Development and Evaluation of Quadruplex Droplet Digital PCR Method to Multiplex Detection of Different Respiratory Pathogens of Chickens
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Biological Materials
2.2. Nucleic Acid Extraction
2.3. Design and Screening of Primers and Probes
2.4. Preparation of Recombinant Standard Plasmids
2.5. Preliminary Establishment of Quadruplex DdPCR Method
2.6. Optimization of Reaction Conditions for Establishing the Quadruplex DdPCR
2.7. Analysis of Sensitivity, Specificity, and Repeatability of Quadruplex DdPCR
2.8. Establishment of Quadruplex QPCR Method
2.9. Detection of Clinical Samples
2.10. Statistical Analysis
3. Results
3.1. Optimal Primers and Probes Screening for Quadruplex DdPCR
3.2. The Results of Optimizing the Reaction Conditions of Quadruplex DdPCR
3.3. Evaluation of the Quadruplex DdPCR Method
3.4. Comparison Analysis of the Sensitivity and Standard Curves Between Quadruplex DdPCR and Quadruplex QPCR
3.5. Test Results of Clinical Samples
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Yehia, N.; Salem, H.M.; Mahmmod, Y.; Said, D.; Samir, M.; Mawgod, S.A.; Sorour, H.K.; AbdelRahman, M.A.A.; Selim, S.; Saad, A.M.; et al. Common viral and bacterial avian respiratory infections: An updated review. Poult. Sci. 2023, 102, 102553. [Google Scholar] [CrossRef] [Scilit]
- Sid, H.; Benachour, K.; Rautenschlein, S. Co-infection with multiple respiratory pathogens contributes to increased mortality rates in algerian poultry flocks. Avian Dis. 2015, 59, 440–446. [Google Scholar] [CrossRef] [Scilit]
- Kong, L.; You, R.; Zhang, D.; Yuan, Q.; Xiang, B.; Liang, J.; Lin, Q.; Ding, C.; Liao, M.; Chen, L.; et al. Infectious bronchitis virus infection increases pathogenicity of H9N2 avian influenza virus by inducing severe inflammatory response. Front. Vet. Sci. 2021, 8, 824179. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- He, X.; Luo, G.; Yu, Y. Etiological analysis and prevention measures of bronchial blockage in broilers. China Poult. 2013, 35, 58. [Google Scholar]
- Mu, Y.; Zhang, R.; Xiao, N.; Duan, Q.; Xu, L.; Zhou, S.; Liu, J.; Wang, X.; Chen, L. Investigation and analysis of viral pathogens causing bronchial obstruction in chickens. China Poult. 2022, 44, 42–50. [Google Scholar]
- Zhao, Z.; Wang, L.; Chen, D.; Zhou, H.; Wang, Y.; Du, Q. Investigation and analysis of bronchial embolism in broilers in some areas of Yunnan province. China Poult. 2014, 36, 60–61. [Google Scholar]
- Hu, X.; Xiao, J.; Chang, W. Analysis of pathogenesis and prevention measures of bronchial embolism in white feather broilers. China Poult. 2011, 33, 56–57. [Google Scholar]
- Zhang, J.; Lu, X.; Liu, K.; Wang, X.; Hu, S.; Liu, X. Study on co-infection of infectious bronchitis virus and low pathogenic avian influenza virus to enhance bronchial blockage in chickens. China Poult. 2022, 44, 104–110. [Google Scholar]
- Wang, Y.; Yan, J.; Hou, X.; Qin, J.; Xue, D.; Liu, J.; Xu, X. The therapeutic effect of gantan oral liquid on multietiological bronchial blockage in white feather broilers. Acta Ecol. Anim. Domastici 2023, 44, 71–76. [Google Scholar]
- Su, Z.; Sun, X.; Zhang, Y.; Tong, P.; Wang, D.; Gao, J.; Ma, K. Isolation and identification of mold in chicken bronchial obstruction cases. Heilongjiang Anim. Husb. Vet. Med. 2020, 7, 90–92. [Google Scholar]
- Al-Natour, M.Q.; Rohaim, M.A.; El Naggar, R.F.; Abdelsabour, M.A.; Afify, A.F.; Madbouly, Y.M.; Munir, M. Respiratory disease complex due to mixed viral infections in chicken in Jordan. Poult. Sci. 2024, 103, 103565. [Google Scholar] [CrossRef] [Scilit]
- Bona, M.; Kiss, I.; Denes, L.; Szilasi, A.; Mandoki, M. Tissue tropism of H9N2 low-pathogenic avian influenza virus in broiler chickens by immunohistochemistry. Animals 2023, 13, 1052. [Google Scholar] [CrossRef] [Scilit]
- El-Shemy, A.A.; Amer, M.M.; Hassan, H.M.; Elaish, M. Epidemiological distribution of respiratory viral pathogens in marketable vaccinated broiler chickens in five governorates in the Nile delta, Egypt, from January 2022 to October 2022. Vet World 2024, 17, 303–312. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jbenyeni, A.; Croville, G.; Cazaban, C.; Guerin, J. Predominance of low pathogenic avian influenza virus H9N2 in the respiratory co-infections in broilers in Tunisia: A longitudinal field study, 2018–2020. Vet. Res. 2023, 54, 88. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kursa, O.; Tomczyk, G.; Adamska, K.; Chrzanowska, J.; Sawicka-Durkalec, A. The microbial community of the respiratory tract of commercial chickens and turkeys. Microorganisms 2022, 10, 987. [Google Scholar] [CrossRef] [Scilit]
- Rahman, M.M.; Nooruzzaman, M.; Kabiraj, C.K.; Mumu, T.T.; Das, P.M.; Chowdhury, E.H.; Islam, M.R. Surveillance on respiratory diseases reveals enzootic circulation of both H5 and H9 avian influenza viruses in small-scale commercial layer farms of Bangladesh. Zoonoses Public Health 2021, 68, 896–907. [Google Scholar] [CrossRef] [Scilit]
- Shehata, A.A.; Sedeik, M.E.; Elbestawy, A.R.; Zain El-Abideen, M.A.; Ibrahim, H.H.; Kilany, W.H.; Ali, A. Co-infections, genetic, and antigenic relatedness of avian influenza H5N8 and H5N1 viruses in domestic and wild birds in Egypt. Poult. Sci. 2019, 98, 2371–2379. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tekelemariam, T.H.; Walkden-Brown, S.; Atire, F.A.; Tefera, D.A.; Alemayehu, D.H.; Gerber, P.F. Detection of chicken respiratory pathogens in live markets of Addis Ababa, Ethiopia, and epidemiological implications. Vet. Sci. 2022, 9, 503. [Google Scholar] [CrossRef] [Scilit]
- Umar, S.; Teillaud, A.; Aslam, H.B.; Guerin, J.; Ducatez, M.F. Molecular epidemiology of respiratory viruses in commercial chicken flocks in Pakistan from 2014 through to 2016. BMC Vet. Res. 2019, 15, 351. [Google Scholar] [CrossRef] [Scilit]
- Hassan, K.E.; Shany, S.A.S.; Ali, A.; Dahshan, A.M.; El-Sawah, A.A.; El-Kady, M.F. Prevalence of avian respiratory viruses in broiler flocks in Egypt. Poult. Sci. 2016, 95, 1271–1280. [Google Scholar] [CrossRef] [Scilit]
- Liu, T.; Peng, Y.; Wu, J.; Lu, S.; He, Y.; Li, X.; Sun, L.; Song, S.; Zhang, S.; Li, Z.; et al. Surveillance of avian influenza viruses in live bird markets of Shandong province from 2013 to 2019. Front. Microbiol. 2022, 13, 1030545. [Google Scholar] [CrossRef] [Scilit]
- Xia, J.; Li, Y.; Dong, M.; Guo, Z.; Luo, Y.; Li, N.; Zhao, Y.; Li, M.; Lin, Y.; Xu, J.; et al. Evolution of prevalent H9N2 subtype of avian influenza virus during 2019 to 2022 for the development of a control strategy in China. Poult. Sci. 2023, 102, 102957. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Liu, M.; Sun, Q.; Zhang, H.; Zhang, H.; Jiang, S.; Liu, S.; Huang, Y. Genotypic evolution and epidemiological characteristics of H9N2 influenza virus in Shandong province, China. Poult. Sci. 2019, 98, 3488–3495. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arafat, N.; Eladl, A.H.; Marghani, B.H.; Saif, M.A.; El-Shafei, R.A. Enhanced infection of avian influenza virus H9N2 with infectious laryngeotracheitis vaccination in chickens. Vet. Microbiol. 2018, 219, 8–16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arafat, N.; Abd El Rahman, S.; Naguib, D.; El-Shafei, R.A.; Abdo, W.; Eladl, A.H. Co-infection of Salmonella enteritidis with H9N2 avian influenza virus in chickens. Avian Pathol. 2020, 49, 496–506. [Google Scholar] [CrossRef] [Scilit]
- Yan, S.; Sun, Y.; Huang, X.; Jia, W.; Xie, D.; Zhang, G. Molecular characteristics and pathogenicity analysis of QX-like avian infectious bronchitis virus isolated in China in 2017 and 2018. Poult Sci 2019, 98, 5336–5341. [Google Scholar] [CrossRef] [Scilit]
- Wu, Q.; Xu, M.; Wei, D.; Zhang, X.; Li, D.; Mei, M. Pathogenicity and molecular characterization of a GI-19 infectious bronchitis virus isolated from east China. Front. Vet. Sci. 2024, 11, 1431172. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yuan, S.; Cheng, Q.; Guo, J.; Li, Z.; Yang, J.; Wang, C.; Liang, Z.; Zhang, X.; Yu, H.; Li, Y.; et al. Detection and genetic characterization of novel infectious bronchitis viruses from recent outbreaks in broiler and layer chicken flocks in southern China, 2021. Poult. Sci. 2022, 101, 102082. [Google Scholar] [CrossRef] [Scilit]
- Gellatly, S.L.; Hancock, R.E.W. Pseudomonas aeruginosa: New insights into pathogenesis and host defenses. Pathog. Dis. 2013, 67, 159–173. [Google Scholar] [CrossRef] [Scilit]
- Gallant, C.V.; Raivio, T.L.; Olson, J.C.; Woods, D.E.; Storey, D.G. Pseudomonas aeruginosa cystic fibrosis clinical isolates produce exotoxin a with altered ADP-ribosyltransferase activity and cytotoxicity. Microbiology 2000, 146, 891–1899. [Google Scholar] [CrossRef] [Scilit]
- Mahmoud, S.I.A.; Zyan, K.A.; Hamoud, M.M.; Khalifa, E.; Dardir, S.; Khalifa, R.; Kilany, W.H.; Elfeil, W.K. Effect of co-infection of low pathogenic avian influenza H9N2 virus and avian pathogenic E. coli on H9N2-vaccinated commercial broiler chickens. Front. Vet. Sci. 2022, 9, 918440. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Liao, X.; Zhang, W.; Jiang, H.; Sun, J.; Zhang, M.; He, X.; Lao, D.; Liu, Y. Prevalence of serogroups, virulence genotypes, antimicrobial resistance, and phylogenetic background of avian pathogenic Escherichia coli in south of China. Foodborne Pathog. Dis. 2010, 7, 1099–1106. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, W.; Li, W.; Zhao, Q.; Wu, P.; Huang, X.; Jin, W.; Wang, B.; Li, S.; Liu, W.; Zhang, G.; et al. Combined analysis of the microbiome, metabolome and transcriptome of silkie chickens in response to avian pathogenic E. Coli (APEC). Microb. Pathog. 2024, 189, 106586. [Google Scholar] [CrossRef] [Scilit]
- Walker, G.K.; Suyemoto, M.M.; Gall, S.; Chen, L.; Thakur, S.; Borst, L.B. The role of enterococcus faecalis during co-infection with avian pathogenic Escherichia coli in avian colibacillosis. Avian Pathol. 2020, 49, 589–599. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hashemi, S.; Ghalyanchilangeroudi, A.; Hosseini, S.M.; Sheikhi, N. Comparative trachea transcriptome analysis between avian infectious bronchitis virus and avian pathogenic E. coli individual infection and co-infection in SPF chickens. Acta Virol. 2020, 64, 457–469. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, S.; Jiang, N.; Shi, W.; Yin, H.; Chi, X.; Xie, Y.; Hu, J.; Zhang, Y.; Li, H.; Chen, J. Co-infection of H9N2 influenza a virus and Escherichia coli in a BALB/c mouse model aggravates lung injury by synergistic effects. Front. Microbiol. 2021, 12, 670688. [Google Scholar] [CrossRef] [Scilit]
- Qu, Y.; Liu, M.; Sun, X.; Liu, Y.; Liu, J.; Hu, L.; Jiang, Z.; Qi, F.; Nan, W.; Yan, X.; et al. Development and evaluation of a triplex droplet digital PCR method for differentiation of M. tuberculosis, M. bovis and BCG. Front. Microbiol. 2024, 15, 1397792. [Google Scholar] [CrossRef] [Scilit]
- Ganova, M.; Zhang, H.; Zhu, H.; Korabecna, M.; Neuzil, P. Multiplexed digital polymerase chain reaction as a powerful diagnostic tool. Biosens. Bioelectron. 2021, 181, 113155. [Google Scholar] [CrossRef] [Scilit]
- Rashid, S.A.; Nazakat, R.; Muhamad Robat, R.; Ismail, R.; Suppiah, J.; Rajendran, K.; Raj Louis Masalamany, A.S.S.; Muhamad Hendri, N.A.; Mohamad, N.; Khairul Hasni, N.A.; et al. Droplet digital PCR application for the detection of SARS-CoV-2 in air sample. Front. Public. Health 2023, 11, 1208348. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shi, J.; Jin, Q.; Zhang, X.; Zhao, J.; Li, N.; Dong, B.; Yu, J.; Yao, L. The development of a sensitive droplet digital polymerase chain reaction test for quantitative detection of goose astrovirus. Viruses 2024, 16, 765. [Google Scholar] [CrossRef] [Scilit]
- Elyazeed, H.A.; Al-Atfeehy, N.M.; Abotaleb, R.; Sayed, R.; Marouf, S. Preparation of ELISA and Lateral Flow Kits for rapid Diagnosis of Mycoplasma gallisepticum in Poultry. Sci. Rep. 2020, 10, 9056. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, T.; Tang, J.; Zhang, Y.; Jin, Y.; Lin, Z.; Chen, J.; Huang, J.; Mo, M. Establishment of a rapid real-time fluorescence-based recombinase-aided amplification method for detection of avian infectious bronchitis virus. J. Virol. Methods 2024, 328, 114955. [Google Scholar] [CrossRef] [Scilit]
- Yehia, N.; Eldemery, F.; Arafa, A.S.; Abd El Wahed, A.; El Sanousi, A.; Weidmann, M.; Shalaby, M. Reverse Transcription Recombinase Polymerase Amplification Assay for Rapid Detection of Avian Influenza Virus H9N2 HA Gene. Vet. Sci. 2021, 8, 134. [Google Scholar] [CrossRef] [Scilit]
- El-Tholoth, M.; Bau, H.H. Molecular Detection of Respiratory Tract Viruses in Chickens at the Point of Need by Loop-Mediated Isothermal Amplification (LAMP). Viruses 2024, 16, 1248. [Google Scholar] [CrossRef] [Scilit]
- Nuraeni, U.; Malau, J.; Astuti, R.T.; Dewantoro, A.; Apriori, D.; Lusiana, E.D.; Prasetya, B. Droplet digital PCR versus real-time PCR for in-house validation of porcine detection and quantification protocol: An artificial recombinant plasmid approach. PLoS ONE 2023, 18, 287712. [Google Scholar] [CrossRef] [Scilit]
- Leong, N.K.C.; Chu, D.K.W.; Chu, J.T.S.; Tam, Y.H.; Ip, D.K.M.; Cowling, B.J.; Poon, L.L.M. A six-plex droplet digital RT-PCR assay for seasonal influenza virus typing, subtyping, and lineage determination. Influenza Other Respir. Viruses 2020, 14, 720–729. [Google Scholar]
- Chen, J.; Li, D.; Xu, Y.; Li, Z.; Ma, S.; Liu, X.; Yuan, Y.; Zhang, C.; Fu, Q.; Shi, H. Establishment and application of multiplex droplet digital polymerase chain reaction assay for bovine enterovirus, bovine coronavirus, and bovine rotavirus. Front. Vet. Sci. 2023, 10, 1157900. [Google Scholar] [CrossRef] [Scilit]
- Wei, Y.; Gao, W.; Sun, H.; Yu, C.; Pei, X.; Sun, Y.; Liu, J.; Pu, J. A duplex RT-PCR assay for detection of H9 subtype avian influenza viruses and infectious bronchitis viruses. J. Integr. Agric. 2016, 15, 2105–2113. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xiao, Q.; Yan, L.; Yao, L.; Lei, J.; Bi, Z.; Hu, J.; Chen, Y.; Fang, A.; Li, H.; Li, Y.; et al. Development of oligonucleotide microarray for accurate and simultaneous detection of avian respiratory viral diseases. BMC Vet. Res. 2019, 15, 253. [Google Scholar] [CrossRef] [Scilit]
- Sanchez-Carvajal, J.M.; Vera-Salmoral, E.; Huerta, B.; Galan-Relano, A.; Ruedas-Torres, I.; Larenas-Munoz, F.; Luque, I.; Carrasco, L.; Gomez-Laguna, J. Droplet digital PCR as alternative to microbiological culture for Mycobacterium tuberculosis complex detection in bovine lymph node tissue samples. Front. Cell. Infect. Microbiol. 2024, 14, 1349999. [Google Scholar] [CrossRef] [Scilit]
- Li, R.; Zhu, Z.; Guo, Y.; Yang, L. Quadruplex Droplet Digital PCR Assay for Screening and Quantification of SARS-CoV-2. Int. J. Mol. Sci. 2024, 25, 8157. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Iribarnegaray, V.; Godiño, G.; Larrañaga, C.; Yamasaki, K.; Verdes, J.M.; Puentes, R. Droplet Digital PCR Enhances Sensitivity of Canine Distemper Virus Detection. Viruses 2024, 16, 1720. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Test ID | Primer/Probe Concentration (μM) | |||
|---|---|---|---|---|
| H9 Subtype AIV HA Gene | IBV M Gene | E. coli UidA Gene | P. aeruginosa Pal Gene | |
| 1 | 0.4/0.2 | 0.4/0.2 | 0.4/0.2 | 0.4/0.2 |
| 2 | 0.4/0.2 | 0.5/0.25 | 0.5/0.25 | 0.5/0.25 |
| 3 | 0.4/0.2 | 0.6/0.3 | 0.6/0.3 | 0.6/0.3 |
| 4 | 0.4/0.2 | 0.8/0.4 | 0.8/0.4 | 0.8/0.4 |
| 5 | 0.5/0.25 | 0.4/0.2 | 0.5/0.25 | 0.6/0.3 |
| 6 | 0.5/0.25 | 0.5/0.25 | 0.4/0.2 | 0.8/0.4 |
| 7 | 0.5/0.25 | 0.6/0.3 | 0.8/0.4 | 0.4/0.2 |
| 8 | 0.5/0.25 | 0.8/0.4 | 0.6/0.3 | 0.5/0.25 |
| 9 | 0.6/0.3 | 0.4/0.2 | 0.6/0.3 | 0.8/0.4 |
| 10 | 0.6/0.3 | 0.5/0.25 | 0.8/0.4 | 0.6/0.3 |
| 11 | 0.6/0.3 | 0.6/0.3 | 0.4/0.2 | 0.5/0.25 |
| 12 | 0.6/0.3 | 0.8/0.4 | 0.5/0.25 | 0.4/0.2 |
| 13 | 0.8/0.4 | 0.4/0.2 | 0.8/0.4 | 0.5/0.25 |
| 14 | 0.8/0.4 | 0.5/0.25 | 0.6/0.3 | 0.4/0.2 |
| 15 | 0.8/0.4 | 0.6/0.3 | 0.5/0.25 | 0.8/0.4 |
| 16 | 0.8/0.4 | 0.8/0.4 | 0.4/0.2 | 0.6/0.3 |
| Target Gene | Primer Name | Primer Sequences (5′–3′) | Primer Span |
|---|---|---|---|
| H9 AIV HA gene | HA-F | AAGCTGGAATCTGAAGGAACTTACA | 90 bp |
| HA-R | GAAGGCAGCAAACCCCATT | ||
| HA-P | FAM-ATCCTCACCATTTATTCGACTGTCGCCT-BHQ1 | ||
| IBV M gene | M-F | GTCCAA LNA C LNA GA LNA GACAAATTG | 170 bp |
| M-R | CCAGAAA LNA CA LNA C LNA CATAACAC | ||
| M-P | HEX-AATAAGCCGACTCCTAGTTGCGT-BHQ1 | ||
| P. aeruginosa Pal gene | Pal-F | TCCAAGGGCGGCGATGCT | 86 bp |
| Pal-R | AACGGCACCGCTGTTGG | ||
| Pal-P | ROX-CGACCCGAACGCAGGCTATGG-BHQ2 | ||
| E. coli UidA gene | UidA-F | ATGTGGAGTATTGCCAACGAA | 135 bp |
| UidA-R | AGCGTCGCAGAACATTACATT | ||
| UidA-P | Cy5-CGTC LNA CGCAA LNA G LNA GTGCA-BHQ3 |
| Quadruplex DdPCR Reaction | Quadruplex QPCR Reaction | |||
|---|---|---|---|---|
| Volume (μL) | Final Concentration (nM) | Volume (μL) | Final Concentration (nM) | |
| 2× qPCR probe Master mix I | 11 | 1× | 10 | 1× |
| HA-F/20 μM | 0.5 | 455 | 0.5 | 500 |
| HA-R/20 μM | 0.5 | 455 | 0.5 | 500 |
| HA-P/20 μM | 0.25 | 227 | 0.25 | 250 |
| M-F/20 μM | 0.6 | 545 | 0.5 | 500 |
| M-R/20 μM | 0.6 | 545 | 0.5 | 500 |
| M-P/20 μM | 0.3 | 273 | 0.25 | 250 |
| Pal-F/20 μM | 0.4 | 364 | 0.5 | 500 |
| Pal-R/20 μM | 0.4 | 364 | 0.5 | 500 |
| Pal-P/20 μM | 0.2 | 182 | 0.25 | 250 |
| UidA-F/20 μM | 0.8 | 727 | 0.5 | 500 |
| UidA-R/20 μM | 0.8 | 727 | 0.5 | 500 |
| UidA-P/20 μM | 0.4 | 364 | 0.25 | 250 |
| DNA | 4 | 4 | ||
| CY5.5/20 μM | 0.8 | 727 | - | - |
| RNase-free water | Up to 22 | Up to 20 | ||
| Target | Final Concentration (Copies/µL) | Repeatability Intra-Assay | Reproducibility Inter-Assay | ||||
|---|---|---|---|---|---|---|---|
| AVG | SD | CV (%) | AVG | SD | CV (%) | ||
| H9 subtype AIV | 6 × 104 | 64,110.64 | 732.49 | 1.14 | 64,043.97 | 683.10 | 1.07 |
| 6 × 103 | 5738.70 | 466.73 | 8.13 | 5848.70 | 422.45 | 7.22 | |
| 6 × 102 | 605.88 | 26.84 | 4.43 | 592.55 | 12.19 | 2.06 | |
| IBV | 6 × 104 | 64,504.55 | 516.56 | 0.80 | 64,504.55 | 866.18 | 1.34 |
| 6 × 103 | 6713.41 | 465.19 | 6.93 | 6746.74 | 479.31 | 7.10 | |
| 6 × 102 | 619.41 | 7.81 | 1.26 | 610.41 | 9.65 | 1.58 | |
| P. aeruginosa | 6 × 104 | 64,026.80 | 2295.35 | 3.58 | 63,993.47 | 3295.86 | 5.15 |
| 6 × 103 | 6442.39 | 214.63 | 3.33 | 6442.39 | 214.63 | 3.33 | |
| 6 × 102 | 699.61 | 18.91 | 2.70 | 686.28 | 18.91 | 2.76 | |
| E. coli | 6 × 104 | 63,293.12 | 333.85 | 0.53 | 63,626.45 | 1666.93 | 2.62 |
| 6 × 103 | 7139.66 | 324.61 | 4.55 | 6472.99 | 324.61 | 5.01 | |
| 6 × 102 | 619.19 | 5.61 | 0.91 | 622.52 | 5.61 | 0.90 | |
| Detection Method | Detection Results (Positive Samples/Total Samples) | |||
|---|---|---|---|---|
| H9 Subtype AIV | IBV | P. aeruginosa | E. coli | |
| Quadruplex ddPCR | 74/185 | 62/185 | 45/185 | 51/185 |
| Quadruplex qPCR | 67/185 | 57/185 | 40/185 | 45/185 |
| Kappa | 0.920 | 0.938 | 0.924 | 0.916 |
| Coincidence Rates (%) | 96.22 | 97.30 | 97.30 | 96.76 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Mu, Y.; Wang, X.; Dong, T.; Bao, X.; Xu, Q.; Lan, T.; Liu, J.; Chen, L. Development and Evaluation of Quadruplex Droplet Digital PCR Method to Multiplex Detection of Different Respiratory Pathogens of Chickens. Animals 2026, 16, 139. https://doi.org/10.3390/ani16010139
Mu Y, Wang X, Dong T, Bao X, Xu Q, Lan T, Liu J, Chen L. Development and Evaluation of Quadruplex Droplet Digital PCR Method to Multiplex Detection of Different Respiratory Pathogens of Chickens. Animals. 2026; 16(1):139. https://doi.org/10.3390/ani16010139
Chicago/Turabian StyleMu, Yingli, Xuejing Wang, Tongchao Dong, Xinran Bao, Qianqian Xu, Tianxiang Lan, Juxiang Liu, and Ligong Chen. 2026. "Development and Evaluation of Quadruplex Droplet Digital PCR Method to Multiplex Detection of Different Respiratory Pathogens of Chickens" Animals 16, no. 1: 139. https://doi.org/10.3390/ani16010139
APA StyleMu, Y., Wang, X., Dong, T., Bao, X., Xu, Q., Lan, T., Liu, J., & Chen, L. (2026). Development and Evaluation of Quadruplex Droplet Digital PCR Method to Multiplex Detection of Different Respiratory Pathogens of Chickens. Animals, 16(1), 139. https://doi.org/10.3390/ani16010139
