A Carnitine-Containing Product Improves Aspects of Post-Exercise Recovery in Adult Horses
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Diet and Husbandry
2.2. Training and Exercise Test
2.3. Heart Rate Analysis
2.4. Sample Retrieval
2.5. Quantitative Reverse-Transcription Polymerase Chain Reaction (qRT-PCR)
2.6. Kinematics
2.7. Statistics
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Pouca, M.C.P.V.; Parente, M.P.L.; Jorge, R.M.N.; Ashton-Miller, J.A. Injuries in Muscle-Tendon-Bone Units: A Systematic Review Considering the Role of Passive Tissue Fatigue. Orthop. J. Sports Med. 2021, 9, 23259671211020732. [Google Scholar] [CrossRef]
- Pethick, J.; Winter, S.L.; Burnley, M. Physiological Complexity: Influence of Ageing, Disease and Neuromuscular Fatigue on Muscle Force and Torque Fluctuations. Exp. Physiol. 2021, 106, 2046–2059. [Google Scholar] [CrossRef]
- Edwards, W.B. Modeling Overuse Injuries in Sport as a Mechanical Fatigue Phenomenon. Exerc. Sport Sci. R 2018, 46, 224–231. [Google Scholar] [CrossRef] [PubMed]
- Rivero, J.-L.L.; Hill, E.W. Skeletal Muscle Adaptations and Muscle Genomics of Performance Horses. Vet. J. 2016, 209, 5–13. [Google Scholar] [CrossRef] [PubMed]
- Bryan, K.; McGivney, B.A.; Farries, G.; McGettigan, P.A.; McGivney, C.L.; Gough, K.F.; MacHugh, D.E.; Katz, L.M.; Hill, E.W. Equine Skeletal Muscle Adaptations to Exercise and Training: Evidence of Differential Regulation of Autophagosomal and Mitochondrial Components. BMC Genom. 2017, 18, 595. [Google Scholar] [CrossRef] [PubMed]
- Maśko, M.; Domino, M.; Jasiński, T.; Witkowska-Piłaszewicz, O. The Physical Activity-Dependent Hematological and Biochemical Changes in School Horses in Comparison to Blood Profiles in Endurance and Race Horses. Animals 2021, 11, 1128. [Google Scholar] [CrossRef] [PubMed]
- Bröjer, J.; Holm, S.; Jonasson, R.; Hedenström, U.; Essén-Gustavsson, B. Synthesis of Proglycogen and Macroglycogen in Skeletal Muscle of Standardbred Trotters after Intermittent Exercise. Equine. Vet. J. 2006, 38, 335–339. [Google Scholar] [CrossRef]
- Snijders, T.; Verdijk, L.B.; Beelen, M.; McKay, B.R.; Parise, G.; Kadi, F.; Loon, L.J.C. van A Single Bout of Exercise Activates Skeletal Muscle Satellite Cells during Subsequent Overnight Recovery. Exp. Physiol. 2012, 97, 762–773. [Google Scholar] [CrossRef] [PubMed]
- Kawai, M.; Aida, H.; Hiraga, A.; Miyata, H. Muscle Satellite Cells Are Activated after Exercise to Exhaustion in Thoroughbred Horses. Equine Vet. J. 2013, 45, 512–517. [Google Scholar] [CrossRef] [PubMed]
- Butcher, M.T.; Hermanson, J.W.; Ducharme, N.G.; Mitchell, L.M.; Soderholm, L.V.; Bertram, J.E.A. Superficial Digital Flexor Tendon Lesions in Racehorses as a Sequela to Muscle Fatigue: A Preliminary Study. Equine Vet. J. 2007, 39, 540–545. [Google Scholar] [CrossRef] [PubMed]
- Fielding, R.; Riede, L.; Lugo, J.P.; Bellamine, A. L-Carnitine Supplementation in Recovery after Exercise. Nutrients 2018, 10, 349. [Google Scholar] [CrossRef] [PubMed]
- Sawicka, A.K.; Renzi, G.; Olek, R.A. The Bright and the Dark Sides of L-Carnitine Supplementation: A Systematic Review. J. Int. Soc. Sport Nutr. 2020, 17, 49. [Google Scholar] [CrossRef]
- Gnoni, A.; Longo, S.; Gnoni, G.V.; Giudetti, A.M. Carnitine in Human Muscle Bioenergetics: Can Carnitine Supplementation Improve Physical Exercise? Molecules 2020, 25, 182. [Google Scholar] [CrossRef] [PubMed]
- Stefan, M.; Sharp, M.; Gheith, R.; Lowery, R.; Ottinger, C.; Wilson, J.; Durkee, S.; Bellamine, A. L-Carnitine Tartrate Supplementation for 5 Weeks Improves Exercise Recovery in Men and Women: A Randomized, Double-Blind, Placebo-Controlled Trial. Nutrients 2021, 13, 3432. [Google Scholar] [CrossRef] [PubMed]
- Rivero, J.-L.L.; Sporleder, H.-P.; Quiroz-Rothe, E.; Vervuert, I.; Coenen, M.; Harmeyer, J. Oral L-carnitine Combined with Training Promotes Changes in Skeletal Muscle. Equine Vet. J. 2002, 34, 269–274. [Google Scholar] [CrossRef]
- Suzuki, K.; Tominaga, T.; Ruhee, R.T.; Ma, S. Characterization and Modulation of Systemic Inflammatory Response to Exhaustive Exercise in Relation to Oxidative Stress. Antioxidants 2020, 9, 401. [Google Scholar] [CrossRef]
- Paulsen, G.; Mikkelsen, U.R.; Raastad, T.; Peake, J.M. Leucocytes, Cytokines and Satellite Cells: What Role Do They Play in Muscle Damage and Regeneration Following Eccentric Exercise? Exerc. Immunol. Rev. 2012, 18, 42–97. [Google Scholar]
- Valigura, H.C.; Leatherwood, J.L.; Martinez, R.E.; Norton, S.; White-Springer, S.H. Dietary Supplementation of a Saccharomyces Cerevisiae Fermentation Product Attenuates Exercise-Induced Stress Markers in Young Horses. J. Anim. Sci. 2021, 99, skab199. [Google Scholar] [CrossRef]
- Page, A.E.; Stewart, J.C.; Fielding, C.L.; Horohov, D.W. The Effect of a 160-Kilometer Competitive Endurance Ride on Inflammatory Marker MRNA Expression in Horses. J. Equine. Vet. Sci. 2019, 79, 45–49. [Google Scholar] [CrossRef]
- Wu, C.; Zhu, M.; Lu, Z.; Zhang, Y.; Li, L.; Li, N.; Yin, L.; Wang, H.; Song, W.; Xu, H. L-Carnitine Ameliorates the Muscle Wasting of Cancer Cachexia through the AKT/FOXO3a/MaFbx Axis. Nutr. Metab. 2021, 18, 98. [Google Scholar] [CrossRef]
- Emran, T.; Chowdhury, N.I.; Sarker, M.; Bepari, A.K.; Hossain, M.; Rahman, G.M.S.; Reza, H.M. L-Carnitine Protects Cardiac Damage by Reducing Oxidative Stress and Inflammatory Response via Inhibition of Tumor Necrosis Factor-Alpha and Interleukin-1beta against Isoproterenol-Induced Myocardial Infarction. Biomed. Pharmacother. 2021, 143, 112139. [Google Scholar] [CrossRef] [PubMed]
- Kalhori, Z.; Mehranjani, M.S.; Azadbakht, M.; Shariatzadeh, M.A. L-Carnitine Improves Endocrine Function and Folliculogenesis by Reducing Inflammation, Oxidative Stress and Apoptosis in Mice Following Induction of Polycystic Ovary Syndrome. Reprod. Fertil. Dev. 2018, 31, 282. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Xu, J.; Zheng, J.; Zhang, X.; Shao, J.; Zhao, L.; Hao, J. Anti-Inflammatory and Antioxidant Effects of Acetyl-L-Carnitine on Atherosclerotic Rats. Med. Sci. Monit. Int. Med. J. Exp. Clin. Res. 2020, 26, e920250. [Google Scholar] [CrossRef]
- Donovan, D.C.; Jackson, C.A.; Colahan, P.T.; Norton, N.; Hurley, D.J. Exercise-Induced Alterations in pro-Inflammatory Cytokines and Prostaglandin F2α in Horses. Vet. Immunol. Immunop. 2007, 118, 263–269. [Google Scholar] [CrossRef] [PubMed]
- Alicka, M.; Kornicka-Garbowska, K.; Kucharczyk, K.; Kępska, M.; Röcken, M.; Marycz, K. Age-Dependent Impairment of Adipose-Derived Stem Cells Isolated from Horses. Stem. Cell Res. Ther. 2020, 11, 4. [Google Scholar] [CrossRef] [PubMed]
- Brandt, A.M.; Kania, J.M.; Gonzalez, M.L.; Johnson, S.E. Hepatocyte Growth Factor Acts as a Mitogen for Equine Satellite Cells via Protein Kinase C δ Directed Signaling. J. Anim. Sci. 2018, 165, 307. [Google Scholar] [CrossRef]
- Busse, N.I.; Gonzalez, M.L.; Krason, M.L.; Johnson, S.E. β-Hydroxy β-Methylbutyrate Supplementation to Adult Thoroughbred Geldings Increases Type IIA Fiber Content in the Gluteus Medius. J. Anim. Sci. 2021, 99, skab264. [Google Scholar] [CrossRef] [PubMed]
- Mielgo-Ayuso, J.; Pietrantonio, L.; Viribay, A.; Calleja-González, J.; González-Bernal, J.; Fernández-Lázaro, D. Effect of Acute and Chronic Oral L-Carnitine Supplementation on Exercise Performance Based on the Exercise Intensity: A Systematic Review. Nutrients 2021, 13, 4359. [Google Scholar] [CrossRef]
- Guzel, N.A.; Orer, G.E.; Bircan, F.S.; Cevher, S.C. Effects of Acute L-Carnitine Supplementation on Nitric Oxide Production and Oxidative Stress after Exhaustive Exercise in Young Soccer Players. J. Sport. Med. Phys. Fit. 2014, 55, 9–15. [Google Scholar]
- White, S.H.; Johnson, S.E.; Bobel, J.M.; Warren, L.K. Dietary Selenium and Prolonged Exercise Alter Gene Expression and Activity of Antioxidant Enzymes in Equine Skeletal Muscle. J. Anim. Sci. 2016, 94, 2867–2878. [Google Scholar] [CrossRef] [PubMed]
- White, S.H.; Warren, L.K.; Li, C.; Wohlgemuth, S.E. Submaximal Exercise Training Improves Mitochondrial Efficiency in the Gluteus Medius but Not in the Triceps Brachii of Young Equine Athletes. Sci. Rep. 2017, 7, 14389. [Google Scholar] [CrossRef] [PubMed]
- Ott, E.C.; Cavinder, C.A.; Wang, S.; Smith, T.; Lemley, C.O.; Dinh, T.T.N. Oxidative Stress Biomarkers and Free Amino Acid Concentrations in the Blood Plasma of Moderately Exercised Horses Indicate Adaptive Response to Prolonged Exercise Training. J. Anim. Sci. 2022, 100, skac086. [Google Scholar] [CrossRef] [PubMed]
- Kent, E.; Coleman, S.; Bruemmer, J.; Casagrande, R.R.; Levihn, C.; Romo, G.; Herkelman, K.; Hess, T. Comparison of an Antioxidant Source and Antioxidant Plus BCAA on Athletic Performance and Post Exercise Recovery of Horses. J. Equine. Vet. Sci. 2023, 121, 104200. [Google Scholar] [CrossRef]
- Thorpe, C.T.; Riley, G.P.; Birch, H.L.; Clegg, P.D.; Screen, H.R.C. Fascicles from Energy-Storing Tendons Show an Age-Specific Response to Cyclic Fatigue Loading. J. R. Soc. Interface 2014, 11, 20131058. [Google Scholar] [CrossRef] [PubMed]
- Mami, S.; Khaje, G.; Shahriari, A.; Gooraninejad, S. Evaluation of Biological Indicators of Fatigue and Muscle Damage in Arabian Horses After Race. J. Equine Vet. Sci. 2019, 78, 74–78. [Google Scholar] [CrossRef] [PubMed]
- Muñoz, A.; Riber, C.; Santisteban, R.; Lucas, R.G.; Castejón, F.M. Effect of Training Duration and Exercise on Blood-Borne Substrates, Plasma Lactate and Enzyme Concentrations in Andalusian, Anglo-Arabian and Arabian Breeds. Equine Vet. J. Suppl. 2002, 34, 245–251. [Google Scholar] [CrossRef] [PubMed]
- Simmons, R.; Doma, K.; Sinclair, W.; Connor, J.; Leicht, A. Acute Effects of Training Loads on Muscle Damage Markers and Performance in Semi-Elite and Elite Athletes: A Systematic Review and Meta-Analysis. Sports Med. 2021, 51, 2181–2207. [Google Scholar] [CrossRef] [PubMed]
- Peake, J.M.; Neubauer, O.; Gatta, P.A.D.; Nosaka, K. Muscle Damage and Inflammation during Recovery from Exercise. J. Appl. Physiol. 2017, 122, 559–570. [Google Scholar] [CrossRef] [PubMed]
- Hansen, S.; Sun, L.; Baptiste, K.E.; Fjeldborg, J.; Horohov, D.W. Age-Related Changes in Intracellular Expression of IFN-γ and TNF-α in Equine Lymphocytes Measured in Bronchoalveolar Lavage and Peripheral Blood. Dev. Comp. Immunol. 2013, 39, 228–233. [Google Scholar] [CrossRef]
- Willenborg, S.; Injarabian, L.; Eming, S.A. Role of Macrophages in Wound Healing. Cold Spring Harb. Perspect. Biol. 2022, 14, a041216. [Google Scholar] [CrossRef] [PubMed]
- Horohov, D.W.; Sinatra, S.T.; Chopra, R.K.; Jankowitz, S.; Betancourt, A.; Bloomer, R.J. The Effect of Exercise and Nutritional Supplementation on Proinflammatory Cytokine Expression in Young Racehorses During Training. J. Equine Vet. Sci. 2012, 32, 805–815. [Google Scholar] [CrossRef]
- Hale, J.N.; Hughes, K.J.; Hall, S.; Labens, R. The Effect of Exercise on Cytokine Concentration in Equine Autologous Conditioned Serum. Equine Vet. J. 2022. [CrossRef]
- Fagan, M.M.; Harris, P.; Adams, A.; Pazdro, R.; Krotky, A.; Call, J.; Duberstein, K.J. Form of Vitamin E Supplementation Affects Oxidative and Inflammatory Response in Exercising Horses. J. Equine Vet. Sci. 2020, 91, 103103. [Google Scholar] [CrossRef]
- Liburt, N.R.; Adams, A.A.; Betancourt, A.; Horohov, D.W.; Mckeever, K.H. Exercise-induced Increases in Inflammatory Cytokines in Muscle and Blood of Horses. Equine Vet. J. 2010, 42, 280–288. [Google Scholar] [CrossRef]
- Senna, G.W.; Dantas, E.H.M.; Scudese, E.; Brandão, P.P.; Lira, V.A.; Baffi, M.; Ribeiro, L.C.P.; Simão, R.; Thomas, E.; Bianco, A. Higher Muscle Damage Triggered by Shorter Inter-Set Rest Periods in Volume-Equated Resistance Exercise. Front. Physiol. 2022, 13, 827847. [Google Scholar] [CrossRef]
- Antunes, B.M.; Rosa-Neto, J.C.; Batatinha, H.A.P.; Franchini, E.; Teixeira, A.M.; Lira, F.S. Physical Fitness Status Modulates the Inflammatory Proteins in Peripheral Blood and Circulating Monocytes: Role of PPAR-Gamma. Sci. Rep. 2020, 10, 14094. [Google Scholar] [CrossRef]
Component | Grain | Hay |
---|---|---|
DE, Mcal/kg | 3.33 | 2.11 |
Crude protein, % | 13.9 | 16.5 |
Crude fat, % | 14.9 | 4.0 |
Lysine, % | 0.7 | 0.6 |
Acid detergent fiber, % | 22.4 | 35.6 |
Neutral detergent fiber, % | 34.4 | 60.8 |
Calcium, % | 1.2 | 0.46 |
Phosphorus, % | 0.56 | 0.30 |
Magnesium, % | 0.39 | 0.31 |
Potassium, % | 1.30 | 2.07 |
Sodium, % | 0.20 | 0.13 |
Iron, ppm | 1130.0 | 112.0 |
Copper, ppm | 44.0 | 9.0 |
Manganese, ppm | 211.0 | 64.0 |
Zinc, ppm | 195.0 | 26.0 |
Molybdenum | 1.5 | 1.2 |
Gene 1 | Accession Number | Forward, 5′-3′ | Reverse, 5′-3′ | Reference |
---|---|---|---|---|
IL1β | NM_001082526.1 | GTCTTGGAAGCTGCCCTTCA | GTCTTGGAAGCTGCCCTTCA | [24] |
IL8 | NM_001083951.2 | CTGGCTGTGGCTCTCTTG | CAGTTTGGGATTGAAAGGTTTG | [25] |
IL10 | NM_001082490.1 | TGTTGTTGAACGGGTCCCTG | ACTCTTCACCTGCTCCACTG | [25] |
TNFɑ | NM_001081819.2 | AAGGACATCATGAGCACTGAAAG | CGGCCCCCTGCCTTCT | [24] |
GAPDH | NM_001163856.1 | CCACCCCTAACGTGTCAGTC | AATCGCAGGAGACAACCTGG | [26] |
CON | AID | p-Value | ||||||||
---|---|---|---|---|---|---|---|---|---|---|
Mean | SEM | Mean | SEM | D | A | D X A | ||||
HRmax, bpm | D1 | 214.0 | ± | 3.2 | 221.6 | ± | 3.5 | 0.67 | 0.09 | 0.90 |
D2 | 214.5 | ± | 2.7 | 222.3 | ± | 3.4 | ||||
Time to HRmax, s | D1 | 232.9 | ± | 19.8 | 233.4 | ± | 24.9 | 0.16 | 0.86 | 0.94 |
D2 | 206.6 | ± | 15.5 | 212.3 | ± | 23.7 | ||||
Time at HRmax, s | D1 | 13.3 | ± | 5.4 | 58.6 | ± | 32.7 | 0.62 | 0.31 | 0.13 |
D2 | 19.9 | ± | 5.8 | 77.1 | ± | 34.0 | ||||
Time to V200, s | D1 | 74.9 | ± | 19.5 | 79.9 | ± | 26.8 | 0.44 | 0.92 | 0.39 |
D2 | 71.1 | ± | 14.4 | 59.0 | ± | 18.2 | ||||
Gallop time, s | D1 | 243.1 | ± | 15.1 | 275.6 | ± | 11.6 | 0.12 | 0.14 | 0.94 |
D2 | 236.3 | ± | 17.3 | 268.1 | ± | 17.4 | ||||
Recovery HR decline, bpm/m | D1 | −43.8 | ± | 4.0 | −42.9 | ± | 4.3 | 0.01 | 0.70 | 0.24 |
D2 | −35.4 | ± | 3.8 | −39.9 | ± | 3.7 |
Gene | Time 1, h | Day 1 | Day 2 | p-Value | ||||||
---|---|---|---|---|---|---|---|---|---|---|
Day | Time | D X T 2 | ||||||||
IL1β | 0 | 1.08 | ± | 0.10 a | 0.89 | ± | 0.22 x | 0.03 | ≤0.01 | 0.12 |
1 | 1.81 | ± | 0.28 b | 1.09 | ± | 0.18 y | ||||
4 | 1.90 | ± | 0.21 b | 1.10 | ± | 0.26 y | ||||
6 | 1.34 | ± | 0.12 a,b | 0.89 | ± | 0.19 x,y | ||||
IL8 | 0 | 1.11 | ± | 0.12 a | 1.16 | ± | 0.25 x | 0.03 | 0.02 | 0.06 |
1 | 2.29 | ± | 0.46 b | 1.35 | ± | 0.25 y | ||||
4 | 2.10 | ± | 0.25 b | 1.09 | ± | 0.18 x,y | ||||
6 | 2.04 | ± | 0.29 b | 1.15 | ± | 0.22 y | ||||
IL10 | 0 | 1.72 | ± | 0.27 a | 1.65 | ± | 0.36 ax | 0.24 | ≤0.01 | 0.02 |
1 | 2.86 | ± | 0.46 b | 1.68 | ± | 0.41 ay | ||||
4 | 1.17 | ± | 0.15 ac | 0.81 | ± | 0.19 bz | ||||
6 | 1.12 | ± | 0.20 ac | 0.99 | ± | 0.21 bz | ||||
TNFα | 0 | 1.05 | ± | 0.09 | 1.02 | ± | 0.28 x | 0.84 | ≤0.01 | 0.84 |
1 | 0.95 | ± | 0.09 | 0.82 | ± | 0.21 x,y | ||||
4 | 0.76 | ± | 0.10 | 0.94 | ± | 0.24 y | ||||
6 | 0.95 | ± | 0.09 | 1.13 | ± | 0.24 x |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Johnson, S.E.; Barshick, M.R.; Gonzalez, M.L.; Riley, J.W.; Pelletier, M.E.; Castanho, B.C.; Ealy, E.N. A Carnitine-Containing Product Improves Aspects of Post-Exercise Recovery in Adult Horses. Animals 2023, 13, 657. https://doi.org/10.3390/ani13040657
Johnson SE, Barshick MR, Gonzalez ML, Riley JW, Pelletier ME, Castanho BC, Ealy EN. A Carnitine-Containing Product Improves Aspects of Post-Exercise Recovery in Adult Horses. Animals. 2023; 13(4):657. https://doi.org/10.3390/ani13040657
Chicago/Turabian StyleJohnson, Sally E., Madison R. Barshick, Madison L. Gonzalez, Julia Wells Riley, Megan E. Pelletier, Beatriz C. Castanho, and Elayna N. Ealy. 2023. "A Carnitine-Containing Product Improves Aspects of Post-Exercise Recovery in Adult Horses" Animals 13, no. 4: 657. https://doi.org/10.3390/ani13040657
APA StyleJohnson, S. E., Barshick, M. R., Gonzalez, M. L., Riley, J. W., Pelletier, M. E., Castanho, B. C., & Ealy, E. N. (2023). A Carnitine-Containing Product Improves Aspects of Post-Exercise Recovery in Adult Horses. Animals, 13(4), 657. https://doi.org/10.3390/ani13040657