Epidemiological Analysis and Genetic Characterization of Parvovirus in Ducks in Northern Vietnam Reveal Evidence of Recombination
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Samples
2.3. DNA Extraction and Polymerase Chain Reaction (PCR)
2.4. Nucleotide Sequencing and Phylogenetic Analyses
2.5. Analyses of Recombination and Natural Selection Profiles
2.6. Statistical Analysis
3. Results
3.1. Detection of Waterfowl Parvovirus Genome in Field Samples
3.2. Characterization of Waterfowl Parvovirus Genome and Protein
3.3. Recombination Analysis
3.4. Evolutionary Analysis of Viral Genome
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Walker, P.J.; Siddell, S.G.; Lefkowitz, E.J.; Mushegian, A.R.; Dempsey, D.M.; Dutilh, B.E.; Harrach, B.; Harrison, R.L.; Hendrickson, R.C.; Junglen, S.; et al. Changes to virus taxonomy and the international code of virus classification and nomenclature ratified by the International Committee on Taxonomy of Viruses (2019). Arch. Virol. 2019, 164, 2417–2429. [Google Scholar] [CrossRef] [PubMed]
- Palya, V. Parvovirus infections of water fowl. In Diseases of Poultry, 13th ed.; Ames, I.A., Ed.; John Wiley: Hoboken, NJ, USA, 2013. [Google Scholar]
- Glavits, R.; Zolnai, A.; Szabo, E.; Ivanics, E.; Zarka, P.; Mato, T.; Palya, V. Comparative pathological studies on domestic geese (Anser anser domestica) and Muscovy ducks (Cairina moschata) experimentally infected with parvovirus strains of goose and Muscovy duck origin. Acta Vet. Hung. 2005, 53, 73–89. [Google Scholar] [CrossRef] [PubMed]
- Zadori, Z.; Stefancsik, R.; Rauch, T.; Kisary, J. Analysis of the complete nucleotide sequences of goose and muscovy duck parvoviruses indicates common ancestral origin with adeno-associated virus 2. Virology 1995, 212, 562–573. [Google Scholar] [CrossRef] [PubMed]
- Zadori, Z.; Erdei, J.; Nagy, J.; Kisary, J. Characteristics of the genome of goose parvovirus. Avian Pathol. 1994, 23, 359–364. [Google Scholar] [CrossRef]
- Poonia, B.; Dunn, P.A.; Lu, H.; Jarosinski, K.W.; Schat, K.A. Isolation and molecular characterization of a new Muscovy duck parvovirus from Muscovy ducks in the USA. Avian Pathol. 2006, 35, 435–441. [Google Scholar] [CrossRef]
- Wang, S.; Cheng, X.X.; Chen, S.Y.; Lin, F.Q.; Chen, S.L.; Zhu, X.L.; Wang, J.X.; Huang, M.Q.; Zheng, M. Phylogenetic analysis of VP1 gene sequences of waterfowl parvoviruses from the Mainland of China revealed genetic diversity and recombination. Gene 2016, 578, 124–131. [Google Scholar] [CrossRef]
- Tsai, H.J.; Tseng, C.H.; Chang, P.C.; Mei, K.; Wang, S.C. Genetic variation of viral protein 1 genes of field strains of waterfowl parvoviruses and their attenuated derivatives. Avian Dis. 2004, 48, 512–521. [Google Scholar] [CrossRef]
- Tatar-Kis, T.; Mato, T.; Markos, B.; Palya, V. Phylogenetic analysis of Hungarian goose parvovirus isolates and vaccine strains. Avian Pathol. 2004, 33, 438–444. [Google Scholar] [CrossRef]
- Mochizuki, M.; Ohshima, T.; Une, Y.; Yachi, A. Recombination between vaccine and field strains of canine parvovirus is revealed by isolation of virus in canine and feline cell cultures. J. Vet. Med. Sci. 2008, 70, 1305–1314. [Google Scholar] [CrossRef]
- Chen, H.; Dou, Y.; Tang, Y.; Zhang, Z.; Zheng, X.; Niu, X.; Yang, J.; Yu, X.; Diao, Y. Isolation and genomic characterization of a duck-origin GPV-related parvovirus from Cherry Valley ducklings in China. PLoS ONE 2015, 10, e0140284. [Google Scholar] [CrossRef]
- Soliman, M.A.; Erfan, A.M.; Samy, M.; Mahana, O.; Nasef, S.A. Detection of novel goose parvovirus disease associated with short beak and dwarfism syndrome in commercial ducks. Animals 2020, 10, 1833. [Google Scholar] [CrossRef] [PubMed]
- Matczuk, A.K.; Chmielewska-Wladyka, M.; Siedlecka, M.; Bednarek, K.J.; Wieliczko, A. Short beak and dwarfism syndrome in ducks in Poland caused by novel goose parvovirus. Animals 2020, 10, 2397. [Google Scholar] [CrossRef] [PubMed]
- Li, P.; Lin, S.; Zhang, R.; Chen, J.; Sun, D.; Lan, J.; Song, S.; Xie, Z.; Jiang, S. Isolation and characterization of novel goose parvovirus-related virus reveal the evolution of waterfowl parvovirus. Transbound. Emerg. Dis. 2018, 65, e284–e295. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Mi, Q.; Wang, Z.; Jia, J.; Li, Y.; Zhu, G. Sole recombinant Muscovy duck parvovirus infection in Muscovy ducklings can form characteristic intestinal embolism. Vet. Microbiol. 2020, 242, 108590. [Google Scholar] [CrossRef]
- Wang, J.; Wang, Z.; Jia, J.; Ling, J.; Mi, Q.; Zhu, G. Retrospective investigation and molecular characteristics of the recombinant Muscovy duck parvovirus circulating in Muscovy duck flocks in China. Avian Pathol. 2019, 48, 343–351. [Google Scholar] [CrossRef]
- Wang, J.; Ling, J.; Wang, Z.; Huang, Y.; Zhu, J.; Zhu, G. Molecular characterization of a novel Muscovy duck parvovirus isolate: Evidence of recombination between classical MDPV and goose parvovirus strains. BMC Vet. Res. 2017, 13, 327. [Google Scholar] [CrossRef]
- Nguyen, V.G.; Dang, H.A.; Nguyen, H.H.; Nguyen, T.B.; Cao, T.B.P.; Huynh, T.M. The preliminary result on detection of Waterfowl parvovirus in Hung Yen province 2019. Vietnam. J. Agri. Sci. 2019, 17, 816–825. [Google Scholar]
- Thompson, J.D.; Higgins, D.G.; Gibson, T.J. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22, 4673–4680. [Google Scholar] [CrossRef]
- Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
- Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef]
- Martin, D.P.; Murrell, B.; Golden, M.; Khoosal, A.; Muhire, B. RDP4: Detection and analysis of recombination patterns in virus genomes. Virus Evol. 2015, 1, vev003. [Google Scholar] [CrossRef]
- Murrell, B.; Moola, S.; Mabona, A.; Weighill, T.; Sheward, D.; Kosakovsky Pond, S.L.; Scheffler, K. FUBAR: A fast, unconstrained bayesian approximation for inferring selection. Mol. Biol. Evol. 2013, 30, 1196–1205. [Google Scholar] [CrossRef] [PubMed]
- Yu, K.; Ma, X.; Sheng, Z.; Qi, L.; Liu, C.; Wang, D.; Huang, B.; Li, F.; Song, M. Identification of goose-origin parvovirus as a cause of newly emerging beak atrophy and dwarfism syndrome in ducklings. J. Clin. Microbiol. 2016, 54, 1999–2007. [Google Scholar] [CrossRef] [PubMed]
- Shien, J.H.; Wang, Y.S.; Chen, C.H.; Shieh, H.K.; Hu, C.C.; Chang, P.C. Identification of sequence changes in live attenuated goose parvovirus vaccine strains developed in Asia and Europe. Avian Pathol. 2008, 37, 499–505. [Google Scholar] [CrossRef]
- Yu, T.F.; Ma, B.; Wang, J.W. Identification of linear B-cell epitopes on goose parvovirus non-structural protein. Vet. Immunol. Immunopathol. 2016, 179, 85–88. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.J.; Yang, Y.T.; Zou, H.Y.; Chen, S.J.; Yang, C.; Tian, Y.B.; Huang, Y.M. Identification of recombination in novel goose parvovirus isolated from domesticated Jing-Xi partridge ducks in South China. Virus Genes 2020, 56, 600–609. [Google Scholar] [CrossRef] [PubMed]
- Wan, C.; Liu, R.; Chen, C.; Cheng, L.; Shi, S.; Fu, G.; Chen, H.; Fu, Q.; Huang, Y. Novel goose parvovirus in domestic Linwu sheldrakes with short beak and dwarfism syndrome, China. Transbound. Emerg. Dis. 2019, 66, 1834–1839. [Google Scholar] [CrossRef]
- Fu, Q.; Huang, Y.; Wan, C.; Fu, G.; Qi, B.; Cheng, L.; Shi, S.; Chen, H.; Liu, R.; Chen, Z. Genomic and pathogenic analysis of a Muscovy duck parvovirus strain causing short beak and dwarfism syndrome without tongue protrusion. Res. Vet. Sci. 2017, 115, 393–400. [Google Scholar] [CrossRef]
- Zhu, Y.; Zhou, Z.; Huang, Y.; Yu, R.; Dong, S.; Li, Z.; Zhang, Y. Identification of a recombinant Muscovy Duck parvovirus (MDPV) in Shanghai, China. Vet. Microbiol. 2014, 174, 560–564. [Google Scholar] [CrossRef]
- Desvaux, S.; Nguyen, C.O.; Vu, D.T.; Henriquez, C.; Ky, V.D.; Roger, F.; Fenwick, S.; Goutard, F. Risk of introduction in northern Vietnam of HPAI viruses from China: Description, patterns and drivers of illegal poultry trade. Transbound. Emerg. Dis. 2016, 63, 389–397. [Google Scholar] [CrossRef]
- Fan, W.; Sun, Z.; Shen, T.; Xu, D.; Huang, K.; Zhou, J.; Song, S.; Yan, L. Analysis of evolutionary processes of species jump in waterfowl parvovirus. Front. Microbiol. 2017, 8, 421. [Google Scholar] [CrossRef] [PubMed]
Target | Name | Sequence (5’–3’) | PCR Product (bp) | Location of Target Genes on the Viral Genome | Reference |
---|---|---|---|---|---|
PCR | PV-F | CCAAGCTACAACAACCACAT | 539 | [4] | |
PV-R | TGAGCGAACATGCTATGGAAGG | ||||
Sequencing | GPV-P1-F | CTTATTGGAGGGTTCGTTCGT | 176 | 5′-UTR | [14] |
GPV-P1-R | GCATGCGCGTGGTCAACCTAACA | ||||
GPV-P2-F | GCATGCCGCGCGGTCAGCCCAATA | 1033 | 5′-UTR/Rep | [14] | |
GPV-P2-R | ATTTCAATGAGCCAATCAACAAGG | ||||
GPV-P3-F | GCCTTTATTTACTGCTGC | 1443 | Rep | [14] | |
GPV-P3-R | GCTTTCAGATTCCGCCAC | ||||
GPV-P4-F | CTTGATGATGCTGAAAATGAAC | 1446 | Rep/Cap | [14] | |
GPV-P4-R | GCCCATGGTGCCATAAGC | ||||
GPV-P5-F | CGCTCATTCACAGGACTTAGACA | 1170 | Cap/3′-UTR | [14] | |
GPV-P5-R | GCATGCGCGTGGTCAACCTAACA |
GenBank Accession No. | Strain | Location | Source | Year |
---|---|---|---|---|
MN549533.1 | GDQY1802 | China | Duck | 2018 |
MN549532.1 | GDSG1902 | China | Duck | 2018 |
KT935531.2 | JS1 | China | Duck | 2015 |
KX384726.2 | DS15 | China | Duck | 2015 |
KU641558.1 | CVS01 | China | Duck | 2015 |
KY679174.1 | SC16 | China | Duck | 2016 |
MF441227.1 | AH1605 | China | Duck | 2016 |
MH444513.1 | AH | China | Duck | 2018 |
MN415972.1 | SD1228 | China | Duck | 2018 |
MN415972.1 | SD1228 | China | Duck | 2018 |
MN356044.1 | SDJN19 | China | Duck | 2019 |
EU583392.1 | VG32/1 vaccine | Taiwan | Goose | 2008 |
EU583389.1 | 82-0321V vaccine | Taiwan | Goose | 1982 |
MT646164.1 | AHAU30 | China | Duck | 2019 |
EF515837.1 | DY | China | Muscovy duck | 2007 |
MT646163.1 | AHAU41 | China | Duck | 2019 |
MF942876.1 | SQ0412 | China | Goose | 2017 |
KY475562.1 | RC16 | China | Goose | 2016 |
KC996730.1 | YZ99-6 | China | Goose | 1999 |
KM272560.1 | LH | China | Goose | 2012 |
KR136258.1 | Yan-2 | China | Goose | 2013 |
KR091960.1 | YZ | China | Goose | 2013 |
EU583391.1 | 06-0329 | Taiwan | Goose | 2008 |
KC184133.1 | E | China | Goose | 2021 |
MW386077.1 | Corum/19 | Turkey | Goose | 2019 |
MW386079.1 | Yozgat/19 | Turkey | Goose | 2019 |
MW386078.1 | Konya/19 | Turkey | Goose | 2019 |
MF441223.1 | SDHZ1604 | China | Duck | 2016 |
MF441221.1 | SDLY1512 | China | Duck | 2015 |
MF441226.1 | JS1603 | China | Duck | 2016 |
MF441222.1 | SDLY1602 | China | Duck | 2016 |
MH444514.1 | GD | China | Duck | 2016 |
MK000549.1 | HuN001 | China | Duck | 2018 |
MK737642.1 | HN1P | China | Duck | 2019 |
KY511124.1 | SD | China | Duck | 2015 |
KT343253.1 | sdlc01 | China | Duck | 2015 |
KM093740.1 | MDPV-GX5 | China | Muscovy duck | 2011 |
KU844282.1 | P1 | China | Muscovy duck | 2016 |
KT865605.1 | FZ91-30 vaccine | China | Muscovy duck | 1991 |
KU844281.1 | P | China | Muscovy duck | 1988 |
Province/City | No. of Collected Samples | Gene-Positive Samples/(%) | No. of Flocks | Gene-Positive Flocks/(%) |
---|---|---|---|---|
Hanoi | 48 | 11/(22.92) a,b | 11 | 4/(36.36) c |
Haiduong | 6 | 2/(33.33) a,b | 2 | 1/(50.00) c,d |
Thainguyen | 15 | 4/(26.67) a | 3 | 2/(66.67) d |
Bacgiang | 30 | 4/(13.33) b | 11 | 3/(27.27) c,e |
Thaibinh | 21 | 3/(14.29) b | 7 | 2/(28.57) c,e |
Hungyen | 10 | 2/(20.00) a,b | 4 | 2/(50) c,d |
Total | 130 | 26/(20.00) | 38 | 14/(36.84) |
Criteria | Ages/Duck Heads | Samples (n) | Gene-Positive Samples/(%) |
---|---|---|---|
Age (weeks) | <2 | 11 | 1/(9.09) a |
2–4 | 27 | 10/(37.04) b | |
>4 | 92 | 15/(16.30) a | |
Flock size | <500 | 29 | 9/(31.03) a |
500–1000 | 64 | 6/(9.38) b | |
>1000 | 37 | 11/(29.73) a |
Virus Strain/Consensus a | Sites in Rep Protein | |||
---|---|---|---|---|
154 | 551 | 555 | 560 | |
GPV | T | R | N | C |
MDPV | T | K | D | C |
Vietnamese NGPVs | T/S | K/R | P/T | G/C |
Virus Strain/Consensus a | Sites in Cap Protein | |||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
142 | 144 | 178 | 180 | 206 | 386 | 390 | 448 | 449 | 451 | 458 | 461 | 507 | 509 | |
GPV | D | V | S | A | A | N | A | D | G | R | A | G | D | Q/E |
MDPV | E | V | N | G | A | N | A | D/N | S/G | R | A | G | D | E |
Vietnamese NGPVs | E/D | I/V | T/S | A/V | T/A | N/D | A/P | D/G | S/R | R/G | A/T | G/R | E/D/A | Q/P |
Method | Recombination p-Value |
---|---|
RDP | 1.89 × 10−2 |
GENECONV | 4.77 × 10−4 |
BootScan | 2.84 × 10−2 |
MaxChi | 2.72 × 10−5 |
Chimaera | 8.11 × 10−6 |
SiScan | 5.41 × 10−12 |
PhylPro | - |
LARD | - |
3Seq | 4.48 × 10−3 |
Protein | Site | a | b | b–a | Prob [a > b] | Prob [a < b] | Bayes Factor [a < b] |
---|---|---|---|---|---|---|---|
Capsid | 137 | 26.755 | 2.394 | −24.361 | 0.912 | 0.063 | 0.083 |
147 | 26.312 | 2.169 | −24.142 | 0.916 | 0.06 | 0.078 | |
157 | 25.594 | 2.021 | −23.573 | 0.915 | 0.061 | 0.079 | |
159 | 26.745 | 2.188 | −24.557 | 0.917 | 0.06 | 0.079 | |
161 | 24.335 | 2.109 | −22.226 | 0.906 | 0.068 | 0.089 | |
168 | 25.174 | 2.226 | −22.948 | 0.908 | 0.065 | 0.086 | |
472 | 24.338 | 2.108 | −22.23 | 0.906 | 0.068 | 0.089 | |
507 | 4.423 | 33.746 | 29.323 | 0.034 | 0.926 | 15.48 | |
686 | 25.729 | 2.158 | −23.571 | 0.912 | 0.063 | 0.083 | |
Replication | 508 | 30.806 | 3.718 | −27.088 | 0.905 | 0.062 | 0.077 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dong, H.V.; Tran, G.T.H.; Nguyen, H.T.T.; Nguyen, T.M.; Trinh, D.Q.; Le, V.P.; Choowongkomon, K.; Rattanasrisomporn, J. Epidemiological Analysis and Genetic Characterization of Parvovirus in Ducks in Northern Vietnam Reveal Evidence of Recombination. Animals 2022, 12, 2846. https://doi.org/10.3390/ani12202846
Dong HV, Tran GTH, Nguyen HTT, Nguyen TM, Trinh DQ, Le VP, Choowongkomon K, Rattanasrisomporn J. Epidemiological Analysis and Genetic Characterization of Parvovirus in Ducks in Northern Vietnam Reveal Evidence of Recombination. Animals. 2022; 12(20):2846. https://doi.org/10.3390/ani12202846
Chicago/Turabian StyleDong, Hieu Van, Giang Thi Huong Tran, Huong Thi Thu Nguyen, Tuong Manh Nguyen, Dai Quang Trinh, Van Phan Le, Kiattawee Choowongkomon, and Jatuporn Rattanasrisomporn. 2022. "Epidemiological Analysis and Genetic Characterization of Parvovirus in Ducks in Northern Vietnam Reveal Evidence of Recombination" Animals 12, no. 20: 2846. https://doi.org/10.3390/ani12202846
APA StyleDong, H. V., Tran, G. T. H., Nguyen, H. T. T., Nguyen, T. M., Trinh, D. Q., Le, V. P., Choowongkomon, K., & Rattanasrisomporn, J. (2022). Epidemiological Analysis and Genetic Characterization of Parvovirus in Ducks in Northern Vietnam Reveal Evidence of Recombination. Animals, 12(20), 2846. https://doi.org/10.3390/ani12202846