Vibrio alginolyticus Reprograms CIK Cell Metabolism via T3SS Effector VopS to Promote Host Cell Ferroptosis
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Strains and Culture Conditions
2.2. Experimental Fish
2.3. Cell Culture
2.4. Cloning and Sequencing of the vopS Gene from V. alginolyticus HY9901
2.5. Physiological and Pathological Characterization of ∆vopS
2.6. Real-Time Quantitative PCR
2.7. Hoechst 33258 Staining
2.8. Lactate Dehydrogenase (LDH) Release Assay
2.9. Caspase-3 Activity Assay
2.10. Metabolomics Analysis
2.11. Intracellular GSH and GSSG Assay
2.12. Detection of Intracellular Iron Content
2.13. Statistical Analysis
2.14. Biosecurity
3. Results
3.1. The V. alginolyticus vopS Shows Higher Conservation Within Vibrio spp.
3.2. ΔvopS Had Weak Extracellular Enzyme Activity and Virulence Compared to HY9901
3.3. VopS Affects the Transcription of T3SS Genes
3.4. VopS Facilitates the Disruption of the Cytoskeleton and Induces Host-Cell Death
3.5. V. alginolyticus Infection-Induced Distinct Metabolome Alteration in the Infected Host Cell
3.6. VopS Can Hijack Host Cell Fatty Acid Metabolism
3.7. VopS Can Induce Ferroptosis of CIK Cells
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Cai, S.H.; Wu, Z.H.; Jian, J.C.; Lu, Y.S. Cloning and Expression of Gene Encoding the Thermostable Direct Hemolysin from Vibrio alginolyticus Strain HY9901, the Causative Agent of Vibriosis of Crimson Snapper (Lutjanus erythopterus). J. Appl. Microbiol. 2007, 103, 289–296. [Google Scholar] [CrossRef] [PubMed]
- Zorrilla, I.; Chabrillón, M.; Arijo, S.; Díaz-Rosales, P.; Martínez-Manzanares, E.; Balebona, M.C.; Moriñigo, M.A. Bacteria recovered from diseased cultured gilthead sea bream (Sparus aurata L.) in southwestern Spain. Aquaculture 2003, 218, 11–20. [Google Scholar] [CrossRef]
- Pang, H.; Chen, L.; Hoare, R.; Huang, Y.; Zaohe, W.; Jian, J. Identification of DLD, by Immunoproteomic Analysis and Evaluation as a Potential Vaccine Antigen against Three Vibrio Species in Epinephelus coioides. Vaccine 2016, 34, 1225–1231. [Google Scholar] [CrossRef] [PubMed]
- Ozório, R.Á.; Lopes, R.G.; Vieira, F.d.N.; Bolívar-Ramírez, N.C.; Oliveira, C.Y.B.d.; Barracco, M.A.A.M.; Owatari, M.S.; Fracalossi, D.M.; Derner, R.B. Crude Polysaccharide Extract from the Microalga Porphyridium cruentum Improved Nonspecific Immune Responses and Resistance in Penaeus vannamei Exposed to Vibrio alginolyticus. Aquac. J. 2024, 4, 104–113. [Google Scholar] [CrossRef]
- Lee, K.K.; Yu, S.R.; Yang, T.I.; Liu, P.C.; Chen, F.R. Isolation and Characterization of Vibrio alginolyticus Isolated from Diseased Kuruma Prawn, Penaeus Japonicus. Lett. Appl. Microbiol. 1996, 22, 111–114. [Google Scholar] [CrossRef]
- Wang, J.; Ding, Q.; Yang, Q.; Fan, H.; Yu, G.; Liu, F.; Bello, B.K.; Zhang, X.; Zhang, T.; Dong, J.; et al. Vibrio alginolyticus Triggers Inflammatory Response in Mouse Peritoneal Macrophages via Activation of NLRP3 Inflammasome. Front. Cell. Infect. Microbiol. 2021, 11, 769777. [Google Scholar] [CrossRef]
- Roehrich, A.D.; Bordignon, E.; Mode, S.; Shen, D.-K.; Liu, X.; Pain, M.; Murillo, I.; Martinez-Argudo, I.; Sessions, R.B.; Blocker, A.J. Steps for Shigella Gatekeeper Protein MxiC Function in Hierarchical Type III Secretion Regulation. J. Biol. Chem. 2017, 292, 1705–1723. [Google Scholar] [CrossRef]
- Sukhan, A.; Kubori, T.; Galán, J.E. Synthesis and Localization of the Salmonella SPI-1 Type III Secretion Needle Complex Proteins PrgI and PrgJ. J. Bacteriol. 2003, 185, 3480–3483. [Google Scholar] [CrossRef]
- Pha, K.; Navarro, L. Yersinia Type III Effectors Perturb Host Innate Immune Responses. World J. Biol. Chem. 2016, 7, 1–13. [Google Scholar] [CrossRef]
- Coburn, B.; Sekirov, I.; Finlay, B.B. Type III Secretion Systems and Disease. Clin. Microbiol. Rev. 2007, 20, 535–549. [Google Scholar] [CrossRef]
- Salgado-Pabón, W.; Konradt, C.; Sansonetti, P.J.; Phalipon, A. New Insights into the Crosstalk between Shigella and T Lymphocytes. Trends Microbiol. 2014, 22, 192–198. [Google Scholar] [CrossRef] [PubMed]
- Ono, T.; Park, K.-S.; Ueta, M.; Iida, T.; Honda, T. Identification of Proteins Secreted via Vibrio parahaemolyticus Type III Secretion System 1. Infect. Immun. 2006, 74, 1032–1042. [Google Scholar] [CrossRef] [PubMed]
- Letchumanan, V.; Chan, K.-G.; Lee, L.-H. Vibrio parahaemolyticus: A Review on the Pathogenesis, Prevalence, and Advance Molecular Identification Techniques. Front. Microbiol. 2014, 5, 705. [Google Scholar] [CrossRef] [PubMed]
- Yarbrough, M.L.; Li, Y.; Kinch, L.N.; Grishin, N.V.; Ball, H.L.; Orth, K. AMPylation of Rho GTPases by Vibrio VopS Disrupts Effector Binding and Downstream Signaling. Science 2009, 323, 269–272. [Google Scholar] [CrossRef]
- Lewallen, D.M.; Steckler, C.J.; Knuckley, B.; Chalmers, M.J.; Thompson, P.R. Probing Adenylation: Using a Fluorescently Labelled ATP Probe to Directly Label and Immunoprecipitate VopS Substrates. Mol. Biosyst. 2012, 8, 1701–1706. [Google Scholar] [CrossRef]
- De Nisco, N.J.; Kanchwala, M.; Li, P.; Fernandez, J.; Xing, C.; Orth, K. Cytotoxic Vibrio T3SS1 Rewires Host Gene Expression to Subvert Cell Death Signaling and Activate Cell Survival Networks. Sci. Signal 2017, 10, eaal4501. [Google Scholar] [CrossRef]
- Dixon, S.J.; Lemberg, K.M.; Lamprecht, M.R.; Skouta, R.; Zaitsev, E.M.; Gleason, C.E.; Patel, D.N.; Bauer, A.J.; Cantley, A.M.; Yang, W.S.; et al. Ferroptosis: An Iron-Dependent Form of Nonapoptotic Cell Death. Cell 2012, 149, 1060–1072. [Google Scholar] [CrossRef]
- Zhou, S.; Tu, X.; Pang, H.; Hoare, R.; Monaghan, S.J.; Luo, J.; Jian, J. A T3SS Regulator Mutant of Vibrio alginolyticus Affects Antibiotic Susceptibilities and Provides Significant Protection to Danio Rerio as a Live Attenuated Vaccine. Front. Cell. Infect. Microbiol. 2020, 10, 183. [Google Scholar] [CrossRef]
- Pang, H.; Qiu, M.; Zhao, J.; Hoare, R.; Monaghan, S.J.; Song, D.; Chang, Y.; Jian, J. Construction of a Vibrio alginolyticus hopPmaJ (Hop) Mutant and Evaluation of Its Potential as a Live Attenuated Vaccine in Orange-Spotted Grouper (Epinephelus coioides). Fish Shellfish. Immunol. 2018, 76, 93–100. [Google Scholar] [CrossRef]
- Windle, H.J.; Kelleher, D. Identification and Characterization of a Metalloprotease Activity from Helicobacter Pylori. Infect. Immun. 1997, 65, 3132–3137. [Google Scholar] [CrossRef]
- Fletcher, M. The Effects of Culture Concentration and Age, Time, and Temperature on Bacterial Attachment to Polystyrene. Can. J. Microbiol 1977, 23, 1–6. [Google Scholar] [CrossRef]
- Tan, H.; Da, F.; Lin, G.; Wan, X.; Cai, S.; Cai, J.; Qin, Q. Construction of a Phosphodiesterase Mutant and Evaluation of Its Potential as an Effective Live Attenuated Vaccine in Pearl Gentian Grouper (♀Epinephelus fuscoguttatus × ♂Epinephelus lanceolatus). Fish. Shellfish. Immunol. 2022, 124, 543–551. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Yao, Z.; Sun, L.; Hu, W.; Cao, J.; Lin, W.; Lin, X. Proteomics Analysis Reveals a Potential Antibiotic Cocktail Therapy Strategy for Aeromonas hydrophila Infection in Biofilm. J. Proteome Res. 2016, 15, 1810–1820. [Google Scholar] [CrossRef] [PubMed]
- Burdette, D.L.; Seemann, J.; Orth, K. Vibrio VopQ Induces PI3-Kinase-Independent Autophagy and Antagonizes Phagocytosis. Mol. Microbiol. 2009, 73, 639–649. [Google Scholar] [CrossRef]
- Tao, W.; Tuo, Z.; Wu, F.; Mu, K.; Xu, C.; Shi, Y.; Sun, Z.; Wang, Y.; Li, Y.; Zhong, Z.; et al. Albumin-Assembled Copper-Bismuth Bimetallic Sulfide Bioactive Nanosphere as an Amplifier of Oxidative Stress for Enhanced Radio-Chemodynamic Combination Therapy. Regen. Biomater. 2022, 9, rbac045. [Google Scholar] [CrossRef]
- Kraft, V.A.N.; Bezjian, C.T.; Pfeiffer, S.; Ringelstetter, L.; Müller, C.; Zandkarimi, F.; Merl-Pham, J.; Bao, X.; Anastasov, N.; Kössl, J.; et al. GTP Cyclohydrolase 1/Tetrahydrobiopterin Counteract Ferroptosis through Lipid Remodeling. ACS Cent. Sci. 2020, 6, 41–53. [Google Scholar] [CrossRef]
- Wilharm, G.; Heider, C. Interrelationship between Type Three Secretion System and Metabolism in Pathogenic Bacteria. Front. Cell Infect. Microbiol. 2014, 4, 150. [Google Scholar] [CrossRef]
- Bhattacharjee, R.N.; Park, K.-S.; Kumagai, Y.; Okada, K.; Yamamoto, M.; Uematsu, S.; Matsui, K.; Kumar, H.; Kawai, T.; Iida, T.; et al. VP1686, a Vibrio Type III Secretion Protein, Induces Toll-like Receptor-Independent Apoptosis in Macrophage through NF-kappaB Inhibition. J. Biol. Chem. 2006, 281, 36897–36904. [Google Scholar] [CrossRef]
- Deng, Y.; Chen, C.; Zhao, Z.; Zhao, J.; Jacq, A.; Huang, X.; Yang, Y. The RNA Chaperone Hfq Is Involved in Colony Morphology, Nutrient Utilization and Oxidative and Envelope Stress Response in Vibrio alginolyticus. PLoS ONE 2016, 11, e0163689. [Google Scholar] [CrossRef]
- McCarter, L.L. Dual Flagellar Systems Enable Motility under Different Circumstances. J. Mol. Microbiol. Biotechnol. 2004, 7, 18–29. [Google Scholar] [CrossRef]
- Zhou, Z.; Pang, H.; Ding, Y.; Cai, J.; Huang, Y.; Jian, J.; Wu, Z. VscO, a Putative T3SS Chaperone Escort of Vibrio alginolyticus, Contributes to Virulence in Fish and Is a Target for Vaccine Development. Fish Shellfish. Immunol. 2013, 35, 1523–1531. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Wu, F.; Pang, H.; Tang, J.; Cai, S.; Jian, J. Superoxide Dismutase B (sodB), an Important Virulence Factor of Vibrio alginolyticus, Contributes to Antioxidative Stress and Its Potential Application for Live Attenuated Vaccine. Fish Shellfish. Immunol. 2019, 89, 354–360. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Li, J.; Pang, H.; Chang, Y.; Huang, Y. Molecular Cloning, Bioinformatics Analysis and Expression Analysis of Type IH Secretion System (T3SS) Injectisome Gene vscX from Vibrio alginolyticus. Agric. Biotechnol. 2017, 6, 41–45. [Google Scholar]
- Lee, K.-S.; Lee, M.-G.; Kwon, Y.-S.; Nam, K.-S. Arctigenin Enhances the Cytotoxic Effect of Doxorubicin in MDA-MB-231 Breast Cancer Cells. Int. J. Mol. Sci. 2020, 21, 2997. [Google Scholar] [CrossRef]
- Liu, H.; Cheng, Q.; Xu, D.-S.; Wang, W.; Fang, Z.; Xue, D.-D.; Zheng, Y.; Chang, A.H.; Lei, Y.-J. Overexpression of CXCR7 Accelerates Tumor Growth and Metastasis of Lung Cancer Cells. Respir. Res. 2020, 21, 287. [Google Scholar] [CrossRef] [PubMed]
- Mahajna, S.; Kadan, S.; Tietel, Z.; Saad, B.; Khasib, S.; Tumeh, A.; Ginsberg, D.; Zaid, H. In Vitro Evaluation of Chemically Analyzed Hypericum Triquetrifolium Extract Efficacy in Apoptosis Induction and Cell Cycle Arrest of the HCT-116 Colon Cancer Cell Line. Molecules 2019, 24, 4139. [Google Scholar] [CrossRef]
- Nguyen, A.Q.; Shimohata, T.; Hatayama, S.; Tentaku, A.; Kido, J.; Bui, T.M.H.; Uebanso, T.; Mawatari, K.; Takahashi, A. Type III Secretion Effector VopQ of Vibrio parahaemolyticus Modulates Central Carbon Metabolism in Epithelial Cells. mSphere 2020, 5, e00960-19. [Google Scholar] [CrossRef]
- Wang, Z.; Aweya, J.J.; Yao, D.; Zheng, Z.; Wang, C.; Zhao, Y.; Li, S.; Zhang, Y. Taurine Metabolism Is Modulated in Vibrio-Infected Penaeus Vannamei to Shape Shrimp Antibacterial Response and Survival. Microbiome 2022, 10, 213. [Google Scholar] [CrossRef]
- Huang, G.; Ma, L.; Shen, L.; Lei, Y.; Guo, L.; Deng, Y.; Ding, Y. MIF/SCL3A2 Depletion Inhibits the Proliferation and Metastasis of Colorectal Cancer Cells via the AKT/GSK-3β Pathway and Cell Iron Death. J. Cell. Mol. Med. 2022, 26, 3410–3422. [Google Scholar] [CrossRef]
- Xue, X.; Ma, L.; Zhang, X.; Xu, X.; Guo, S.; Wang, Y.; Qiu, S.; Cui, J.; Guo, W.; Yu, Y.; et al. Tumour Cells Are Sensitised to Ferroptosis via RB1CC1-Mediated Transcriptional Reprogramming. Clin. Transl. Med. 2022, 12, e747. [Google Scholar] [CrossRef]
- Zhang, Y.; Zhang, J.; Feng, D.; Zhou, H.; Gui, Z.; Zheng, M.; Hang, Z.; Wang, Z.; Wang, Z.; Gu, M.; et al. IRF1/ZNF350/GPX4-Mediated Ferroptosis of Renal Tubular Epithelial Cells Promote Chronic Renal Allograft Interstitial Fibrosis. Free Radic. Biol. Med. 2022, 193, 579–594. [Google Scholar] [CrossRef] [PubMed]














| Strains, Plasmids, Cell Line | Relevant Characteristics | Source or References |
|---|---|---|
| V. alginolyticus HY9901 | Wild type, isolated from diseased Lutjanus sanguineus off the Southern China coast | This study |
| ΔvopS | HY9901 carrying an in-frame deletion of vopS | This study |
| E. coli DH5α | supE44 ΔlacU169 (φ80 lacZDM15) hsdR17 recA1 gyrA96 thi-1 relA1 | Sangon, China |
| pBAD33-CM | araBAD promoter, Cmr | This study |
| pLP12 | E. coli-suicide vector | This study |
| E. coli β2163 | Competent cells | This study |
| β2163-pLP12-ΔvopS | β2163 containing plasmid of pLP12-ΔvopS, Cmr | This study |
| β2163-pBAD33-CM-ΔvopS | β2163containing plasmid of pBAD33-CM-ΔvopS, Cmr | This study |
| pMD18-T | Cloning vector, Ampr | Takara,J |
| pLP12-ΔvopS | pLP12 containing vopS gene in-frame deletion, Cmr | This study |
| CIK | Grass carp cells in the kidney | This study |
| Primer Name | Primer Sequence (5′-3′) |
|---|---|
| Cloning primers | |
| vopS1 | ATGATCAGTTTTGGAAGTGTT |
| vopS2 mutant construction | TCACTTAATACCGTGAAGGCTA |
| vopS-MF1 | GGAATCTAGACCTTGAGTCGACTTCTTTACTGACAGATTTTGCCA |
| vopS-MR1 | TTACGAAGTTCTGCTATCGCGTATAGCGCGCTAACACTTCCAAAACT |
| vopS-MF2 | AGTTTTGGAAGTGTTAGCGCGCTATACGCGATAGCAGAACTTCGTAA |
| vopS-MR2 | ACAGCTAGCGACGATATGTCCTCTACGAGCAGAACATCGACAC |
| vopS-TF | CCATTTCTAAAATATTCACTGCCATAA |
| vopS-TR | GCACACCACCTGTTTCTCGAT |
| pLP-UF | GACACAGTTGTAACTGGTCCA |
| pLP-UR | CAGGAACACTTAACGGCTGAC |
| Complement construction | |
| pBAD30-ZF | CTAGAGTCGACCTGCAGGCA |
| pBAD30-ZR | AGCTCGAATTCGCTAGCCCA |
| vopS-RF | TGGGCTAGCGAATTCGAGCTAGGAGGAATTCACCATGATCAGTTTTGGA |
| vopS-RR | TGCCTGCAGGTCGACTCTAGTCACTTAATACCGTG |
| RP4-F2 | CGAATTGGGTACCAGCGCTT |
| RP4-R2 | TACCGTCGACGCCGGCCAGC |
| PBAD30-mcf-TF | CCATAAGATTAGCGGATCCTACCT |
| qPCR primers | CTTCTCTCATCCGCCAAAACAG |
| vscL-F | TACCACGGTGAGTGTAGTTC |
| vscL-R | CGTAACCGACTTCAGGGA |
| hop-F | CTTCGCTTTCGGTTTGCT |
| hop-R | AATACCATCCCACCCTGT |
| vscO-F | GAGCTGGAAACATTAAGACA |
| vscO-R | TTGCTGCAACTGAACGAA |
| vscK-F | GGCGTTATCTCCCGTTCC |
| vscK-R | CTCCGCCCACCATCAATA |
| vopN-F | TGAACTCGTTTCGGACTA |
| vopN-R | ACTTTCTGGACTCGCACT |
| vscN-F | TAGGCGAAGAAGGAATGG |
| vscN-R | GCGATAGAAGTGGCAACAA |
| YSCK-F | GGCGTTATCTCCCGTTCC |
| YSCK-R | CTCCGCCCACCATCAATA |
| 16S-F | TTGCGAGAGTGAGCGAATCC |
| 16S-R | ATGGTGTGACGGGCGGTGTG |
| Characteristics | HY9901 | ΔvopS | C-vopS |
|---|---|---|---|
| Acitivity of ECP a | 0.47 ± 0.01 | 0.32 ± 0.01 | 0.47 ± 0.02 |
| Swarming (mm) b | 44.7 ± 0.13 | 44.1 ± 0.17 | 44.6 ± 0.16 |
| LD50 c | 6.29 × 105 | 3.43 × 107 ** | 6.35 × 105 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, W.; Huang, C.; Chen, Z.; Song, D.; Zhang, Y.; Yang, S.; Wang, N.; Jian, J.; Pang, H. Vibrio alginolyticus Reprograms CIK Cell Metabolism via T3SS Effector VopS to Promote Host Cell Ferroptosis. Animals 2024, 14, 3250. https://doi.org/10.3390/ani14223250
Zhang W, Huang C, Chen Z, Song D, Zhang Y, Yang S, Wang N, Jian J, Pang H. Vibrio alginolyticus Reprograms CIK Cell Metabolism via T3SS Effector VopS to Promote Host Cell Ferroptosis. Animals. 2024; 14(22):3250. https://doi.org/10.3390/ani14223250
Chicago/Turabian StyleZhang, Weijie, Chao Huang, Zhihang Chen, Dawei Song, Yujia Zhang, Shuai Yang, Na Wang, Jichang Jian, and Huanying Pang. 2024. "Vibrio alginolyticus Reprograms CIK Cell Metabolism via T3SS Effector VopS to Promote Host Cell Ferroptosis" Animals 14, no. 22: 3250. https://doi.org/10.3390/ani14223250
APA StyleZhang, W., Huang, C., Chen, Z., Song, D., Zhang, Y., Yang, S., Wang, N., Jian, J., & Pang, H. (2024). Vibrio alginolyticus Reprograms CIK Cell Metabolism via T3SS Effector VopS to Promote Host Cell Ferroptosis. Animals, 14(22), 3250. https://doi.org/10.3390/ani14223250

