Detection of Enterocytozoon bieneusi in Non-Human Primates in Portuguese Zoos
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. Nucleic Acid Extraction
2.3. Molecular Detection of Enterocytozoon bieneusi
2.4. General Procedures
2.5. Sequencing and Phylogenetic Analysis
2.6. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Han, B.; Pan, G.; Weiss, L.M. Microsporidiosis in Humans. Clin. Microbiol. Rev. 2021, 34, e00010-20. [Google Scholar] [CrossRef] [PubMed]
- Karim, M.R.; Dong, H.; Li, T.; Yu, F.; Li, D.; Zhang, L.; Li, J.; Wang, R.; Li, S.; Li, X.; et al. Predomination and New Genotypes of Enterocytozoon bieneusi in Captive Nonhuman Primates in Zoos in China: High Genetic Diversity and Zoonotic Significance. PLoS ONE 2015, 10, e0117991. [Google Scholar] [CrossRef]
- Desportes, I.; Le Charpentier, Y.; Galian, A.; Bernard, F.; Cochand-Priollet, B.; Lavergne, A.; Ravisse, P.; Modigliani, R. Occurrence of a New Microsporidan: Enterocytozoon bieneusi n. g., n. sp., in the Enterocytes of a Human Patient with AIDS. J. Protozool. 1985, 32, 250–254. [Google Scholar] [CrossRef]
- Ten Hove, R.J.; Van Lieshout, L.; Beadsworth, M.B.J.; Perez, M.A.; Spee, K.; Claas, E.C.J.; Verweij, J.J. Characterization of genotypes of Enterocytozoon bieneusi in immunosuppressed and immunocompetent patient groups. J. Eukaryot. Microbiol. 2009, 56, 388–393. [Google Scholar] [CrossRef]
- Liguory, O.; Sarfati, C.; Derouin, F.; Molina, J.M. Evidence of Different Enterocytozoon bieneusi Genotypes in Patients with and without Human Immunodeficiency Virus Infection. J. Clin. Microbiol. 2001, 39, 2672. [Google Scholar] [CrossRef]
- Sadler, F.; Peake, N.; Borrow, R.; Rowl, P.L.; Wilkins, E.G.L.; Curry, A. Genotyping of Enterocytozoon bieneusi in AIDS patients from the north west of England. J. Infect. 2002, 44, 39–42. [Google Scholar] [CrossRef]
- Akinbo, F.O.; Okaka, C.E.; Omoregie, R.; Dearen, T.; Leon, E.T.; Xiao, L. Molecular Epidemiologic Characterization of Enterocytozoon bieneusi in HIV-Infected Persons in Benin City, Nigeria. Am. J. Trop. Med. Hyg. 2012, 86, 441. [Google Scholar] [CrossRef]
- Santín, M.; Fayer, R. Microsporidiosis: Enterocytozoon bieneusi in domesticated and wild animals. Res. Vet. Sci. 2011, 90, 363–371. [Google Scholar] [CrossRef]
- Karim, M.R.; Wang, R.; Dong, H.; Zhang, L.; Li, J.; Zhang, S.; Rume, F.I.; Qi, M.; Jian, F.; Sun, M.; et al. Genetic polymorphism and zoonotic potential of Enterocytozoon bieneusi from nonhuman primates in China. Appl. Environ. Microbiol. 2014, 80, 1893–1898. [Google Scholar] [CrossRef]
- Li, W.; Xiao, L. Ecological and public health significance of Enterocytozoon bieneusi. One Health 2021, 12., 100209. [Google Scholar] [CrossRef]
- Li, W.; Diao, R.; Yang, J.; Xiao, L.; Lu, Y.; Li, Y.; Song, M. High diversity of human-pathogenic Enterocytozoon bieneusi genotypes in swine in northeast China. Parasitol. Res. 2014, 113, 1147–1153. [Google Scholar] [CrossRef] [PubMed]
- Ghosh, K.; Weiss, L.M. Molecular diagnostic tests for microsporidia. Interdiscip. Perspect. Infect. Dis. 2009, 2009, 926521. [Google Scholar] [CrossRef] [PubMed]
- Anane, S.; Attouchi, H. Microsporidiosis: Epidemiology, clinical data and therapy. Gastroenterol. Clin. Biol. 2010, 34, 450–464. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Feng, Y.; Xiao, L. Enterocytozoon bieneusi. Trends Parasitol. 2022, 38, 95–96. [Google Scholar] [CrossRef]
- Li, W.; Feng, Y.; Xiao, L. Diagnosis and molecular typing of Enterocytozoon bieneusi: The significant role of domestic animals in transmission of human microsporidiosis. Res. Vet. Sci. 2020, 133, 251–261. [Google Scholar] [CrossRef] [PubMed]
- Karim, M.R.; Yu, F.; Li, J.; Li, J.; Zhang, L.; Wang, R.; Rume, F.I.; Jian, F.; Zhang, S.; Ning, C. First molecular characterization of enteric protozoa and the human pathogenic microsporidian, Enterocytozoon bieneusi, in captive snakes in China. Parasitol. Res. 2014, 113, 3041–3048. [Google Scholar] [CrossRef]
- Ding, H.; Zhao, A.; Wang, L.; Gao, N.; Sun, Y.; Li, J.; Qi, M. Genotypes and zoonotic potential of Enterocytozoon bieneusi in edible bullfrogs (Lithobates catesbeiana) in China. Int. J. Parasitol. Parasites Wildl. 2020, 11, 103–107. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Zhang, T.; Yu, K.; Xu, J.; Cao, W.; Wang, Y.; Wang, J.; Zhou, L.; Chen, J.; Huang, H.; Zhao, W. Enterocytozoon bieneusi in Wild Rats and Shrews from Zhejiang Province, China: Occurrence, Genetic Characterization, and Potential for Zoonotic Transmission. Microorganisms 2024, 12, 811. [Google Scholar] [CrossRef]
- Li, W.; Feng, Y.; Santin, M. Host Specificity of Enterocytozoon bieneusi and Public Health Implications. Trends Parasitol. 2019, 35, 436–451. [Google Scholar] [CrossRef]
- Sak, B.; Kváč, M.; Petrželková, K.; Květoňová, D.; Pomajbíková, K.; Mulama, M.; Kiyang, J.; Modrý, D. Diversity of microsporidia (Fungi: Microsporidia) among captive great apes in European zoos and African sanctuaries: Evidence for zoonotic transmission? Folia Parasitol. 2011, 58, 81–86. [Google Scholar] [CrossRef]
- Lobo, M.L.; Teles, A.; Da Cunha, M.B.; Henriques, J.; Lourenço, A.M.; Antunes, F.; Matos, O. Microsporidia detection in stools from pets and animals from the zoo in Portugal: A preliminary study. J. Eukaryot. Microbiol. 2003, 50, 581–582. [Google Scholar] [CrossRef] [PubMed]
- Buckholt, M.A.; Lee, J.H.; Tzipori, S. Prevalence of Enterocytozoon bieneusi in Swine: An 18-Month Survey at a Slaughterhouse in Massachusetts. Appl. Environ. Microbiol. 2002, 68, 2595. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
- Letunic, I.; Bork, P. Interactive Tree of Life (iTOL) v4: Recent updates and new developments. Nucleic Acids Res. 2019, 47, W256–W259. [Google Scholar] [CrossRef] [PubMed]
- Figueiredo, A.M.; Dashti, A.; Santín, M.; Köster, P.C.; Torres, R.T.; Fonseca, C.; Mysterud, A.; Carvalho, J.; Sarmento, P.; Neves, N.; et al. Occurrence and molecular characterization of Enterocytozoon bieneusi in wild and domestic animal species in Portugal. Med. Mycol. 2023, 61, myad018. [Google Scholar] [CrossRef]
- Lobo, M.L.; Xiao, L.; Cama, V.; Stevens, T.; Antunes, F.; Matos, O. Genotypes of Enterocytozoon bieneusi in Mammals in Portugal. J. Eukaryot. Microbiol. 2006, 53, S61–S64. [Google Scholar] [CrossRef]
- Lobo, M.L.; Xiao, L.; Cama, V.; Magalhães, N.; Antunes, F.; Matos, O. Identification of Potentially Human-Pathogenic Enterocytozoon bieneusi Genotypes in Various Birds. Appl. Environ. Microbiol. 2006, 72, 7380–7382. [Google Scholar] [CrossRef]
- Sulaiman, I.M.; Fayer, R.; Yang, C.; Santin, M.; Matos, O.; Xiao, L. Molecular characterization of Enterocytozoon bieneusi in cattle indicates that only some isolates have zoonotic potential. Parasitol. Res. 2004, 92, 328–334. [Google Scholar] [CrossRef] [PubMed]
- Zhong, Z.; Li, W.; Deng, L.; Song, Y.; Wu, K.; Tian, Y.; Huang, X.; Hu, Y.; Fu, H.; Geng, Y.; et al. Multilocus Genotyping of Enterocytozoon bieneusi Derived from Nonhuman Primates in Southwest China. PLoS ONE 2017, 12, e0176926. [Google Scholar] [CrossRef]
- Köster, P.C.; Lapuente, J.; Pizarro, A.; Prieto-Pérez, L.; Pérez-Tanoira, R.; Dashti, A.; Bailo, B.; Muadica, A.S.; González-Barrio, D.; Calero-Bernal, R.; et al. Presence and Genetic Diversity of Enteric Protists in Captive and Semi-Captive Non-Human Primates in Côte d’Ivoire, Sierra Leone, and Peru. Int. J. Parasitol. Parasites Wildl. 2022, 17, 26–34. [Google Scholar] [CrossRef]
- Köster, P.C.; Martínez-Nevado, E.; González, A.; Abelló-Poveda, M.T.; Fernández-Bellon, H.; de la Riva-Fraga, M.; Marquet, B.; Guéry, J.-P.; Knauf-Witzens, T.; Weigold, A.; et al. Intestinal Protists in Captive Non-Human Primates and Their Handlers in Six European Zoological Gardens. Molecular Evidence of Zoonotic Transmission. Front. Vet. Sci. 2021, 8, 819887. [Google Scholar] [CrossRef] [PubMed]

| Target | Locus | Primer | Sequence (5′-3′) | Reference |
|---|---|---|---|---|
| Enterocytozoon bieneusi | ITS (and flanking rRNA) | EBITS3 | GGTCATAGGGATGAAGAG | [22] |
| EBITS4 | TTCGAGTTCTTTCGCGCTC | |||
| EBITS1 | GCTCTGAATATCTATGGCT | |||
| EBITS2.4 | ATCGCCGACGGATCCAAGTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Moreira, G.; Cruz, A.V.S.; Santos-Silva, S.; Moreira, R.S.S.; Mesquita, J.R. Detection of Enterocytozoon bieneusi in Non-Human Primates in Portuguese Zoos. Animals 2024, 14, 1874. https://doi.org/10.3390/ani14131874
Moreira G, Cruz AVS, Santos-Silva S, Moreira RSS, Mesquita JR. Detection of Enterocytozoon bieneusi in Non-Human Primates in Portuguese Zoos. Animals. 2024; 14(13):1874. https://doi.org/10.3390/ani14131874
Chicago/Turabian StyleMoreira, Guilherme, Andreia V. S. Cruz, Sérgio Santos-Silva, Rafaela S. S. Moreira, and João R. Mesquita. 2024. "Detection of Enterocytozoon bieneusi in Non-Human Primates in Portuguese Zoos" Animals 14, no. 13: 1874. https://doi.org/10.3390/ani14131874
APA StyleMoreira, G., Cruz, A. V. S., Santos-Silva, S., Moreira, R. S. S., & Mesquita, J. R. (2024). Detection of Enterocytozoon bieneusi in Non-Human Primates in Portuguese Zoos. Animals, 14(13), 1874. https://doi.org/10.3390/ani14131874

