Whole Genome Resequencing Reveals the Genetic Basis of Desert Arid Climate Adaptation in Lop Sheep
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal Care
2.2. Sample Collection and Sequencing
2.3. Genotyping and Quality Control
2.4. Genetic Diversity and Population Structure
2.5. Selection of Signal Analyses
2.6. Gene Functional Enrichment Analysis
2.7. Methods for Candidate Gene Validation
3. Results
3.1. Genetic Diversity
3.2. Population Structure and Gene Flow
3.3. Selective Signal Analysis
3.4. Candidate Gene Validation
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| WGS | Whole Genome Sequencing |
| He | Expected Heterozygosity |
| Ho | Observed Heterozygosity |
| MAF | Allelic Frequency |
| π | Nucleotide Diversity |
| ROH | Runs of Homozygosity |
| LD | Linkage Disequilibrium |
| PCA | Principle Component Analysis |
| NJtree | Neighbor-Joining Tree |
| FST | Fixation Index |
| SNP | Single Nucleotide Polymorphism |
| GO | Gene Ontology |
| KEGG | Kyoto Encyclopedia of Genes and Genomes |
| qPCR | Quantitative Real-time PCR |
References
- Zeder, M.A.; Hesse, B. The initial domestication of goats (Capra hircus)in the Zagros mountains 10,000 years ago. Science 2000, 287, 2254–2257. [Google Scholar] [CrossRef]
- Yang, C.; Wang, J.; Bi, L.; Fang, D.; Xiang, X.; Khamili, A.; Kurban, W.; Han, C.; Gao, Q. Genetic Structure and Selection Signals for Extreme Environment Adaptation in Lop Sheep of Xinjiang. Biology 2025, 14, 337. [Google Scholar] [CrossRef]
- Moore, J.W.; Schindler, D.E. Getting ahead of climate change for ecological adaptation and resilience. Science 2022, 376, 1421–1426. [Google Scholar] [CrossRef]
- Carroll, S.P.; Jørgensen, P.S.; Kinnison, M.T.; Bergstrom, C.T.; Denison, R.F.; Gluckman, P.; Smith, T.B.; Strauss, S.Y.; Tabashnik, B.E. Applying evolutionary biology to address global challenges. Science 2014, 346, 1245993. [Google Scholar] [CrossRef]
- Abied, A.; Bagadi, A.; Bordbar, F.; Pu, Y.; Augustino, S.M.A.; Xue, X.; Xing, F.; Gebreselassie, G.; Han, J.-L.; Mwacharo, J.M.; et al. Genomic Diversity, Population Structure, and Signature of Selection in Five Chinese Native Sheep Breeds Adapted to Extreme Environments. Genes 2020, 11, 494. [Google Scholar] [CrossRef]
- Zhao, L.; Yuan, L.; Li, F.; Zhang, X.; Tian, H.; Ma, Z.; Zhang, D.; Zhang, Y.; Zhao, Y.; Huang, K.; et al. Whole-genome resequencing of Hu sheep identifies candidate genes associated with agronomic traits. J. Genet. Genom. 2024, 51, 866–876. [Google Scholar] [CrossRef]
- Niu, Y.; Li, Y.; Zhao, Y.; He, X.; Zhao, Q.; Pu, Y.; Ma, Y.; Jiang, L. Whole-genome sequencing identifies functional genes for environmental adaptation in Chinese sheep. J. Genet. Genom. 2024, 51, 1278–1285. [Google Scholar] [CrossRef]
- Li, T.; Jin, M.; Wang, H.; Zhang, W.; Yuan, Z.; Wei, C. Whole-Genome Scanning for Selection Signatures Reveals Candidate Genes Associated with Growth and Tail Length in Sheep. Animals 2024, 14, 687. [Google Scholar] [CrossRef] [PubMed]
- E, G.X.; Zhong, T.; Ma, Y.H.; Gao, H.J.; He, J.N.; Liu, N.; Zhao, Y.J.; Zhang, J.H.; Huang, Y.F. Conservation genetics in Chinese sheep: Diversity of fourteen indigenous sheep (Ovis aries) using microsatellite markers. Ecol. Evol. 2016, 6, 810–817. [Google Scholar] [CrossRef] [PubMed]
- Zhang, C.L.; Zhang, J.; Tuersuntuoheti, M.; Zhou, W.; Han, Z.; Li, X.; Yang, R.; Zhang, L.; Zheng, L.; Liu, S. Landscape genomics reveals adaptive divergence of indigenous sheep in different ecological environments of Xinjiang, China. Sci. Total Environ. 2023, 904, 166698. [Google Scholar] [CrossRef] [PubMed]
- Jin, M.; Wang, H.; Liu, G.; Lu, J.; Yuan, Z.; Li, T.; Liu, E.; Lu, Z.; Du, L.; Wei, C. Whole-genome resequencing of Chinese indigenous sheep provides insight into the genetic basis underlying climate adaptation. Genet. Sel. Evol. 2024, 56, 26. [Google Scholar] [CrossRef]
- Wang, J.; Suo, J.; Yang, R.; Zhang, C.L.; Li, X.; Han, Z.; Zhou, W.; Liu, S.; Gao, Q. Genetic diversity, population structure, and selective signature of sheep in the northeastern Tarim Basin. Front. Genet. 2023, 14, 1281601. [Google Scholar] [CrossRef]
- Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef]
- Alganmi, N.; Abusamra, H. Evaluation of an optimized germline exomes pipeline using BWA-MEM2 and Dragen-GATK tools. PLoS ONE 2023, 18, e0288371. [Google Scholar] [CrossRef] [PubMed]
- Danecek, P.; Bonfield, J.K.; Liddle, J.; Marshall, J.; Ohan, V.; Pollard, M.O.; Whitwham, A.; Keane, T.; McCarthy, S.A.; Davies, R.M.; et al. Twelve years of SAMtools and BCFtools. GigaScience 2021, 10, giab008. [Google Scholar] [CrossRef] [PubMed]
- Brouard, J.S.; Bissonnette, N. Variant Calling from RNA-seq Data Using the GATK Joint Genotyping Workflow. Methods Mol. Biol. 2022, 2493, 205–233. [Google Scholar]
- Danecek, P.; Auton, A.; Abecasis, G.; Albers, C.A.; Banks, E.; DePristo, M.A.; Handsaker, R.E.; Lunter, G.; Marth, G.T.; Sherry, S.T.; et al. 1000 Genomes Project Analysis Group. The variant call format and VCFtools. Bioinformatics 2011, 27, 2156–2158. [Google Scholar] [CrossRef] [PubMed]
- Fitak, R.R. OptM: Estimating the optimal number of migration edges on population trees using Treemix. Biol. Methods Protoc. 2021, 6, bpab017. [Google Scholar] [CrossRef]
- Malinsky, M.; Matschiner, M.; Svardal, H. Dsuite-Fast D-statistics and related admixture evidence from VCF files. Mol. Ecol. Resour. 2020, 21, 584–595. [Google Scholar] [CrossRef]
- Shriver, M.D.; Kennedy, G.C.; Parra, E.J.; Lawson, H.A.; Sonpar, V.; Huang, J.; Akey, J.M.; Jones, K.W. The genomic distribution of population substructure in four populations using 8,525 autosomal SNPs. Hum. Genom. 2004, 1, 274–286. [Google Scholar] [CrossRef]
- Li, M.; Tian, S.; Jin, L.; Zhou, G.; Li, Y.; Zhang, Y.; Wang, T.; Yeung, C.K.; Chen, L.; Ma, J.; et al. Genomic analyses identify distinct patterns of selection in domesticated pigs and Tibetan wild boars. Nat. Genet. 2013, 45, 1431–1438. [Google Scholar] [CrossRef]
- Huang, F.; Fu, M.; Li, J.; Chen, L.; Feng, K.; Huang, T.; Cai, Y.D. Analysis and prediction of protein stability based on interaction network, gene ontology, and KEGG pathway enrichment scores. Biochim. Biophys. Acta (BBA)-Proteins Proteom. 2023, 1871, 140889. [Google Scholar] [CrossRef]
- Naval-Sanchez, M.; Nguyen, Q.; McWilliam, S.; Porto-Neto, L.R.; Tellam, R.; Vuocolo, T.; Reverter, A.; Perez-Enciso, M.; Brauning, R.; Clarke, S. Sheep genome functional annotation reveals proximal regulatory elements contributed to the evolution of modern breeds. Nat. Commun. 2018, 9, 859. [Google Scholar] [CrossRef]
- Zhao, Y.X.; Yang, J.; Lv, F.H.; Hu, X.J.; Xie, X.L.; Zhang, M.; Li, W.R.; Liu, M.J.; Wang, Y.T.; Li, J.Q.; et al. Genomic Reconstruction of the History of Native Sheep Reveals the Peopling Patterns of Nomads and the Expansion of Early Pastoralism in East Asia. Mol. Biol. Evol. 2017, 34, 2380–2395. [Google Scholar] [CrossRef] [PubMed]
- Friedrich, J.; Liu, S.; Fang, L.; Prendergast, J.; Wiener, P. Insights into trait-association of selection signatures and adaptive eQTL in indigenous African cattle. BMC Genom. 2024, 25, 981. [Google Scholar] [CrossRef] [PubMed]
- Yuan, N.; Shen, L.; Peng, Q.; Sha, R.; Wang, Z.; Xie, Z.; You, X.; Feng, Y. SRSF1 Is Required for Mitochondrial Homeostasis and Thermogenic Function in Brown Adipocytes Through its Control of Ndufs3 Splicing. Adv. Sci. 2024, 11, e2306871. [Google Scholar] [CrossRef]
- Li, R.; Chen, S.; Li, C.; Xiao, H.; Costa, V.; Bhuiyan, M.S.A.; Baig, M.; Beja-Pereira, A. Whole-Genome Analysis Deciphers Population Structure and Genetic Introgression Among Bovine Species. Front. Genet. 2022, 13, 847492. [Google Scholar] [CrossRef] [PubMed]
- Ågren, M.S.; Litman, T.; Eriksen, J.O.; Schjerling, P.; Bzorek, M.; Gjerdrum, L.M.R. Gene Expression Linked to Reepithelialization of Human Skin Wounds. Int. J. Mol. Sci. 2022, 23, 15746. [Google Scholar] [CrossRef]
- Guo, T.; Zhao, H.; Yuan, C.; Huang, S.; Zhou, S.; Lu, Z.; Niu, C.; Liu, J.; Zhu, S.; Yue, Y.; et al. Selective Sweeps Uncovering the Genetic Basis of Horn and Adaptability Traits on Fine-Wool Sheep in China. Front. Genet. 2021, 12, 604235. [Google Scholar] [CrossRef]
- Wang, Z.; Wang, G.; Huang, J.; Li, Q.; Wang, C.; Zhong, J. Novel SNPs in the ATP1B2 gene and their associations with milk yield, milk composition and heat-resistance traits in Chinese Holstein cows. Mol. Biol. Rep. 2011, 38, 1749–1755. [Google Scholar] [CrossRef]
- Gu, J.; Liang, Q.; Liu, C.; Li, S. Genomic Analyses Reveal Adaptation to Hot Arid and Harsh Environments in Native Chickens of China. Front. Genet. 2020, 11, 582355. [Google Scholar] [CrossRef]
- Andrawus, M.; Sharvit, L.; Shekhidem, H.A.; Roichman, A.; Cohen, H.Y.; Atzmon, G. The effects of environmental stressors on candidate aging associated genes. Exp. Gerontol. 2020, 137, 110952. [Google Scholar] [CrossRef] [PubMed]
- Ramljak, J.; Špehar, M.; Ceranac, D.; Držaić, V.; Pocrnić, I.; Barać, D.; Mioč, B.; Širić, I.; Barać, Z.; Ivanković, A.; et al. Genomic Characterization of Local Croatian Sheep Breeds-Effective Population Size, Inbreeding & Signatures of Selection. Animals 2024, 14, 1928. [Google Scholar] [CrossRef] [PubMed]
- Xia, T.; Zhang, L.; Sun, G.; Yang, X.; Zhao, C.; Zhang, H. Insights into cold tolerance in sable (Martes zibellina) from the adaptive evolution of lipid metabolism. Mamm. Biol. 2021, 101, 861–870. [Google Scholar] [CrossRef]
- Li, Y.; Li, X.; Han, Z.; Yang, R.; Zhou, W.; Peng, Y.; He, J.; Liu, S. Population structure and selective signature analysis of local sheep breeds in Xinjiang, China based on high-density SNP chip. Sci. Rep. 2024, 14, 28133. [Google Scholar] [CrossRef]
- Zhao, F.; Deng, T.; Shi, L.; Wang, W.; Zhang, Q.; Du, L.; Wang, L. Genomic Scan for Selection Signature Reveals Fat Deposition in Chinese Indigenous Sheep with Extreme Tail Types. Animals 2020, 10, 773. [Google Scholar] [CrossRef]
- Lan, D.; Ji, W.; Xiong, X.; Liang, Q.; Yao, W.; Mipam, T.D.; Zhong, J.; Li, J. Population genome of the newly discovered Jinchuan yak to understand its adaptive evolution in extreme environments and generation mechanism of the multirib trait. Integr. Zool. 2021, 16, 685–695. [Google Scholar] [CrossRef]
- Chiu, C.Y.; Willis-Owen, S.A.G.; Wong, K.C.C.; Farrow, S.N.; Cookson, W.O.C.; Moffatt, M.F.; Zhang, Y. MAP3K8 is a potential therapeutic target in airway epithelial inflammation. J. Inflamm. 2024, 21, 27. [Google Scholar] [CrossRef]
- Wang, W.; Li, Z.; Xie, G.; Li, X.; Wu, Z.; Li, M.; Liu, A.; Xiong, Y.; Wang, Y. Convergent Genomic Signatures of Cashmere Traits: Evidence for Natural and Artificial Selection. Int. J. Mol. Sci. 2023, 24, 1165. [Google Scholar] [CrossRef]
- Grossman, P.C.; Schneider, D.A.; Herndon, D.R.; Knowles, D.P.; Highland, M.A. Differential pulmonary immunopathology of domestic sheep (Ovis aries) and bighorn sheep (Ovis canadensis) with Mycoplasma ovipneumoniae infection: A retrospective study. Comp. Immunol. Microbiol. Infect. Dis. 2021, 76, 101641. [Google Scholar] [CrossRef]
- Cuthbert, A.W.; Murthy, M.; Darlington, A.P. Neural control of submucosal gland and apical membrane secretions in airways. Physiol. Rep. 2015, 3, e12398. [Google Scholar] [CrossRef]
- Abcouwer, S.F.; Miglioranza Scavuzzi, B.; Kish, P.E.; Kong, D.; Shanmugam, S.; Le, X.A.; Yao, J.; Hager, H.; Zacks, D.N. The mouse retinal pigment epithelium mounts an innate immune defense response following retinal detachment. J. Neuroinflammation 2024, 21, 74. [Google Scholar] [CrossRef]
- Ghnenis, A.B.; Odhiambo, J.F.; McCormick, R.J.; Nathanielsz, P.W.; Ford, S.P. Maternal obesity in the ewe increases cardiac ventricular expression of glucocorticoid receptors, proinflammatory cytokines and fibrosis in adult male offspring. PLoS ONE 2017, 12, e0189977. [Google Scholar] [CrossRef]
- Gley, K.; Murani, E.; Trakooljul, N.; Zebunke, M.; Puppe, B.; Wimmers, K.; Ponsuksili, S. Transcriptome profiles of hypothalamus and adrenal gland linked to haplotype related to coping behavior in pigs. Sci. Rep. 2019, 9, 13038–13048. [Google Scholar] [CrossRef]
- Yamashita, H.; Nakayama, K.; Kanno, K.; Ishibashi, T.; Ishikawa, M.; Sato, S.; Iida, K.; Razia, S.; Kyo, S. Identifying the Carcinogenic Mechanism of Malignant Struma Ovarii Using Whole-Exome Sequencing and DNA Methylation Analysis. Curr. Issues Mol. Biol. 2023, 45, 1843–1851. [Google Scholar] [CrossRef]
- Jasper, P.J.; Zhai, S.K.; Kalis, S.L.; Kingzette, M.; Knight, K.L. B lymphocyte development in rabbit: Progenitor B cells and waning of B lymphopoiesis. J. Immunol. 2003, 171, 6372–6380. [Google Scholar] [CrossRef]
- Zhang, A.; Lacy-Hulbert, A.; Anderton, S.; Haslett, C.; Savill, J. Apoptotic Cell-Directed Resolution of Lung Inflammation Requires Myeloid αv Integrin-Mediated Induction of Regulatory T Lymphocytes. Am. J. Pathol. 2020, 190, 1224–1235. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Lv, W.; Ma, X.; Diao, R.; Luo, X.; Shen, Q.; Xu, M.; Yin, M.; Jin, Y. NDUFS3 alleviates oxidative stress and ferroptosis in sepsis induced acute kidney injury through AMPK pathway. Int. Immunopharmacol. 2024, 143 Pt 2, 113393. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Li, W.; Xiong, Z.; Zhu, J.; Ren, X.; Wang, S.; Kuang, H.; Lin, X.; Mora, A.; Li, X. PDGF-D-induced immunoproteasome activation and cell-cell interactions. Comput. Struct. Biotechnol. J. 2023, 21, 2405–2418. [Google Scholar] [PubMed]
- Wang, C.; Zhang, K.; Diao, Y.; Zhou, C.; Zhou, J.; Yang, Y.; Zeng, Z. Liensinine alleviates LPS-induced acute lung injury by blocking autophagic flux via PI3K/AKT/mTOR signaling pathway. Biomed. Pharmacother. 2023, 168, 115813. [Google Scholar]








| Primer Name | Primer Sequence | Annealing Temperature | Fragment Length |
|---|---|---|---|
| PDGFD | F: CCAACCTCAGGCGAGATGAG | 57 | 152 |
| R: TGTGAGGTGATTGCTCTCAAGT | |||
| NDUFS3 | F: GGTATGAGAGGGAGATCTGGGA | 59 | 133 |
| R: TCAACATAGCCAGACAGCGG | |||
| ATP1B2 | F: ACCAGGGTTGATGATTCGCC | 57 | 124 |
| R: GGAGTCATTGTAAGGCTCCAAG | |||
| ITGB8 | F: GCGGACTGCTTTGCATTATGT | 57 | 161 |
| R: TGCACATCTGTTGTCTTCACTT | |||
| CD79A | F: GAGAAGATGCCTGAGGGTCC | 59 | 96 |
| R: CCATGAGGAGTTGCCCAGG |
| Region | Breed | MAF | Ho | He |
|---|---|---|---|---|
| China | ALTS | 0.2050 | 0.2573 | 0.2674 |
| BSBS | 0.2078 | 0.2817 | 0.2707 | |
| CLHS | 0.2058 | 0.2617 | 0.2699 | |
| DLS | 0.1992 | 0.2665 | 0.2607 | |
| HTS | 0.2055 | 0.2515 | 0.2679 | |
| WDS | 0.2029 | 0.2785 | 0.2645 | |
| LOP | 0.2325 | 0.2904 | 0.2994 | |
| Other countries | AMS | 0.1867 | 0.2445 | 0.2464 |
| DFLS | 0.1755 | 0.2526 | 0.2324 | |
| DUBS | 0.1860 | 0.2687 | 0.2444 | |
| FLS | 0.1904 | 0.2716 | 0.2502 | |
| GLS | 0.1599 | 0.2362 | 0.2092 | |
| HUS | 0.1977 | 0.2879 | 0.2565 | |
| MGS | 0.2024 | 0.2569 | 0.2652 | |
| MLNS | 0.1879 | 0.2812 | 0.2458 | |
| Ouessant | 0.1454 | 0.1994 | 0.1920 | |
| SFKS | 0.1675 | 0.2612 | 0.2184 | |
| SLS | 0.1774 | 0.2668 | 0.2291 | |
| SGS | 0.1924 | 0.2505 | 0.2530 | |
| SSSP | 0.1977 | 0.2749 | 0.2576 | |
| TANS | 0.2042 | 0.2864 | 0.2673 | |
| WJS | 0.2023 | 0.2879 | 0.2645 | |
| XWHS | 0.2065 | 0.2929 | 0.2689 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, C.; Gong, C.; Khamili, A.; Li, X.; Gao, Q.; Chen, H.; Xiang, X.; Wang, J.; Han, C.; Gao, Q. Whole Genome Resequencing Reveals the Genetic Basis of Desert Arid Climate Adaptation in Lop Sheep. Animals 2025, 15, 2747. https://doi.org/10.3390/ani15182747
Yang C, Gong C, Khamili A, Li X, Gao Q, Chen H, Xiang X, Wang J, Han C, Gao Q. Whole Genome Resequencing Reveals the Genetic Basis of Desert Arid Climate Adaptation in Lop Sheep. Animals. 2025; 15(18):2747. https://doi.org/10.3390/ani15182747
Chicago/Turabian StyleYang, Chenchen, Changhai Gong, Abliz Khamili, Xiaopeng Li, Qifeng Gao, Hong Chen, Xin Xiang, Jieru Wang, Chunmei Han, and Qinghua Gao. 2025. "Whole Genome Resequencing Reveals the Genetic Basis of Desert Arid Climate Adaptation in Lop Sheep" Animals 15, no. 18: 2747. https://doi.org/10.3390/ani15182747
APA StyleYang, C., Gong, C., Khamili, A., Li, X., Gao, Q., Chen, H., Xiang, X., Wang, J., Han, C., & Gao, Q. (2025). Whole Genome Resequencing Reveals the Genetic Basis of Desert Arid Climate Adaptation in Lop Sheep. Animals, 15(18), 2747. https://doi.org/10.3390/ani15182747

