). The extracted DNA was amplified in a PCR with a final reaction volume of 20 µL that included 10 µL of Invitrogen™ Platinum™ II Hot-Start Green PCR Master Mix (2×) (Thermo Fisher Scientific, Inc. Waltham, MA, USA), 5 pmol from each primer, and 20 ng of DNA. The PCR conditions were: 40 cycles at 94 °C for 20 s, followed by 60 °C for 20 s, and finally 68 °C for 30 s. FWD primer—AGATCAGCTACCATGGGAAAAATC—and REV primer—CTTGCAGACTGAAGGATTCCC—were used. PCR products were purified using Invitrogen PureLink® PCR Purification Kit (Thermo Fisher Scientific, Inc. Waltham, MA, USA). Purified PCR products were sequenced in a Sanger sequencing reaction that included 27 ng of purified PCR production and 10 pmol of primer and yielded 801 base pairs. The sequencing was conducted by the Australian Genome Research Facility (AGRF) (Westmead Institute, Westmead, NSW, Australia).

2.6. Sequence and Comparative Alignment

The sequenced PRNP from phascogale was viewed using the SnapGene viewer program (from Insightful Science; available at https://www.snapgene.com/ (accessed on 4 February 2022)) and aligned to a sequence database using the NCBI BLAST tool. The ORF and protein sequence of PRNP were determined using NCBI ORF finder. The DNA sequence of phascogale PRNP was aligned using the Clustal 2.1 Alignment tool, then the comparative protein alignments were carried out using the Clustal Omega program (version 2.0) from UniProt (https://www.uniprot.org/ (accessed on 4 February 2022)).

2.7. Defining the Exon–Intron Structure of the Phascogale PRNP Gene

2.7.1. Sequence Alignment for Exon Prediction

The genomic sequence of the phascogale PRNP gene, obtained through Sanger sequencing, was aligned with known annotated PRNP sequences from closely related marsupials (e.g., Tasmanian devil, grey short-tailed opossum) using Clustal Omega for multi-sequence alignment. Conserved regions corresponding to the coding exons were identified based on sequence similarity and evolutionary conservation.

2.7.2. Open Reading Frame (ORF) Identification

The NCBI ORF Finder tool (https://www.ncbi.nlm.nih.gov/orffinder/ (accessed on 4 February 2022)) was used to identify the open reading frame (ORF) of the phascogale PRNP sequence. Exon regions were delineated by mapping the ORF to the sequenced genomic region. The ORF boundaries provided initial predictions of exon start and end positions.

2.7.3. Genomic Annotation of Exon–Intron Boundaries

Exon–intron boundaries were predicted by comparing the genomic sequence with transcriptome data for the phascogale, as well as RNA sequences of related marsupial species (e.g., Tasmanian devil). BLAST (Basic Local Alignment Search Tool) was used to map known PRNP mRNA or cDNA sequences from other marsupials to the phascogale genomic sequence. Conserved donor (GT) and acceptor (AG) splice sites at the exon–intron junctions were identified using NetGene2 (https://services.healthtech.dtu.dk/service.php?NetGene2-2.42 (accessed on 4 February 2022)).

2.7.4. Validation with Known Gene Structures

The exon–intron structure was cross-validated with the annotated PRNP gene structures in related species available in public databases, including Tasmanian devil (NCBI Gene ID: 100927381) and the grey short-tailed opossum (Monodelphis domestica, NCBI Gene ID: 554189). Comparison ensured that the predicted exon–intron organization of phascogale PRNP followed the typical two-exon structure found in marsupials and placentals.

2.7.5. Functional Annotation and Final Confirmation

The predicted exon regions were confirmed by translating the sequence into amino acids and aligning the translated product with known PrPC protein sequences from other marsupials. Any discrepancies were addressed by re-evaluating splice site predictions and transcript alignments.

2.8. Analysis of the Physicochemical Properties of Phascogale PrPC

We retrieved the prion protein sequences from the Uniprot database (https://www.uniprot.org/ (accessed on 4 February 2022)) for different species to analyse the physicochemical properties. We used phascogale male protein sequences and the sequences of multiple other species for comparative analysis using the expert protein analysis system ExPASy ProtParam server (https://web.expasy.org/protparam/ (accessed on 4 February 2022)) [48]. We considered the theoretical PI, the aliphatic index (AI), the half-life of protein, the instability index (II), and the grand average hydropathy (GRAVY) value for comparison purposes.

3. Results

3.1. Anti-PrP Monoclonal Antibodies Recognise Phascogale PrPC

A large number of anti-PrP antibodies have been produced that recognise both forms of PrP isoforms [49,50,51,52,53,54,55,56]. Scrapie-associated fibrils (SAF) derived from hamster were used as immunogen to generate an antibody response in both mice and rabbits. Although purified intact infectious SAF did not elicit detectable natural or experimental immune responses [53], a weakly measurable immunoreactive antibody reaction was evoked by formic acid-extracted SAF and SDS-solubilised SAF preparations, suggesting that treatment of SAF with detergent or denaturant somehow renders the antigen more immunogenic, perhaps by altering its conformation through a process of denaturation. For this study, we used SAF32 and SAF70, (Figure 1A) to characterise phascogale PrPC using brain homogenates in Western blot (WB) to investigate the presence of the typical 3-band pattern (Figure 1B–D). Here, we demonstrate the presence of the 3–4 band pattern between 25–40 kDa (Figure 1B–D). To determine whether PrPC derived from phascogale brain homogenates is susceptible to protease digestion, it was treated with proteinase K (PK) then analysed with WB using SAF32 or SAF70 anti-PrP mAbs (Figure 1B). Following treatment with PK, PrPC was completely digested with 50 µg/mL for 1 h minimum at 37 °C (Figure 1B). In order to compare the molecular weight (MW) range of P. calura PrPC with other well characterised mammalian PrPCs, 10% (w/v) P. Calura (Phascogale PrPC), M. musculus (Mouse PrPC), Cricetinae (Hamster PrPC) and H. sapiens (Human PrPC) brain homogenates were probed with either SAF32 or SAF70 following by Western blotting. Phascogale PrPC displayed a similar MW with the other species tested, ranging between approximately 25 and 40 kDa (Figure 1C). Finally, we compared PrPC derived from P. calura, including male and female juvenile, adult female, adult male (reproductively active and non-active). We showed that the sex, age, and reproductive status did not affect the MW of PrPC (Figure 1D).
Figure 1. Detection of phascogale PrPC with anti-PrP monoclonal antibodies. (A) IlFigurelustration of the prion protein and anti-PrP antibody epitope binding sites. SP = signal peptide; OR = octapeptide repeat region; HR = hydrophobic region; Gly = N-glycosylation sites; S-S; disulphide bridges. Antibodies: SAF32, SAF72, ICSM18. (B) Western blot analysis of 10% (w/v) P. calura brain homogenates treated with (+) or with no proteinase K (PK) using anti-PrP antibodies SAF32 and SAF70. (C) Western blot analysis of 10% (w/v) P. calura, mouse (M. musculus), hamster (Cricetinae), and human (H. sapiens) brain homogenates using anti-PrP antibodies SAF32 and SAF70. (D) Western blot analysis of 10% (w/v) P. calura brain homogenates derived from adult male breeders (AMB), adult male non-breeders (AMNB), male juvenile (MJ), a female juvenile (FJ), and an adult female (AF) using anti-PrP antibodies SAF32 and SAF70. Representative of 3 independent experiments.

3.2. Sequence Homology of Phascogale PrPC with Other Species

To compare the level of sequence homology between P. calura PrPC and a number of other species, DNA from two adult phascogale males were sequenced. The P. calura PrPC sequence was submitted to GenBank and is available under the accession number. The DNA sequences of the phascogales were translated to amino acids and aligned with the published sequences derived from other marsupials (Figure 2) and non-marsupial species [57,58,59,60] using Clustal Omega [61]. Here, we show that the octapeptide repeat region of the P. calura PRNP and other marsupials is evolutionarily conserved with minor variations (Figure 3, shown in colour). Generally, the placentals studied contained an octapeptide repeat [62]; however, the marsupials displayed a mix of 4–5 nona- and deca-peptide repeats. The first (PQGGGTNWGQ) and second (PHPGGSNWGQ) repeats are identical among all marsupials [62]. The P. calura PRNP sequence displayed a much closer sequence similarity with Tasmanian devil and opossum [63], however, the alignment identified an even closer phylogenetic relationship with the S. harrisii (Figure 3). This shows a strong correlation between the PrPC sequences similarity and close phylogeny amongst marsupials, suggesting a similar evolutionary split in protein sequence and species diversification of therians.
Figure 2. Multiple PrPC sequence alignment of phascogale and other marsupials. Species including phascogale (Phascogale calura), koala (Phascolarctos cinereus), Tasmanian devil (Sarcophilus harrisii), Tammar wallaby (Macropus eugenii), common wombat (Vombatus ursinus), possum (Trichosurus vulpecula), and opossum (Monodelphis domestica). Fully conserved between all species: * (asterisk); Strongly conserved between species: : (colon); Weakly conserved between species: . (period); Repeats: #1 (blue), #2 (red), #3 (green), #4 (purple), #5 (orange).
Figure 3. Interspecies phylogenetic relationship of marine, amphibian, reptilian, avian and mammalian species. The PrPC instability index (II) is recorded next to each reported species. The colours in the phylogenetic tree represent different taxonomic groups of animals, helping to visually distinguish their evolutionary relationships: (i) Blue: Represents aquatic species, specifically fish and amphibians, such as the Japanese rice fish (Oryzias latipes), zebrafish (Danio rerio), and African clawed frog (Xenopus laevis). (ii) Light-Green: Represents reptiles and birds, including species like the king cobra (Ophiophagus hannah), saltwater crocodile (Crocodylus porosus), and wild turkey (Meleagris gallopavo). (iii) Yellow: Represents monotremes and marsupials, such as the platypus (Ornithorhynchus anatinus), common wombat (Vombatus ursinus), and Tasmanian devil (Sarcophilus harrisii). (iv) Green: Represents placental mammals, including humans (Homo sapiens), elephants (Loxodonta africana), and mice (Mus musculus). (v) Orange: Represents various mammalian species with higher protein instability index (II), such as dogs (Canis lupus familiaris), rhinos (Diceros bicornis), and whales (Balaenoptera acutorostrata scammoni).
Next, we performed multiple sequence alignments between PrPC derived from P. calura and other mammalian and avian species. All the mammalian species, excluding cattle, contained five nona- and octa-peptide repeats similar to P. calura (Figure 4, shown in colour). Cattle shared the same number of repeats as chicken (Gallus gallus domesticus), however, the peptides and length of the repeat sequence differed. Cattle exhibited six nona- and octa-peptide repeats which had similar peptide sequences to the other mammalian species. In contrast, the sequence alignment showed that chicken PrPC had six peptide sequences which were present as short hexa-repeats (Figure 4). When compared with other species, excluding marsupials, P. calura displayed the highest sequence similarity with chicken. The close relationship between P. calura and chicken is further supported by their closer phylogenetic relationship compared with other mammals (Figure 3). Following P. calura, in descending order of sequence similarity, a new tree node was created for each species, starting with rabbit (Oryctolagus cuniculus) and then camel (Camelus dromedarius), dog, cattle, cat (Felis catus), elk (Cervus), deer (Cervidae), and finally sheep and goat (Capra hircus) (Figure S1). This group of animals, excluding rabbit, camel and cattle, formed a separate phylogeny tree branch. Another phylogeny tree branch of hamster (Mesocricetus auratus), bank vole, mouse, and rat (Rattus norvegicus) was also formed, with the sequence similarity depicting it in a cluster with the human PrPC sequence. The repeat sequences found between placental and marsupial mammals differ, each containing species-specific repeat sequences (Table 1).
Figure 4. Multiple PrPC sequence alignment of phascogale with mammalian and avian species. Species included phascogale (Phascogale calura), human (Homo sapiens), mouse (Mus musculus), rat (Rattus norvegicus), hamster (Mesocricetus auratus), bank vole (Myodes glareolus), rabbit (Oryctolagus cuniculus), sheep (Ovis aries), goat (Capra hircus), bovine (Bos taurus), deer (Cervidae), elk (Cervus), cat (Felis catus), dog (Canis lupus familiaris), camel (Camelus dromedarius), and chicken (Gallus gallus domesticus). Fully conserved between all species: * (asterisk); Strongly conserved between species: : (colon); Weakly conserved between species: . (period); Repeats: #1 (blue), #2 (red), #3 (green), #4 (purple), #5 (orange), #6 (pink).
Table 1. Common and unique repeat sequences between mammalian and avian species. Common repeats are sequences identified in more than one species. Unique repeats are sequences that are only found in a single animal.

3.3. A Comparative Analysis on the Physicochemical Properties of Phascogale PrPC

The physicochemical properties (PCP) of two male P. calura PrPC protein sequences were predicted through in silico analysis, one with an N72N and the other with an N72S. Of note, both forms were included in the Western blotting analysis (Figure 1B–D). Along with the P. calura’s, the PCP of 27 other species including the human and mouse PrPC sequences were also predicted (Table 2). The selected protein sequences showed that the length of most PrPCs is ~260 amino acids except zebrafish prion protein 1 (Danio rerio—567 and 606 amino acids), Japanese rice fish (Oryzias latipes—420 amino acids) and Mexican tetra (Astyanax mexicanus—594 amino acids). Similarly, P. calura PrPC was found to be 266 amino acids in length. The isoelectric point, commonly known as the theoretical pI (pI), provides information about the acidic or basic nature of the protein and the average theoretical pI ranged between 8.74 and 9.62 for the selected species and 9.44 for both N72N and N72S phascogale. The instability index (II), which provides an estimate of the stability of proteins in a test tube, was also assessed [64]. As reported by Rogers and colleagues [65], proteins with an in vivo half-life of >16 h or <5 h were considered stable or unstable, respectively. The authors based their analysis on the frequency of occurrence of specific amino acids in the stable and unstable protein classes studied in vitro, then predicted stable and unstable amino acid ‘hot spots’ in proteins using the Protein Sequence Database of the PIR (Release 12.0). For instance, and in the case of unstable proteins, the presence of Met(M), Gln(Q), Pro(P), Glu(E), and Ser(S) was relatively high. Moreover, Guruprasad and colleagues [66] also demonstrated that the in vivo instability of proteins is determined by the order of certain amino acids in their sequence. If the II is <40, this indicates that the assessed protein is stable. Here, we predicted 12 unstable PrP proteins that displayed a value >40, including human (43.11), cattle (41.17), common minke whale (Balaenoptera acutorostrata scammoni—41.84), black rhinoceros (Diceros bicornis—41.10), king cobra (Ophiophagus hannah—40.01), Mexican tetra (62.09), Japanese rice fish (58.83), and zebrafish (55.22). Of importance, the II of both N72N and N72S P. calura PrPC had values of 23.70 and 22.59, respectively, indicating that P. calura PrP is highly stable, similar to other marsupials, such as Tasmanian devil (24.19), wombat (24.55), and Tammar wallaby (24.55). Overall, the protein instability index of PrPC differs in multiple species, which predominantly appears to have evolved into a more unstable form in many different species. Several classes of species have developed into separate phylogenetic tree clusters. Each cluster shows they have evolved similar protein instability indexes relative to other classes of species in the other tree clusters (Figure 3, shown in colour). Of particular importance, despite their predicted high PrPC stability, both N72N and N72S P. calura exhibited a relatively high level of disorder in their N-terminal region (53.76% for both variants). This suggests that N-terminal disorder is not necessarily correlated with overall PrPC stability, highlighting a possible functional or structural role independent of the intrinsic stability of the protein.
Table 2. Physicochemical properties of phascogale PrPC. The number of residues, MW, net charge, IUR, and instability index. Phascogale (NN): N72N. Phascogale (NS): N72S.
Moreover, species predicted to have highly unstable PrPC based on their instability index (II), such as Danio rerio (DANRE Prion protein 1), Oryzias latipes, and Astyanax mexicanus, displayed even higher levels of N-terminal disorder (70.63%, 75.84%, 60.48%, and 66.67%, respectively). This suggests a potential compensatory mechanism, where increased N-terminal disorder may counterbalance the instability of the protein, possibly by influencing its conformational plasticity, interaction with binding partners, or susceptibility to misfolding.
We then conducted a comparison of the PrPC phascogale and PrPC of the other marsupial and mammalian species through analysis of its structural motifs. All the structural PROMOTIF information (sheet, beta hairpin, beta bulge, strands, helices, helix–helix interacts, beta-turn, gamma turn, and disulphides) are represented in Table 3. The PROMOTIF analysis revealed that there are structural differences mainly in beta-turn, gamma turn, strand, and helices between the homozygote phascogale and heterozygote phascogale. The structural differences between the phascogale and other marsupial and mammalian PrPC were found mainly in the helices, beta-turn, and gamma turn level. The highest number of beta-turns were seen in the Tasmanian devil and the phascogales which exhibited 69 and 63 beta-turns. In contrast, there were several commonalities shown in the structural motif with similar numbers of beta sheet, hairpin, strand, and disulphide bonds between the heterozygote phascogale and other mammalian and marsupial species [67].
Table 3. Structural properties of phascogale PrPC. The number of beta sheets, beta hairpin, beta bulge, beta stands, helices, helix–helix interacts, beta-turn, gamma-turn, disulphide structures are listed. P. calura N72S displays 2 beta sheets while other species analysed, including P. calura N72N, have 1 or no beta sheets.

4. Discussion

To further explore the phylogenetic relationship in different mammals, we carried out a detailed analysis of the molecular and physiochemical properties of PrPC in the marsupial red-tailed phascogale (P. calura). Here, we compared PrPC properties between the marsupial phascogale and a number of phylogenetically distant placentals and monotremes. This study confirmed that P. calura PrPC possesses similar molecular and physicochemical properties compared to other marsupials studied [68]. In this study, the sequence similarity and the number of repeats shared between Tammar wallaby, possum, koala, and wombat show a close PRNP phylogenetic relationship. This close relationship is likely attributed to belonging to the same marsupial Diprotodontia order [69]. Collectively, the various marsupial species are phylogenetically closer than other mammalian species [63]. P. calura PrPC displayed the typical 3-band pattern profile which represents the mono-, di-, and unglycosylated forms of PrPC, albeit its SDS-PAGE migration profile ranged between 25 and 75 kDa compared to the typical 25–39 kDa range [14]. PrPC in phascogale and other marsupials showed striking differences in their amino acid sequence, and structural and physicochemical properties when compared with placentals and monotremes. Aside from differing methods of embryonic development [70], other evolutionary differences have been highlighted among the mammalian subclasses, including genomic imprinting [71,72] and mitochondrial genome [73]. The chicken belongs to the Aves vertebrate class and its genome differs from mammalian vertebrates [74]; thus its PrPC sequence is unique to its class and does not share sequence homology with either placental or marsupial mammals.
Of importance, we established that the evolutionary relationship of PrPC seems to be intimately linked to its stability, progressing from a very low, to moderate and finally to a highly stable PrPC, as measured by the II [75,76]. This high variability of the PrPC II appears to be associated with the evolutionary split; with very high II in fish (55 to 62), moderately instable in reptiles (40–50), moderately stable/instable (38 to 43) in placental mammals, such as human and mouse, and highly stable in marsupials where the II ranged between 19 to 24 [77]. Of note, the instability index of proteins was shown to be inversely proportional to the protein’s half-life [78]. Idicula-Thomas and Balaji (2005) have shown that proteins with in vivo half-life <5 h had a II >40 while proteins with half-life >16 h had a II <40 [65,66]. The inverse relationship between half-life and instability index was first shown by Guruprasad and colleagues (1990), although, with the exception of the highly stable RNase A that has a long in vivo half-life of 61 h despite a very high II value (=52.2). This example highlights that there might be other factors involved in protein stability; for RNAse A, it was speculated that in this case the presence of four disulphide bonds confers high stability [79]. PrPC is composed of a flexible N-terminal and a globular C-terminal domain, consisting of three α-helices and two short β-sheets. α-helices 2 and 3 are linked by a disulfide bond at position ~178 and 213 in human PrPC [3]. Furthermore, the in vivo half-life of PrPC was approximately 18 h in a mouse model prion disease [80]. It was previously reported that reducing the disulfide bond led to α-helice 1 shift, β-sheet elongation, and de-stabilisation of human recombinant PrPC [81]. Despite the large disparity of the II of PrPC in placentals, marsupials, and monotremes studied here, the predicted in vivo half-life (30 h) was not affected and remained high except for the African bush elephant (Loxodonta africana) and platypus (Ornithorhynchus anatinus) with a half-life/II of 1.9 h/38.55 and 3.5 h/30.42, respectively. In contrast, P. calura PrPC, 266 amino acid residues long, has its cysteines located on residues 192 and 227. Taken together, these findings underscore the complex interplay between PrPC stability and structural disorder, indicating that N-terminal disorder may serve a distinct functional role beyond mere stability determinants. This could have implications for prion protein evolution, function, and susceptibility to misfolding-related diseases.
Interestingly, placentals and monotremes which predominantly displayed a higher number of five and six repeats, also had higher II values. The increase in repeat copies has been observed to be associated with a higher susceptibility to prions (TSEs) [82]. This correlation between a higher susceptibility to TSEs and increased repeats could be linked to high protein instability. However, the protein stability and additional repeats may not be the only factors conferring susceptibility to prion disease. Dogs and rabbits exhibit five repeats, with the dog closely approaching an unstable protein index, but being resistant to prion disease [83,84].
The sequence of some regions of the PrPC sequence are highly conserved in evolution [85], emphasizing a key role for the protein. Moreover, PrPC presence in P. calura, a species separated from placentals by approximately 125 million years of independent evolution, in a highly stable form [86], further strengthen the proposition of the importance of this protein in biological systems. Overall, the characterisation of PrPC in the marsupial, red-tailed phascogale has provided insights into the sequence evolution and diverse stability forms of PrPC. The consideration of the commonalities and variations established in PrPC between multiple species during evolution can help clarify the main functional significance of this highly conserved protein.

5. Conclusions

In conclusion, we highlight the importance of studying the P. calura and other marsupial sequences to help further elucidate the disease related PRNP genes in other mammals. Our comparison of the P. calura PRNP with eutherian sequences identified a number of physicochemical properties and specific repeats in the flexible region unique to marsupials which might confer disease resistance. However, sequence conservation between marsupials and eutherians indicates that P. calura might display similar disease susceptibility [87]. The semelparous nature of P. calura is unlikely to play a role in disease resistance/susceptibility as this is largely dictated by the PRNP primary sequence and conformation [88]. Finally, this study warrants further investigation of the biological function(s) of PrPC in marsupials.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/brainsci15030250/s1, Figure S1: Simplified tree diagrams of the sequence similarity of phascogale with an avian and other mammalian species.

Author Contributions

K.D.D. performed experiments and wrote the manuscript; S.K. performed experiments; E.A. performed experiments; U.K.A. performed experiments; M.A.D. revised the manuscript; M.T. conceived, designed experiments and wrote the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the Ainsworth Medical Research & Innovation Fund awarded to M.T. (Award #3).

Institutional Review Board Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article and Supplementary Material. Further inquiries can be directed to the corresponding author.

Acknowledgments

We are very grateful to Archibald, J. David, Emeritus of Biology, San Diego State University for the critical review of this manuscript.

Conflicts of Interest

The authors declare no competing interests.

References

  1. Gill, A.C.; Castle, A.R. The cellular and pathologic prion protein. In Handbook of Clinical Neurology; Elsevier: Amsterdam, The Netherlands, 2018; pp. 21–44. [Google Scholar] [CrossRef]
  2. Atkinson, C.J.; Zhang, K.; Munn, A.L.; Wiegmans, A.; Wei, M.Q. Prion protein scrapie and the normal cellular prion protein. Prion 2015, 10, 63–82. [Google Scholar] [CrossRef] [PubMed]
  3. Altmeppen, H.C.; Puig, B.; Dohler, F.; Thurm, D.K.; Falker, C.; Krasemann, S.; Glatzel, M. Proteolytic processing of the prion protein in health and disease. Am. J. Neurodegener. Dis. 2012, 1, 15–31. [Google Scholar] [PubMed]
  4. Gasperini, L.; Legname, G. Prion protein and aging. Front. Cell Dev. Biol. 2014, 2, 44. [Google Scholar] [CrossRef]
  5. Collinge, J.; Clarke, A.R. A General Model of Prion Strains and Their Pathogenicity. Science 2007, 318, 930–936. [Google Scholar] [CrossRef]
  6. Prusiner, S.B. Novel proteinaceous infectious particles cause scrapie. Science 1982, 216, 136–144. [Google Scholar] [CrossRef]
  7. Geschwind, M.D. Prion Diseases. Contin. Minneap. Minn. 2015, 21, 1612–1638. [Google Scholar] [CrossRef]
  8. Will, R.G.; Ironside, J.W. Sporadic and Infectious Human Prion Diseases. Cold Spring Harb. Perspect. Med. 2017, 7, a024364. [Google Scholar] [CrossRef]
  9. Biasini, E.; Turnbaugh, J.; Unterberger, U.; Harris, D.A. Prion Protein at the Crossroads of Physiology and Disease. Trends Neurosci. 2012, 35, 92–103. [Google Scholar] [CrossRef]
  10. Vanni, I.; Migliore, S.; Cosseddu, G.M.; Di Bari, M.A.; Pirisinu, L.; D’Agostino, C.; Riccardi, G.; Agrimi, U.; Nonno, R. Isolation of a Defective Prion Mutant from Natural Scrapie. PLOS Pathog. 2016, 12, e1006016. [Google Scholar] [CrossRef]
  11. Cronier, S.; Gros, N.; Tattum, M.H.; Jackson, G.S.; Clarke, A.R.; Collinge, J.; Wadsworth, J.D. Detection and characterization of proteinase K-sensitive disease-related prion protein with thermolysin. Biochem. J. 2008, 416, 297–305. [Google Scholar] [CrossRef]
  12. Solforosi, L.; Milani, M.; Mancini, N.; Clementi, M.; Burioni, R. A closer look at prion strains. Prion 2013, 7, 99–108. [Google Scholar] [CrossRef] [PubMed]
  13. Bossers, A.; Belt, P.B.G.M.; Raymond, G.J.; Caughey, B.; de Vries, R.; Smits, M.A. Scrapie susceptibility-linked polymorphisms modulate the in vitro conversion of sheep prion protein to protease-resistant forms. Proc. Natl. Acad. Sci. USA 1997, 94, 4931–4936. [Google Scholar] [CrossRef] [PubMed]
  14. Lawson, V.A.; Collins, S.J.; Masters, C.L.; Hill, A.F. Prion protein glycosylation. J. Neurochem. 2005, 93, 793–801. [Google Scholar] [CrossRef] [PubMed]
  15. Arsac, J.-N.; Andreoletti, O.; Bilheude, J.-M.; Lacroux, C.; Benestad, S.L.; Baron, T. Similar Biochemical Signatures and Prion Protein Genotypes in Atypical Scrapie and Nor98 Cases, France and Norway. Emerg. Infect. Dis. 2007, 13, 58–65. [Google Scholar] [CrossRef]
  16. Owen, J.P.; Maddison, B.C.; Whitelam, G.C.; Gough, K.C. Use of thermolysin in the diagnosis of prion diseases. Mol. Biotechnol. 2007, 35, 161–170. [Google Scholar] [CrossRef]
  17. Hill, A.F.; Joiner, S.; Wadsworth, J.D.; Sidle, K.C.; Bell, J.E.; Budka, H.; Ironside, J.W.; Collinge, J. Molecular classification of sporadic Creutzfeldt–Jakob disease. Brain 2003, 126, 1333–1346. [Google Scholar] [CrossRef]
  18. Collinge, J.; Sidle, K.C.L.; Meads, J.; Ironside, J.; Hill, A.F. Molecular analysis of prion strain variation and the aetiology of “new variant” CJD. Nature 1996, 383, 685–690. [Google Scholar] [CrossRef]
  19. Bruce, M.E.; Will, R.G.; Ironside, J.W.; McConnell, I.; Drummond, D.; Suttie, A.; McCardle, L.; Chree, A.; Hope, J.; Birkett, C.; et al. Transmissions to mice indicate that “new variant” CJD is caused by the BSE agent. Nature 1997, 389, 498–501. [Google Scholar] [CrossRef]
  20. Hill, A.F.; Desbruslais, M.; Joiner, S.; Sidle, K.C.; Gowland, I.; Collinge, J.; Doey, L.J.; Lantos, P. The same prion strain causes vCJD and BSE. Nature 1997, 389, 448–450. [Google Scholar] [CrossRef]
  21. Zeidler, M.; Ironside, J.W. The new variant of Creutzfeldt-Jakob disease. Rev. Sci. Tech. Int. Off. Epizoot. 2000, 19, 98–120. [Google Scholar] [CrossRef]
  22. Collinge, J.; Palmer, M.S.; Dryden, A.J. Genetic predisposition to iatrogenic Creutzfeldt-Jakob disease. Lancet 1991, 337, 1441–1442. [Google Scholar] [CrossRef] [PubMed]
  23. Palmer, M.S.; Dryden, A.J.; Hughes, J.T.; Collinge, J. Homozygous prion protein genotype predisposes to sporadic Creutzfeldt-Jakob disease. Nature 1991, 352, 340–342. [Google Scholar] [CrossRef] [PubMed]
  24. Windl, O.; Dempster, M.; Estibeiro, J.P.; Lathe, R.; de Silva, R.; Esmonde, T.; Will, R.; Springbett, A.; Campbell, T.A.; Sidle, K.C.; et al. Genetic basis of Creutzfeldt-Jakob disease in the United Kingdom: A systematic analysis of predisposing mutations and allelic variation in the PRNP gene. Hum. Genet. 1996, 98, 259–264. [Google Scholar] [CrossRef] [PubMed]
  25. Wadsworth, J.D.F.; Hill, A.F.; Joiner, S.; Jackson, G.S.; Clarke, A.R.; Collinge, J. Strain-specific prion-protein conformation determined by metal ions. Nat. Cell Biol. 1999, 1, 55–59. [Google Scholar] [CrossRef]
  26. Parchi, P.; Castellani, R.; Capellari, S.; Ghetti, B.; Young, K.; Chen, S.G.; Farlow, M.; Dickson, D.W.; Sima, A.A.; Trojanowski, J.Q.; et al. Molecular basis of phenotypic variability in sporadic Creutzfeldt-Jakob disease. Ann. Neurol. 1996, 39, 767–778. [Google Scholar] [CrossRef]
  27. Brown, D.R.; Clive, C.; Haswell, S.J. Antioxidant activity related to copper binding of native prion protein. J. Neurochem. 2001, 76, 69–76. [Google Scholar] [CrossRef]
  28. Mattei, V.; Garofalo, T.; Misasi, R.; Circella, A.; Manganelli, V.; Lucania, G.; Pavan, A.; Sorice, M. Prion protein is a component of the multimolecular signaling complex involved in T cell activation. FEBS Lett. 2004, 560, 14–18. [Google Scholar] [CrossRef]
  29. Lee, Y.J.; Baskakov, I.V. The cellular form of the prion protein guides the differentiation of human embryonic stem cells into neuron-, oligodendrocyte-, and astrocyte-committed lineages. Prion 2014, 8, 266–275. [Google Scholar] [CrossRef]
  30. Steele, A.D.; Emsley, J.G.; Özdinler, P.H.; Lindquist, S.; Macklis, J.D. Prion protein (PrPc) positively regulates neural precursor proliferation during developmental and adult mammalian neurogenesis. Proc. Natl. Acad. Sci. USA 2006, 103, 3416–3421. [Google Scholar] [CrossRef]
  31. Premzl, M.; Delbridge, M.; Gready, J.E.; Wilson, P.; Johnson, M.; Davis, J.; Kuczek, E.; Marshall Graves, J.A. The prion protein gene: Identifying regulatory signals using marsupial sequence. Gene 2005, 349, 121–134. [Google Scholar] [CrossRef]
  32. Tank, E.M.H.; Harris, D.A.; Desai, A.A.; True, H.L. Prion Protein Repeat Expansion Results in Increased Aggregation and Reveals Phenotypic Variability. Mol. Cell Biol. 2007, 27, 5445–5455. [Google Scholar] [CrossRef] [PubMed][Green Version]
  33. Loots, G.G. Genomic Identification of Regulatory Elements by Evolutionary Sequence Comparison and Functional Analysis. Adv. Genet. 2008, 61, 269–293. [Google Scholar] [CrossRef] [PubMed]
  34. Alberini, C.M. Transcription Factors in Long-Term Memory and Synaptic Plasticity. Physiol. Rev. 2009, 89, 121–145. [Google Scholar] [CrossRef]
  35. Groth, R.D.; Mermelstein, P.G. Brain-Derived Neurotrophic Factor Activation of NFAT (Nuclear Factor of Activated T-Cells)-Dependent Transcription: A Role for the Transcription Factor NFATc4 in Neurotrophin-Mediated Gene Expression. J. Neurosci. 2003, 23, 8125–8134. [Google Scholar] [CrossRef]
  36. Poggiolini, I.; Legname, G. Mapping the Prion Protein Distribution in Marsupials: Insights from Comparing Opossum with Mouse CNS. PLoS ONE 2012, 7, e0050370. [Google Scholar] [CrossRef]
  37. Letendre, C.; Sawyer, E.; Young, L.J.; Old, J.M. Immunosenescence in a captive semelparous marsupial, the red-tailed phascogale (Phascogale calura). BMC Zool. 2018, 3, 10. [Google Scholar] [CrossRef]
  38. Luo, Z.-X. Transformation and diversification in early mammal evolution. Nature 2007, 450, 1011–1019. [Google Scholar] [CrossRef]
  39. Luo, Z.-X.; Yuan, C.-X.; Meng, Q.-J.; Ji, Q. A Jurassic eutherian mammal and divergence of marsupials and placentals. Nature 2011, 476, 442–445. [Google Scholar] [CrossRef]
  40. Bradley, A.J. Reproduction and life history in the red-tailed phascogale, Phascogale calura (Marsupialia: Dasyuridae): The adaptive-stress senescence hypothesis. J. Zool. 1997, 241, 739–755. [Google Scholar] [CrossRef]
  41. Stannard, H.J.; Borthwick, C.R.; Ong, O.; Old, J.M. Longevity and breeding in captive red-tailed phascogales (Phascogale calura). Aust. Mammal. 2013, 35, 217. [Google Scholar] [CrossRef]
  42. Bradley, A.J. Failure of glucocorticoid feedback during breeding in the male red-tailed phascogale Phascogale calura (Marsupialia: Dasyuridae). J. Steroid Biochem. Mol. Biol. 1990, 37, 155–163. [Google Scholar] [CrossRef] [PubMed]
  43. Fisher, D.O.; Dickman, C.R.; Jones, M.E.; Blomberg, S.P. Sperm competition drives the evolution of suicidal reproduction in mammals. Proc. Natl. Acad. Sci. USA 2013, 110, 17910–17914. [Google Scholar] [CrossRef] [PubMed]
  44. Borthwick, C.R.; Old, J.M. Histological Development of the Immune Tissues of a Marsupial, the Red-Tailed Phascogale (Phascogale calura). Anat. Rec. 2016, 299, 207–219. [Google Scholar] [CrossRef] [PubMed]
  45. Old, J.M.; Carman, R.L.; Fry, G.; Deane, E.M. The immune tissues of the endangered red-tailed phascogale (Phascogale calura). J. Anat. 2006, 208, 381–387. [Google Scholar] [CrossRef]
  46. Borthwick, C.R.; Young, L.J.; Old, J.M. Molecular identification and gene expression profiles of the T cell receptors and co-receptors in developing red-tailed phascogale (Phascogale calura) pouch young. Mol. Immunol. 2018, 101, 268–275. [Google Scholar] [CrossRef]
  47. Hermsen, E.M.; Young, L.J.; Old, J.M. Major Histocompatibility Complex Class II in the red-tailed phascogale (Phascogale calura). Aust. Mammal. 2017, 39, 28–32. [Google Scholar] [CrossRef]
  48. Wilkins, M.R.; Gasteiger, E.; Bairoch, A.; Sanchez, J.C.; Williams, K.L.; Appel, R.D.; Hochstrasser, D.F. Protein Identification and Analysis Tools on the ExPASy Server. In The Proteomics Protocols Handbook; Walker, J.M., Ed.; Humana Press: Totowa, NJ, USA, 2005; pp. 571–607. [Google Scholar] [CrossRef]
  49. Bendheim, P.E.; Barry, R.A.; DeArmond, S.J.; Stites, D.P.; Prusiner, S.B. Antibodies to a scrapie prion protein. Nature 1984, 310, 418–421. [Google Scholar] [CrossRef]
  50. Bode, L.; Pocchiari, M.; Gelderblom, H.; Diringer, H. Characterization of antisera against scrapie-associated fibrils (SAF) from affected hamster and cross-reactivity with SAF from scrapie-affected mice and from patients with Creutzfeldt-Jakob disease. J. Gen. Virol. 1985, 66 Pt 11, 2471–2478. [Google Scholar] [CrossRef]
  51. Demart, S.; Fournier, J.G.; Creminon, C.; Frobert, Y.; Lamoury, F.; Marce, D.; Lasmézas, C.; Dormont, D.; Grassi, J.; Deslys, J.P. New insight into abnormal prion protein using monoclonal antibodies. Biochem. Biophys. Res. Commun. 1999, 265, 652–657. [Google Scholar] [CrossRef]
  52. Kascsak, R.J.; Rubenstein, R.; Merz, P.A.; Carp, R.I.; Robakis, N.K.; Wisniewski, H.M.; Diringer, H. Immunological comparison of scrapie-associated fibrils isolated from animals infected with four different scrapie strains. J. Virol. 1986, 59, 676–683. [Google Scholar] [CrossRef]
  53. Kascsak, R.J.; Rubenstein, R.; Merz, P.A.; Tonna-DeMasi, M.; Fersko, R.; Carp, R.I.; Wisniewski, H.M.; Diringer, H. Mouse polyclonal and monoclonal antibody to scrapie-associated fibril proteins. J. Virol. 1987, 61, 3688–3693. [Google Scholar] [CrossRef] [PubMed]
  54. Rubenstein, R.; Kascsak, R.J.; Papini, M.; Kascsak, R.; Carp, R.I.; LaFauci, G.; Meloen, R.; Langeveld, J. Immune surveillance and antigen conformation determines humoral immune response to the prion protein immunogen. J. Neurovirol 1999, 5, 401–413. [Google Scholar] [CrossRef] [PubMed]
  55. Takahashi, K.; Shinagawa, M.; Doi, S.; Sasaki, S.; Goto, H.; Sato, G. Purification of scrapie agent from infected animal brains and raising of antibodies to the purified fraction. Microbiol. Immunol. 1986, 30, 123–131. [Google Scholar] [CrossRef] [PubMed]
  56. Polymenidou, M.; Moos, R.; Scott, M.; Sigurdson, C.; Shi, Y.Z.; Yajima, B.; Hafner-Bratkovic, I.; Jerala, R.; Hornemann, S.; Wuthrich, K.; et al. The POM Monoclonals: A Comprehensive Set of Antibodies to Non-Overlapping Prion Protein Epitopes. PLoS ONE 2008, 3, e0003872. [Google Scholar] [CrossRef]
  57. Wopfner, F.; Weidenhöfer, G.; Schneider, R.; von Brunn, A.; Gilch, S.; Schwarz, T.F.; Werner, T.; Schätzl, H.M. Analysis of 27 mammalian 9 avian PrPs reveals high conservation of flexible regions of the prion protein. J. Mol. Biol. 1999, 289, 1163–1178. [Google Scholar] [CrossRef]
  58. Johnson, R.N.; O’Meally, D.; Chen, Z.; Etherington, G.J.; Ho, S.Y.W.; Nash, W.J.; Grueber, C.E.; Cheng, Y.; Whittington, C.M.; Dennison, S.; et al. Adaptation and conservation insights from the koala genome. Nat. Genet. 2018, 50, 1102–1111. [Google Scholar] [CrossRef]
  59. Phillips, M.J.; Lin, Y.H.; Harrison, G.L.; Penny, D. Mitochondrial genomes of a bandicoot and a brushtail possum confirm the monophyly of australidelphian marsupials. Proc. Biol. Sci. 2001, 268, 1533–1538. [Google Scholar] [CrossRef]
  60. Miller, W.; Hayes, V.; Ratan, A.; Petersen, D.; Wittekindt, N.; Miller, J.R.; Walenz, B.; Knight, J.; Qi, J.; Zhao, F.; et al. Genetic diversity and population structure of the endangered marsupial Sarcophilus harrisii (Tasmanian devil). Proc. Natl. Acad. Sci. USA 2011, 108, 12348–12353. [Google Scholar] [CrossRef]
  61. Sievers, F.; Wilm, A.; Dineen, D.; Gibson, T.J.; Karplus, K.; Li, W.; Lopez, R.; McWilliam, H.; Remmert, M.; Söding, J.; et al. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol. Syst. Biol. 2011, 7, 539. [Google Scholar] [CrossRef]
  62. van Rheede, T.; Smolenaars, M.M.W.; Madsen, O.; de Jong, W.W. Molecular Evolution of the Mammalian Prion Protein. Mol. Biol. Evol. 2003, 20, 111–121. [Google Scholar] [CrossRef]
  63. Kealy, S.; Beck, R. Total evidence phylogeny and evolutionary timescale for Australian faunivorous marsupials (Dasyuromorphia). BMC Evol. Biol. 2017, 17, 240. [Google Scholar] [CrossRef] [PubMed]
  64. Khanna, D.; Rana, P.S. Ensemble Technique for Prediction of T-cell Mycobacterium tuberculosis Epitopes. Interdiscip. Sci. Comput. Life Sci. 2019, 11, 611–627. [Google Scholar] [CrossRef] [PubMed]
  65. Rogers, S.; Wells, R.; Rechsteiner, M. Amino acid sequences common to rapidly degraded proteins: The PEST hypothesis. Science 1986, 234, 364–368. [Google Scholar] [CrossRef] [PubMed]
  66. Guruprasad, K.; Reddy, B.V.; Pandit, M.W. Correlation between stability of a protein and its dipeptide composition: A novel approach for predicting in vivo stability of a protein from its primary sequence. Protein Eng. 1990, 4, 155–161. [Google Scholar] [CrossRef]
  67. Laskowski, R.A.; Jabłońska, J.; Pravda, L.; Vařeková, R.S.; Thornton, J.M. PDBsum: Structural summaries of PDB entries. Protein Sci. Publ. Protein Soc. 2018, 27, 129–134. [Google Scholar] [CrossRef]
  68. May-Collado, L.J.; Kilpatrick, C.W.; Agnarsson, I. Mammals from ‘down under’: A multi-gene species-level phylogeny of marsupial mammals (Mammalia, Metatheria). PeerJ 2015, 3, 805. [Google Scholar] [CrossRef]
  69. Osborne, M.J.; Christidis, L.; Norman, J.A. Molecular phylogenetics of the Diprotodontia (kangaroos, wombats, koala, possums, and allies). Mol. Phylogenet Evol. 2002, 25, 219–228. [Google Scholar] [CrossRef]
  70. Behringer, R.R.; Eakin, G.S.; Renfree, M.B. Mammalian diversity: Gametes, embryos and reproduction. Reprod. Fertil. Dev. 2005, 18, 99–107. [Google Scholar] [CrossRef]
  71. Killian, J.K.; Byrd, J.C.; Jirtle, J.V.; Munday, B.L.; Stoskopf, M.K.; MacDonald, R.G.; Jirtle, R.L. M6P/IGF2R Imprinting Evolution in Mammals. Mol. Cell 2000, 5, 707–716. [Google Scholar] [CrossRef]
  72. Killian, J.K.; Nolan, C.M.; Wylie, A.A.; Li, T.; Vu, T.H.; Hoffman, A.R.; Jirtle, R.L. Divergent evolution in M6P/IGF2R imprinting from the Jurassic to the Quaternary. Hum. Mol. Genet. 2001, 10, 1721–1728. [Google Scholar] [CrossRef]
  73. Janke, A.; Xu, X.; Arnason, U. The complete mitochondrial genome of the wallaroo (Macropus robustus) and the phylogenetic relationship among Monotremata, Marsupialia, and Eutheria. Proc. Natl. Acad. Sci. USA 1997, 94, 1276–1281. [Google Scholar] [CrossRef] [PubMed]
  74. International Chicken Genome Sequencing Consortium. Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution. Nature 2004, 432, 695–716. [Google Scholar] [CrossRef] [PubMed]
  75. Debès, C.; Wang, M.; Caetano-Anollés, G.; Gräter, F. Evolutionary Optimization of Protein Folding. PLOS Comput. Biol. 2013, 9, e1002861. [Google Scholar] [CrossRef]
  76. Gilson, A.I.; Marshall-Christensen, A.; Choi, J.-M.; Shakhnovich, E.I. The Role of Evolutionary Selection in the Dynamics of Protein Structure Evolution. Biophys. J. 2017, 112, 1350–1365. [Google Scholar] [CrossRef]
  77. Garwood, R.J.; Edgecombe, G.D. Early Terrestrial Animals, Evolution, and Uncertainty. Evol. Educ. Outreach 2011, 4, 489–501. [Google Scholar] [CrossRef]
  78. Idicula-Thomas, S.; Balaji, P.V. Understanding the relationship between the primary structure of proteins and their amyloidogenic propensity: Clues from inclusion body formation. Protein Eng. Des. Sel. 2005, 18, 175–180. [Google Scholar] [CrossRef][Green Version]
  79. Creighton, T.E. Disulphide bonds and protein stability. BioEssays News Rev. Mol. Cell Dev. Biol. 1988, 8, 57–63. [Google Scholar] [CrossRef]
  80. Safar, J.G.; DeArmond, S.J.; Kociuba, K.; Deering, C.; Didorenko, S.; Bouzamondo-Bernstein, E.; Prusiner, S.B.; Tremblay, P. Prion clearance in bigenic mice. J. Gen. Virol. 2005, 86, 2913–2923. [Google Scholar] [CrossRef]
  81. Ning, L.; Guo, J.; Jin, N.; Liu, H.; Yao, X. The role of Cys179-Cys214 disulfide bond in the stability and folding of prion protein: Insights from molecular dynamics simulations. J. Mol. Model. 2014, 20, 2106. [Google Scholar] [CrossRef]
  82. Moore, R.A.; Herzog, C.; Errett, J.; Kocisko, D.A.; Arnold, K.M.; Hayes, S.F.; Priola, S.A. Octapeptide repeat insertions increase the rate of protease-resistant prion protein formation. Protein Sci. Publ. Protein Soc. 2006, 15, 609–619. [Google Scholar] [CrossRef]
  83. Sanchez-Garcia, J.; Fernandez-Funez, P. D159 and S167 are protective residues in the prion protein from dog and horse, two prion-resistant animals. Neurobiol. Dis. 2018, 119, 1–12. [Google Scholar] [CrossRef] [PubMed]
  84. Vorberg, I.; Groschup, M.H.; Pfaff, E.; Priola, S.A. Multiple Amino Acid Residues within the Rabbit Prion Protein Inhibit Formation of Its Abnormal Isoform. J. Virol. 2003, 77, 2003–2009. [Google Scholar] [CrossRef] [PubMed]
  85. Rivera-Milla, E.; Oidtmann, B.; Panagiotidis, C.H.; Baier, M.; Sklaviadis, T.; Hoffmann, R.; Zhou, Y.; Solis, G.P.; Stuermer, C.A.; Málaga-Trillo, E. Disparate evolution of prion protein domains and the distinct origin of Doppel- and prion-related loci revealed by fish-to-mammal comparisons. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 2006, 20, 317–319. [Google Scholar] [CrossRef]
  86. Adams, S.J.; McDowell, M.C.; Prideaux, G.J. Understanding accumulation bias in the ecological interpretation of archaeological and paleontological sites on Kangaroo Island, South Australia. J. Archaeol. Sci. Rep. 2016, 7, 715–729. [Google Scholar] [CrossRef]
  87. Legname, G.; Baskakov, I.V.; Nguyen, H.O.; Riesner, D.; Cohen, F.E.; DeArmond, S.J.; Prusiner, S.B. Synthetic Mammalian Prions. Science 2004, 305, 673–676. [Google Scholar] [CrossRef] [PubMed]
  88. Lee, J.-H.; Bae, S.-E.; Jung, S.; Ahn, I.; Son, H.S. Discriminant analysis of prion sequences for prediction of susceptibility. Exp. Mol. Med. 2013, 45, e48. [Google Scholar] [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Article Metrics

Citations

Article Access Statistics

Multiple requests from the same IP address are counted as one view.