The Effect of Prolactin on Gene Expression and the Secretion of Reproductive Hormones in Ewes during the Estrus Cycle
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Feeding Management
2.2. Experimental Design
2.2.1. Sheep Estrus Synchronization Treatment of Ewes
2.2.2. Experimental Design
2.3. Blood and Ovary Collection and of Follicle Count Statistics
2.4. Reproductive Hormone Assays
2.5. Determination of Relative Gene Expression
2.6. Statistical Analysis
3. Results
3.1. Effects of BCR on Serum Reproductive Hormone in Ewes at Different Stages of the Estrus Cycle
3.2. Effects of BCR on the Number of Follicles and Corpus Luteum in Ewes at Each Stage of the Estrus Cycle
3.3. Effects of BCR on mRNA Expression of Genes at Each Stage of the Estrus Cycle in Ewes
4. Discussion
4.1. Effect of PRL on Follicle Count and CL Number
4.2. Effect of PRL on the Secretion of Related Reproductive Hormones
4.3. Effect of PRL on the Expression of Genes at Different Stages of the Estrus Cycle
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Talebi, R.; Ahmadi, A.; Afraz, F.; Sarry, J.; Plisson-Petit, F.; Genêt, C.; Fabre, S. Transcriptome analysis of ovine granulosa cells reveals differences between small antral follicles collected during the follicular and luteal phases. Theriogenology 2018, 108, 103–117. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Chen, H.Y.; Jiang, S.; Shen, H.; Zeng, X.C. Identification of LncRNA Expression in the Estrous Cycle of Qira Black Sheep and Its Combination with miRNA Analysis. Kafkas Univ. Vet. Fak. Derg. 2021, 27, 733–740. [Google Scholar] [CrossRef]
- Orisaka, M.; Miyazaki, Y.; Shirafuji, A.; Tamamura, C.; Tsuyoshi, H.; Tsang, B.K.; Yoshida, Y. The role of pituitary gonadotropins and intraovarian regulators in follicle development: A mini-review. Reprod. Med. Biol. 2021, 20, 169–175. [Google Scholar] [CrossRef] [PubMed]
- Cao, X.H.; Wang, X.Y.; Lu, L.L.; Li, X.Y.; Di, R.; He, X.Y.; Hu, W.P.; Zeng, X.Y.; Liu, Q.Y.; Chu, M.X. Expression and Functional Analysis of the BCL2-Associated Agonist of Cell Death (BAD) Gene in the Sheep Ovary During the Reproductive Cycle. Front. Endocrinol. 2018, 9, 512. [Google Scholar] [CrossRef] [PubMed]
- Richard, S.; Zhou, Y.R.; Jasoni, C.L.; Pankhurst, M.W. Ovarian follicle size or growth rate can both be determinants of ovulatory follicle selection in mice. Biol. Reprod. 2023, 110, 130–139. [Google Scholar] [CrossRef] [PubMed]
- Luo, Y.R.; Zhang, R.Q.; Gao, J.; Wang, Y.L.; Zhang, W.M.; Qing, S.Z. The localization and expression of epidermal growth factor and epidermal growth factor receptor in bovine ovary during oestrous cycle. Reprod. Domest. Anim. 2020, 55, 822–832. [Google Scholar] [CrossRef] [PubMed]
- Rawan, A.F.; Langar, H.; Munetomo, M.; Yamamoto, Y.; Kawano, K.; Kimura, K. Effects of insulin-like growth factor-1 on the mRNA expression of estradiol receptors, steroidogenic enzymes, and steroid production in bovine follicles. J. Reprod. Dev. 2023, 69, 337–346. [Google Scholar] [CrossRef] [PubMed]
- Rosa, P.M.D.; Bridi, A.; Ferronato, G.D.; Prado, C.M.; Bastos, N.M.; Sangalli, J.R.; Meirelles, F.V.; Perecin, F.; da Silveira, J.C. Corpus luteum presence in the bovine ovary increase intrafollicular progesterone concentration: Consequences in follicular cells gene expression and follicular fluid small extracellular vesicles miRNA contents. J. Ovarian Res. 2024, 17, 65. [Google Scholar] [CrossRef] [PubMed]
- Raut, S.; Khambata, K.; Goffin, V.; Balasinor, N. Prolactin Regulates Testicular Gene Expression and Cell Cycle Processes Predominantly via JAK2/STAT5 Pathway in the Male Rat. Endocrinology 2023, 164, bqad072. [Google Scholar] [CrossRef] [PubMed]
- Samuel, B.; Dadi, H.; Dejene, G.; Kang, M.G.; Park, C.; Dinka, H. Single nucleotide polymorphisms within exon four of the prolactin gene and their effect on milk traits in cattle populations of Ethiopia. Anim. Biotechnol. 2023, 34, 4634–4644. [Google Scholar] [CrossRef]
- Maleki, O.L.; Hashemi, A.; Zarringhabaie, G.E.; Farhadian, M. Associations of polymorphisms in the prolactin receptor gene with growth trait in japanese quail (Coturnix coturnix japonica). Genetika 2017, 49, 1105–1114. [Google Scholar] [CrossRef]
- Toyoda, F.; Hasunuma, I.; Yamamoto, K.; Yamashita, M.; Kikuyama, S. Prolactin acts centrally to enhance newt courtship behavior. Gen. Comp. Endocrinol. 2005, 141, 172–177. [Google Scholar] [CrossRef] [PubMed]
- Pirchio, R.; Graziadio, C.; Colao, A.; Pivonello, R.; Auriemma, R.S. Metabolic effects of prolactin. Front. Endocrinol. 2022, 13, 1015520. [Google Scholar] [CrossRef] [PubMed]
- Misztal, T.; Rornanowicz, K.; Tomaszewska-Zaremba, D.; Wójcik-Gladysz, A.; Barcikowski, B. The effects of prolonged, intracerebroventricular prolactin treatment on luteinizing hormone secretion, catecholaminergic activity and estrous behavior in ewes. Exp. Clin. Endocrinol. Diabetes 2004, 112, 215–221. [Google Scholar] [CrossRef] [PubMed]
- Schanbacher, B. Relationship of daylength and prolactin to resumption of reproductive activity in anestrous ewes. J. Anim. Sci. 1980, 50, 293–297. [Google Scholar] [CrossRef] [PubMed]
- Christian, H.C.; Imirtziadis, L.; Tortonese, D. Ultrastructural changes in lactotrophs and folliculo-stellate cells in the ovine pituitary during the annual reproductive cycle. J. Neuroendocrinol. 2015, 27, 277–284. [Google Scholar] [CrossRef] [PubMed]
- Polatti, F.; Nava, C.; Brambilla, A.; Zara, C. PRL action on E2 ovarian secretion. Clin. Exp. Obstet. Gynecol. 1982, 9, 160–164. [Google Scholar] [PubMed]
- Taketa, Y.; Inoue, K.; Takahashi, M.; Sakamoto, Y.; Watanabe, G.; Taya, K.; Yoshida, M. Effects of sulpiride and ethylene glycol monomethyl ether on endometrial carcinogenicity in Donryu rats. J. Appl. Toxicol. 2016, 36, 769–776. [Google Scholar] [CrossRef] [PubMed]
- Liu, T.; Jia, C.; Li, Y. Treatment of sexual dysfunction induced by hyperprolactinemia accompanied by reduced luteinizing hormone levels: A case report. Clin. Case Rep. 2024, 12, e8432. [Google Scholar] [CrossRef]
- Nakamura, E.; Otsuka, F.; Inagaki, K.; Miyoshi, T.; Yamanaka, R.; Tsukamoto, N.; Suzuki, J.; Ogura, T.; Makino, H. A Novel Antagonistic Effect of the Bone Morphogenetic Protein System on Prolactin Actions in Regulating Steroidogenesis by Granulosa Cells. Endocrinology 2010, 151, 5506–5518. [Google Scholar] [CrossRef] [PubMed]
- Milenkovic, L.; D’Angelo, G.; Kelly, P.A.; Weiner, R.I. Inhibition of gonadotropin hormone-releasing hormone release by prolactin from GT1 neuronal cell lines through prolactin receptors. Proc. Natl. Acad. Sci. USA 1994, 91, 1244–1247. [Google Scholar] [CrossRef] [PubMed]
- Ohtaki, T.; Fujiwara, H.; Watanabe, G.; Ono, M.; Taya, K.; Tsumagari, S. Changes in luteinizing hormone pulse frequency and prolactin levels in bitches in response to estrus induction by cabergoline-its cases where it is delayed to induce estrus. J. Vet. Med. Sci. 2020, 82, 1773–1780. [Google Scholar] [CrossRef]
- Blaszczyk, B.; Udala, J.; Gaczarzewicz, D. Changes in estradiol, progesterone, melatonin, prolactin and thyroxine concentrations in blood plasma of goats following induced estrus in and outside the natural breeding season. Small Rumin. Res. 2004, 51, 209–219. [Google Scholar] [CrossRef]
- Deveson, S.L. The Effects of Photoperiod and Melatonin on Seasonal Breeding in Goats; University of Surrey: Guildford, UK, 1990. [Google Scholar]
- Chen, M.; Duan, C.; Yin, X.; Li, X.; Liu, X.; Zhang, L.; Yue, S.; Zhang, Y.; Liu, Y. Prolactin inhibitor changes testosterone production, testicular morphology, and related genes expression in cashmere goats. Front. Vet. Sci. 2023, 10, 1249189. [Google Scholar] [CrossRef] [PubMed]
- Picazo, R.A.; de Bulnes, A.G.; Brunet, A.G.; del Campo, A.; Granados, B.; Tresguerres, J.; Sebastián, A.L. Effects of bromocriptine administration during the follicular phase of the oestrous cycle on prolactin and gonadotrophin secretion and follicular dynamics in Merino monovular ewes. J. Reprod. Fertil. 2000, 120, 177–186. [Google Scholar] [CrossRef]
- Zhang, L.; Duan, C.; Guo, Y.; Zhang, Y.; Liu, Y. Inhibition of prolactin promotes secondary skin follicle activation in cashmere goats. J. Anim. Sci. 2021, 99, skab079. [Google Scholar] [CrossRef] [PubMed]
- Molik, E.; Blasiak, M. The role of melatonin and bromocriptine in the regulation of prolactin secretion in animals—A review. Ann. Anim. Sci. 2015, 15, 849–860. [Google Scholar] [CrossRef]
- Fukuhara, N.; Nishiyama, M.; Iwasaki, Y. Update in Pathogenesis, Diagnosis, and Therapy of Prolactinoma. Cancers 2022, 14, 3604. [Google Scholar] [CrossRef] [PubMed]
- Koniares, K.; Benadiva, C.; Engmann, L.; Nulsen, J.; Grow, D. Macroprolactinemia: A mini-review and update on clinical practice. F&S Rep. 2023, 4, 245–250. [Google Scholar] [CrossRef]
- Año-Perello, A.; Santos-Jimenez, Z.; Encinas, T.; Martinez-Ros, P.; Gonzalez-Bulnes, A. Use of GnRH for Synchronization of the Follicular Wave in Assisted Reproductive Technologies in Sheep: A Preliminary Study. Animals 2020, 10, 1208. [Google Scholar] [CrossRef] [PubMed]
- Duan, H.; Ge, W.; Yang, S.; Lv, J.; Ding, Z.; Hu, J.; Zhang, Y.; Zhao, X.; Hua, Y.; Xiao, L. Dihydrotestosterone regulates oestrogen secretion, oestrogen receptor expression, and apoptosis in granulosa cells during antral follicle development. J. Steroid Biochem. Mol. Biol. 2021, 207, 105819. [Google Scholar] [CrossRef] [PubMed]
- Palermo, R. Differential actions of FSH and LH during folliculogenesis. Reprod. Biomed. Online 2007, 15, 326–337. [Google Scholar] [CrossRef] [PubMed]
- Short, R.E.; Bellows, R.A.; Staigmiller, R.B.; Berardinelli, J.G.; Custer, E.E. Physiological mechanisms controlling anestrus and infertility in postpartum beef cattle. J. Anim. Sci. 1990, 68, 799–816. [Google Scholar] [CrossRef] [PubMed]
- Valdes, P.; Sierralta, P.; Barria, A.; Figueroa, G.; Berg, V.; Aravena, M.; Ossa, X.; Cardenas, H. Influence of basal and post-feeding prolactin levels on amenorrhea during breast feeding. Rev. Chil. Obstet. Ginecol. 1991, 56, 88–93. [Google Scholar] [PubMed]
- Kalyani, M.; Callahan, P.; Janik, J.M.; Shi, H.F. Effects of Pup Separation on Stress Response in Postpartum Female Rats. Int. J. Mol. Sci. 2017, 18, 1370. [Google Scholar] [CrossRef] [PubMed]
- Mohammadi, G.; Kohram, H.; Gooraninejad, S.; Yousefi, A.; Motaghedi, A. Ovarian follicular dynamics during the interovulatory interval in Najdi goats. Afr. J. Biotechnol. 2010, 9, 5236–5239. [Google Scholar]
- Kebede, H.; Lemma, A.; Negussie, H. Ultrasonographic studies on ovarian dynamics and associated estrus manifestations of jennies under controlled management, Ethiopia. Trop. Anim. Health Prod. 2012, 44, 1965–1970. [Google Scholar] [CrossRef] [PubMed]
- Larsen, J.L.; Bhanu, A.; Odell, W.D. Prolactin inhibition of pregnant mare’s serum stimulated follicle development in the rat ovary. Endocr. Res. 1990, 16, 449–459. [Google Scholar] [CrossRef]
- Bosch, E.; Alamá, P.; Romero, J.L.; Marí, M.; Labarta, E.; Pellicer, A. Serum progesterone is lower in ovarian stimulation with highly purified HMG compared to recombinant FSH owing to a different regulation of follicular steroidogenesis: A randomized controlled trial. Hum. Reprod. 2024, 39, 393–402. [Google Scholar] [CrossRef] [PubMed]
- Bowolaksono, A.; Fauzi, M.; Sundari, A.M.; Pustimbara, A.; Lestari, R.; Abinawanto; Dwiranti, A.; Fadhillah. The effects of luteinizing hormone as a suppression factor for apoptosis in bovine luteal cells in vitro. Reprod. Domest. Anim. 2021, 56, 744–753. [Google Scholar] [CrossRef] [PubMed]
- Yoshimura, Y.; Tada, S.; Oda, T.; Nakamura, Y.; Maruyama, K.; Ichikawa, F.; Ebihara, T.; Hirota, Y.; Sawada, T.; Kawakami, S. Direct inhibitory ovarian effects of prolactin in the process of ovulation. Nihon Sanka Fujinka Gakkai Zasshi 1989, 41, 83–89. [Google Scholar] [PubMed]
- Kumazawa, T.; Nakajima, A.; Ishiguro, T.; Jiuxin, Z.; Tanaharu, T.; Nishitani, H.; Inoue, Y.; Harada, S.; Hayasaka, I.; Tagawa, Y. Collaborative work on evaluation of ovarian toxicity 15) Two- or four-week repeated-dose studies and fertility study of bromocriptine in female rats. J. Toxicol. Sci. 2009, 34, SP157–SP165. [Google Scholar] [CrossRef]
- Saei Ghare Naz, M.; Rostami Dovom, M.; Ramezani Tehrani, F. The Menstrual Disturbances in Endocrine Disorders: A Narrative Review. Int. J. Endocrinol. Metab. 2020, 18, e106694. [Google Scholar] [CrossRef] [PubMed]
- Baldwin, S.N.; Jepps, T.A.; Greenwood, I.A. Cycling matters: Sex hormone regulation of vascular potassium channels. Channels 2023, 17, 2217637. [Google Scholar] [CrossRef] [PubMed]
- Zhao, H.Q.; Huang, Y.Z.; Shu, S.; Wang, G.W.; Fu, C.Q.; Huang, R.; Zhang, J.; Su, H.W.; He, Y.; Lei, C.Z.; et al. Transcriptomics and metabolomics of blood, urine and ovarian follicular fluid of yak at induced estrus stage. BMC Genom. 2024, 25, 201. [Google Scholar] [CrossRef] [PubMed]
- Szukiewicz, D. Current Insights in Prolactin Signaling and Ovulatory Function. Int. J. Mol. Sci. 2024, 25, 1976. [Google Scholar] [CrossRef] [PubMed]
- Shimizu, T. Molecular and cellular mechanisms for the regulation of ovarian follicular function in cows. J. Reprod. Dev. 2016, 62, 323–329. [Google Scholar] [CrossRef] [PubMed]
- Takiguchi, S.; Nakamura, Y.; Yamagata, Y.; Takayama, H.; Harada, A.; Sugino, N.; Kato, H. Role of transient hyperprolactinemia in the late follicular phase of the gonadotropin-stimulated cycle. Reprod. Med. Biol. 2002, 1, 69–74. [Google Scholar] [CrossRef] [PubMed]
- Duan, H.W.; Xiao, L.F.; Hu, J.J.; Zhang, Y.; Zhao, X.X.; Ge, W.B.; Jiang, Y.T.; Song, L.L.; Yang, S.S.; Luo, W.Z. Expression of oestrogen receptor, androgen receptor and progesterone nuclear receptor in sheep uterus during the oestrous cycle. Reprod. Domest. Anim. 2019, 54, 1305–1312. [Google Scholar] [CrossRef] [PubMed]
- Fernandez, J.; Bruno-Galarraga, M.M.; Cueto, M.I.; Bonadeo, N.; Notaro, U.; Soto, A.T.; de la Sota, R.L.; Salvetti, N.R.; Bianchi, C.P.; Cristina, C.; et al. Changes on corpus luteum structure and progesterone synthesis pathway after hCG or GnRH treatment during the early luteal phase in sheep. Anim. Reprod. Sci. 2024, 265, 107474. [Google Scholar] [CrossRef] [PubMed]
- Ginther, O.J.; Santos, V.G.; Mir, R.A.; Beg, M.A. Role of LH in the progesterone increase during the bromocriptine-induced prolactin decrease in heifers. Theriogenology 2012, 78, 1969–1976. [Google Scholar] [CrossRef] [PubMed]
- Aisaka, K.; Yoshida, K.; Mori, H. Analysis of clinical backgrounds and pathogenesis of luteal-phase defect. Horm. Res. 1992, 37 (Suppl. S1), 41–47. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.F.; Wang, P.; Zhou, Z.Y.; He, X.Y.; Tao, L.; Jiang, Y.T.; Lan, R.; Hong, Q.H.; Chu, M.X. Expression Profile Analysis to Identify Circular RNA Expression Signatures in the Prolificacy Trait of Yunshang Black Goat Pituitary in the Estrus Cycle. Front. Genet. 2022, 12, 801357. [Google Scholar] [CrossRef] [PubMed]
- Yang, R.; Duan, C.; Zhang, S.; Liu, Y.; Zhang, Y. Prolactin Regulates Ovine Ovarian Granulosa Cell Apoptosis by Affecting the Expression of MAPK12 Gene. Int. J. Mol. Sci. 2023, 24, 10269. [Google Scholar] [CrossRef]
- Picazo, R.A.; Ruiz, J.P.G.; Moreno, J.S.; de Bulnes, A.G.; Muñoz, J.; Silván, G.; Lorenzo, P.L.; Illera, J.C. Cellular localization and changes in expression of prolactin receptor isoforms in sheep ovary throughout the estrous cycle. Reproduction 2004, 128, 545–553. [Google Scholar] [CrossRef] [PubMed]
- Thompson, I.M.; Ozawa, M.; Bubolz, J.W.; Yang, Q.; Dahl, G.E. Bovine luteal prolactin receptor expression: Potential involvement in regulation of progesterone during the estrous cycle and pregnancy. J. Anim. Sci. 2011, 89, 1338–1346. [Google Scholar] [CrossRef] [PubMed]
- Patel, B.; Elguero, S.; Thakore, S.; Dahoud, W.; Bedaiwy, M.; Mesiano, S. Role of nuclear progesterone receptor isoforms in uterine pathophysiology. Hum. Reprod. Update 2015, 21, 155–173. [Google Scholar] [CrossRef] [PubMed]
- Yang, B.X.; An, Y.; Yang, Y.Y.; Zhao, Y.F.; Yu, K.; Weng, Y.; Du, C.G.; Li, H.J.; Yu, B.Y. The ERβ-cAMP signaling pathway regulates estradiol-induced ovine oocyte meiotic arrest. Theriogenology 2024, 214, 81–88. [Google Scholar] [CrossRef] [PubMed]
- Porter, M.B.; Brumsted, J.R.; Sites, C.K. Effect of prolactin on follicle-stimulating hormone receptor binding and progesterone production in cultured porcine granulosa cells. Fertil. Steril. 2000, 73, 99–105. [Google Scholar] [CrossRef] [PubMed]
- Andersen, C.Y. Inhibin-B secretion and FSH isoform distribution may play an integral part of follicular selection in the natural menstrual cycle. Mol. Hum. Reprod. 2017, 23, 16–24. [Google Scholar] [CrossRef] [PubMed]
- Jolly, P.D.; Tisdall, D.J.; Heath, D.A.; Lun, S.; McNatty, K.P. Apoptosis in bovine granulosa cells in relation to steroid synthesis, cyclic adenosine 3’,5’-monophosphate response to follicle-stimulating hormone and luteinizing hormone, and follicular atresia. Biol. Reprod. 1994, 51, 934–944. [Google Scholar] [CrossRef] [PubMed]
- Miller, W.L.; Auchus, R.J. The Molecular Biology, Biochemistry, and Physiology of Human Steroidogenesis and Its Disorders. Endocr. Rev. 2011, 32, 81–151. [Google Scholar] [CrossRef] [PubMed]
- Guo, Y.X.; Duan, C.H.; Hao, Q.H.; Liu, Y.Q.; Li, T.; Zhang, Y.J. Effect of short-term nutritional supplementation on hormone concentrations in ovarian follicular fluid and steroid regulating gene mRNA abundances in granulosa cells of ewes. Anim. Reprod. Sci. 2019, 211, 106208. [Google Scholar] [CrossRef] [PubMed]
- Gregory, S.J.; Townsend, J.; McNeilly, A.S.; Tortonese, D.J. Effects of prolactin on the luteinizing hormone response to gonadotropin-releasing hormone in primary pituitary cell cultures during the ovine annual reproductive cycle. Biol. Reprod. 2004, 70, 1299–1305. [Google Scholar] [CrossRef] [PubMed]
- ul Ain, N.; Khan, R.A.; Mirza, T.; Fayyaz, T.B. The Effects of Ficus caricaon Male and Female Reproductive Capabilities in Rats. Evid.-Based Complement. Altern. Med. 2022, 2022, 1799431. [Google Scholar] [CrossRef]
- Jeppesen, J.V.; Kristensen, S.G.; Nielsen, M.E.; Humaidan, P.; Dal Canto, M.; Fadini, R.; Schmidt, K.T.; Ernst, E.; Andersen, C.Y. LH-Receptor Gene Expression in Human Granulosa and Cumulus Cells from Antral and Preovulatory Follicles. J. Clin. Endocrinol. Metab. 2012, 97, E1524–E1531. [Google Scholar] [CrossRef] [PubMed]
- Slot, K.A.; Voorendt, M.; de Boer-Brouwer, M.; van Vugt, H.H.; Teerds, K.J. Estrous cycle dependent changes in expression and distribution of Fas, Fas ligand, Bcl-2, Bax, and pro- and active caspase-3 in the rat ovary. J. Endocrinol. 2006, 188, 179–192. [Google Scholar] [CrossRef] [PubMed]
- Kaur, S.; Kurokawa, M. Regulation of Oocyte Apoptosis: A View from Gene Knockout Mice. Int. J. Mol. Sci. 2023, 24, 1345. [Google Scholar] [CrossRef] [PubMed]
- Vaskivuo, T.E.; Ottander, U.; Oduwole, O.; Isomaa, V.; Vihko, P.; Olofsson, J.I.; Tapanainen, J.S. Role of apoptosis, apoptosis-related factors and 17β-hydroxysteroid dehydrogenases in human corpus luteum regression. Mol. Cell. Endocrinol. 2002, 194, 191–200. [Google Scholar] [CrossRef] [PubMed]
- Chesnokov, M.S.; Mamedova, A.R.; Zhivotovsky, B.; Kopeina, G.S. A matter of new life and cell death: Programmed cell death in the mammalian ovary. J. Biomed. Sci. 2024, 31, 31. [Google Scholar] [CrossRef] [PubMed]
- Li, H.L.; Pei, X.M.; Yu, H.; Wang, W.; Mao, D.G. Autophagic and apoptotic proteins in goat corpus luteum and the effect of Adiponectin/AdipoRon on luteal cell autophagy and apoptosis. Theriogenology 2024, 214, 245–256. [Google Scholar] [CrossRef] [PubMed]
- Rossetto, L.; Gallelli, M.F.; Aba, M.A.; Miragaya, M.H.; Bianchi, C.P. Effect of early administration of progesterone on the function of the corpus luteum of llamas. Anim. Reprod. Sci. 2023, 252, 107233. [Google Scholar] [CrossRef] [PubMed]
Gene | Sequence (5′-3′) | Size (bp) | Tm (°C) | Accession Number |
---|---|---|---|---|
L-PRLR | F: CCCCTTGTTCTCTGCTAAACCC R: CTATCCGTCACCCGAGACACC | 129 | 60 | O46561-1 |
S-PRLR | F:ACAGTAAGCGCCATCAACCA R: CTGGCTTGCATCGAATCTGC | 328 | 60 | O46561-2 |
FSHR | F: GTGACACCAAGATAGCCAAGCG R: GGGTAGAACAGGACCAGGAGGA | 151 | 60 | NM_001009289.1 |
LHR | F: ATCCAGAGCTGATGGCTACC | 115 | 60 | NM_001278566.2 |
R: GCAGCTGAGATGGCAAAGAA | ||||
PR | F: CAACAGCAAACCTGATACCT R: CCATCCTAGTCCAAATACCATT | 183 | 60 | XM_015100878.2 |
ER | F: CGGCTACGCAAGTGCTATGAA | 385 | 60 | XM_027972563.1 |
R: CCACAAATCCTGGCACCCT | ||||
StAR | F: ATTCAGGAGGCAAAGAGCAGC | 270 | 60 | XM_015094520.2 |
R: TCGGGTAAGGAAAATGGGTCA | ||||
3β-HSD | F: CAGTCTATGTTGGCAATGTGGC | 283 | 60 | NM_001135932.1 |
R: CGGTTGAAGCAGGGGTGGTAT | ||||
CYP11A1 | F: GTTTCGCTTTGCCTTTGAGTC | 120 | 60 | NM_001093789.1 |
R: ACAGTTCTGGAGGGAGGTTGA | ||||
CYP19A1 | F: GCTTTTGGAAGTGCTGAACCC | 379 | 60 | NM_001123000.1 |
R: CATGCCGATGAACTGCAACC | ||||
Caspase-3 | F: AATGCAAGAAGCAGGGCACCCA | 275 | 60 | XM_015104559.3 |
R:GGGTTACAGCGATGCAGAAGGTTCA | ||||
Bcl-2 | F:CGCTGAAGCGAAGCTGTAGA | 176 | 60 | XM_027960877.2 |
R: CGTTGAGCCTGAAAGCTGTTT | ||||
Bax | F: TGCCAGCAAACTGGTGCTCAA | 183 | 60 | XM_027978592.1 |
R: GCACTCCAGCCACAAAGATGGT | ||||
GAPDH | F: CTGACCTGCCGCCTGGAGAAA | 149 | 60 | NM001190390.1 |
R: GTAGAAGAGTGAGTGTCGCTGTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yue, S.; Chen, J.; Duan, C.; Li, X.; Yang, R.; Chen, M.; Li, Y.; Song, Z.; Zhang, Y.; Liu, Y. The Effect of Prolactin on Gene Expression and the Secretion of Reproductive Hormones in Ewes during the Estrus Cycle. Animals 2024, 14, 1873. https://doi.org/10.3390/ani14131873
Yue S, Chen J, Duan C, Li X, Yang R, Chen M, Li Y, Song Z, Zhang Y, Liu Y. The Effect of Prolactin on Gene Expression and the Secretion of Reproductive Hormones in Ewes during the Estrus Cycle. Animals. 2024; 14(13):1873. https://doi.org/10.3390/ani14131873
Chicago/Turabian StyleYue, Sicong, Jiaxin Chen, Chunhui Duan, Xiangyun Li, Ruochen Yang, Meijing Chen, Yu Li, Zhipan Song, Yingjie Zhang, and Yueqin Liu. 2024. "The Effect of Prolactin on Gene Expression and the Secretion of Reproductive Hormones in Ewes during the Estrus Cycle" Animals 14, no. 13: 1873. https://doi.org/10.3390/ani14131873
APA StyleYue, S., Chen, J., Duan, C., Li, X., Yang, R., Chen, M., Li, Y., Song, Z., Zhang, Y., & Liu, Y. (2024). The Effect of Prolactin on Gene Expression and the Secretion of Reproductive Hormones in Ewes during the Estrus Cycle. Animals, 14(13), 1873. https://doi.org/10.3390/ani14131873