Phenotypic and Molecular Patterns of Resistance among Campylobacter coli and Campylobacter jejuni Isolates, from Pig Farms
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Samples and Processing
2.2. DNA Isolation
2.3. Genotypic Characterization of Fluoroquinolone Resistance
2.4. Genotypic Characterization of Macrolide Resistance
2.5. Genotypic Characterization of Tetracycline Resistance
| Target Gene | Sequence (5′-3′) | Amplicon Size (bp) | Reference |
|---|---|---|---|
| tet(O) | F:AACTTAGGCATTCTGGCTCAC | 515 | [27] |
| R:TCCCACTGTTCCATATCGTCA | |||
| tet(A) | F: GTGAAACCCAACATACCCC | 888 | |
| R: GAAGGCAAGCAGGATGTAG | |||
| tet(B) | F: CCTTATCATGCCAGTCTTGC | 774 | |
| R: ACTGCCGTTTTTTCGCC | |||
| cmeB | F:GACGTAATGAAGGAGAGCCA | 1166 | [28] |
| R:CTGATCCACTCCAGCTATG | |||
| gyrA Thr-86-Ile mutations (C. jejuni) | F: TATGAGCGTTATTATCGGTC | 265 | [24] |
| R: TAAGGCATCGTAAACAGCCA | |||
| gyrA Thr-86-Ile mutations (C. coli) | F:TATGAGCGTTATTATCGGTC | 192 | [24] |
| R:TAAGGCATCGTAAACAGCCA | |||
| 23S rRNA at position 2074 | F:TTAGCTAATGTTGCCCGTACCG | 485 | [25] |
| R: AGTAAAGGTCCACGGGGTCTCG | |||
| 23S rRNA at position 2075 | F:TTAGCTAATGTTGCCCGTACCG | 486 | [25] |
| R:TAGTAAAGGTCCACGGGGTCGC | |||
| ermB | F:TGAAAAAGTACTCAACCAAAT | 692 | [26] |
| R:TCCTCCCGTTAAATAATAGAT |
2.6. Genotypic Characterization of Efflux Pumps
2.7. Statistical Analysis
3. Results
3.1. Antimicrobial Susceptibility Testing (AST)
3.2. Antibiotic Resistance Genes (Molecular Mechanisms of Resistance)
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- The European Union One Health 2018 Zoonoses Report. EFSA J. 2019, 17, e05926. [CrossRef] [Scilit]
- Altekruse, S.F.; Stern, N.J.; Fields, P.I.; Swerdlow, D.L. Campylobacter jejuni—An Emerging Foodborne Pathogen. Emerg. Infect. Dis. 1999, 5, 28–35. [Google Scholar] [CrossRef] [Scilit]
- Nachamkin, I.; Mishu Allos, B.; Ho, T. Campylobacter species and Guillain-Barré Syndrome. Clin. Microbiol. Rev. 1998, 11((3)), 555–567. [Google Scholar] [CrossRef] [Scilit]
- Mishu, B.; Blaser, M.J. Role of infection due to Campylobacter jejuni in the initiation of Guillain-Barre syndrome. Clin. Infect. Dis. 1993, 17, 104–108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pope, J.E.; Krizova, A.; Garg, A.X.; Thiessen-Philbrook, H.; Ouimet, J.M. Campylobacter Reactive Arthritis: A Systematic Review. Semin. Arthritis Rheum. 2007, 37, 48–55. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Spiller, R.C.; Jenkins, D.; Thornley, J.P.; Hebden, J.M.; Wright, T.; Skinner, M.; Neal, K.R. Increased rectal mucosal enteroendocrine cells, T lymphocytes, and increased gut permeability following acute Campylobacter enteritis and in post-dysenteric irritable bowel syndrome. Gut 2000, 47, 804–811. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- WHO. Estimates of the Global Burden of Foodborne Diseases: Foodborne Disease Burden Epidemiology Reference Group 2007–2015; WHO: Geneva, Switzerland, 2018. [Google Scholar]
- Silva, J.; Leite, D.; Fernandes, M.; Mena, C.; Gibbs, P.A.; Teixeira, P. Campylobacter spp. as a Foodborne Pathogen: A Review. Front. Microbiol. 2011, 2, 200. [Google Scholar] [CrossRef] [Scilit]
- Harvey, R.B.; Young, C.R.; Ziprin, R.L.; Hume, M.E.; Genovese, K.J.; Anderson, R.C.; Droleskey, R.E.; Stanker, L.H.; Nisbet, D.J. Prevalence of Campylobacter species isolated from the intestinal tract of pigs raised in an integrated swine production system. J. Am. Vet. Med. Assoc. 1999, 215, 1601–1604. [Google Scholar]
- Madden, R.; Moran, L.; Scates, P. Optimising recovery of Campylobacter spp. from the lower porcine gastrointestinal tract. J. Microbiol. Methods 2000, 42, 115–119. [Google Scholar] [CrossRef] [Scilit]
- Jensen, A.N.; Andersen, M.T.; Dalsgaard, A.; Baggesen, D.L.; Nielsen, E.M. Development of real-time PCR and hybridization methods for detection and identification of thermophilic Campylobacter spp. in pig faecal samples. J. Appl. Microbiol. 2005, 99, 292–300. [Google Scholar] [CrossRef] [Scilit]
- Boes, J.; Nersting, L.; Nielsen, E.M.; Kranker, S.; Enøe, C.; Wachmann, H.C.; Baggesen, D.L. Prevalence and Diversity of Campylobacter jejuni in Pig Herds on Farms with and without Cattle or Poultry. J. Food Prot. 2005, 68, 722–727. [Google Scholar] [CrossRef] [Scilit]
- Alter, T.; Gaull, F.; Kasimir, S.; Gürtler, M.; Mielke, H.; Linnebur, M.; Fehlhaber, K. Prevalences and transmission routes of Campylobacter spp. strains within multiple pig farms. Vet. Microbiol. 2005, 108, 251–261. [Google Scholar] [CrossRef] [Scilit]
- Varela, N.P.; Friendship, R.M.; Dewey, C.E. Prevalence of Campylobacter spp. isolated from grower-finisher pigs in Ontario. Can. Vet. J. 2007, 48, 515–517. [Google Scholar]
- Soultos, N.; Madden, R.H. A genotyping colonization of piglets by Campylobacter coli, in the first 10 weeks of life. J. Appl. Microbiol. 2007, 102, 916–920. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Young, K.T.; Davis, L.M.; DiRita, V.J. Campylobacter jejuni: Molecular biology and pathogenesis. Nat. Rev. Genet. 2007, 5, 665–679. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Doyle, L.P.A. Vibrio associated with pig dysentery. Amer. J. Vet. Res. 1944, 514, 3–5. [Google Scholar]
- Doyle, L.P.A. The etiology of pig dysentery. Amer. J. Vet. Res. 1948, 9, 50–53. [Google Scholar]
- Sala, V.; Piccinini, R.; Socci, A. Localization and characteristics of pig thermophilic Campylobacter in carriers of experimentally conditioned animals. Clin. Vet. 1986, 109, 236–242. [Google Scholar]
- Protocol for PCR Amplification of C. Jejuni and C. Coli; Recommended by the EURL-AR, 2nd Version; National Food Institute DTU: Kongens Lyngby, Denmark, 2013.
- European Committee on Antimicrobial Susceptibility Testing. Breakpoint Tables for Interpretation of MICs and Zone Diameters; Version 11.0; European Committee on Antimicrobial Susceptibility Testing: Vaxjo, Sweden, 2021. [Google Scholar]
- Magiorakos, A.-P.; Srinivasan, A.; Carey, R.; Carmeli, Y.; Falagas, M.; Giske, C.; Harbarth, S.; Hindler, J.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef] [Scilit]
- Zirnstein, G.; Li, Y.; Swaminathan, B.; Angulo, F. Ciprofloxacin resistance in Campylobacter jejuni isolates: Detection of gyrA resistance mutations by mismatch amplification mutation assay PCR and DNA sequence analysis. J. Clin. Microbiol. 1999, 37, 3276–3280. [Google Scholar] [CrossRef] [Scilit]
- Zirnstein, G.; Helsel, L.; Li, Y.; Swaminathan, B.; Besser, J. Characterization of gyrA mutations associated with fluoroquinolone resistance in Campylobacter coli by DNA sequence analysis and MAMA PCR. FEMS Microbiol. Lett. 2000, 190, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Alonso, R.; Mateo, E.; Churruca, E.; Martenez, I.; Girbau, C.; Fernandez-Astorga, A. MAMA-PCR assay for the detection of point mutations associated with high-level erythromycin resistance in Campylobacter jejuni and Campylobacter coli strains. J. Microbiol. Methods 2005, 63, 99–103. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qin, S.; Wang, Y.; Zhang, Q.; Zhang, M.; Deng, F.; Shen, Z.; Wu, C.; Wang, S.; Zhang, J.; Shen, J. Report of ribosomal RNA methylase gene erm(B) in multidrug-resistant Campylobacter coli. J. Antimicrob. Chemother. 2013, 69, 964–968. [Google Scholar] [CrossRef] [Scilit]
- Abdi-Hachesoo, B.; Khoshbakht, R.; Sharifiyazdi, H.; Tabatabaei, M.; Hosseinzadeh, S.; Asasi, K. Tetracycline Resistance Genes in Campylobacter jejuni and C. coli Isolated From Poultry Carcasses. Jundishapur J. Microbiol. 2014, 7, e12129. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pumbwe, L.; Piddock, L.J. Identification and molecular characterisation of CmeB, a Campylobacter jejuni multidrug efflux pump. FEMS Microbiol. Lett. 2002, 206, 185–189. [Google Scholar] [CrossRef]
- Collective Eurosurveillance Editorial Team. The European Union summary report on antimicrobial resistance in zoonotic and indicator bacteria from humans, animals and food in 2017. EFSA J. 2019, 17, e05598. [Google Scholar] [CrossRef] [Scilit]
- Tang, M.; Zhou, Q.; Zhang, X.; Zhou, S.; Zhang, J.; Tang, X.; Lu, J.; Gao, Y. Antibiotic Resistance Profiles and Molecular Mechanisms of Campylobacter From Chicken and Pig in China. Front. Microbiol. 2020, 11, 592496. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Organisation for Economic Co-operation and Development. Antibiotic Use and Antibiotic Resistance in Food Producing Animals in China; Organisation for Economic Co-operation and Development: Paris, France, 2018. [Google Scholar]
- Padungtod, P.; Kaneene, J.B.; Hanson, R.; Morita, Y.; Boonmar, S. Antimicrobial resistance in Campylobacter isolated from food animals and humans in northern Thailand. FEMS Immunol. Med. Microbiol. 2006, 47, 217–225. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- European Centre for Disease Prevention and Control (ECDC); European Food Safety Authority (EFSA); European Medicines Agency (EMA). Joint Scientific Opinion on a list of outcome indicators as regards surveillance of antimicrobial resistance and antimicrobial consumption in humans and food-producing animals. EFSA J. 2017, 15(10), 5017. [Google Scholar]
- Said, M.M.; El-Mohamady, H.; El-Beih, F.M.; Rockabrand, D.M.; Ismail, T.F.; Monteville, M.R.; Ahmed, S.F.; Klena, J.D.; Salama, M.S. Detection of gyrA Mutation Among Clinical Isolates of Campylobacter jejuni Isolated in Egypt by MAMA-PCR. J. Infect. Dev. Ctries. 2010, 4, 546–554. [Google Scholar] [CrossRef] [Scilit]
- Woźniak-Biel, A.; Bugla-Płoskońska, G.; Kielsznia, A.; Korzekwa, K.; Tobiasz, A.; Korzeniowska-Kowal, A.; Wieliczko, A. High Prevalence of Resistance to Fluoroquinolones and TetracyclineCampylobacterSpp. Isolated from Poultry in Poland. Microb. Drug Resist. 2018, 24, 314–322. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- El-Adawy, H.; Hotzel, H.; Düpre, S.; Tomaso, H.; Neubauer, H.; Hafez, H.M. Determination of antimicrobial sensitivities of Campylobacter jejuni isolated from commercial turkey farms in Germany. Avian Dis. 2012, 56, 685–692. [Google Scholar] [CrossRef] [Scilit]
- Maćkiw, E.; Korsak, D.; Rzewuska, K.; Tomczuk, K.; Rożynek, E. Antibiotic resistance in Campylobacter jejuni and Campylobacter coli isolated from food in Poland. Food Control 2012, 23, 297–301. [Google Scholar] [CrossRef] [Scilit]
- Pratt, A.; Korolik, V. Tetracycline resistance of Australian Campylobacter jejuni and Campylobacter coli isolates. J. Antimicrob. Chemother. 2005, 55, 452–460. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Du, Y.; Wang, C.; Ye, Y.; Liu, Y.; Wang, A.; Li, Y.; Zhou, X.; Pan, H.; Zhang, J.; Xu, X. Molecular Identification of Multidrug-Resistant Campylobacter Species From Diarrheal Patients and Poultry Meat in Shanghai, China. Front. Microbiol. 2018, 9, 1642. [Google Scholar] [CrossRef] [Scilit]
- Lin, J.; Michel, L.O.; Zhang, Q. CmeABC Functions as a Multidrug Efflux System in Campylobacter jejuni. Antimicrob. Agents Chemother. 2002, 46, 2124–2131. [Google Scholar] [CrossRef] [Scilit]
- Papadopoulos, D.; Petridou, E.; Filioussis, G.; Papadopoulos, T.; Papageorgiou, K.; Chatzistilianou, M.; Kritas, S. Prevalence and antibiotic resistance of Campylobacter coli and Campylobacter jejuni in Greek swine farms. Am. J. Microbiol. Immunol. 2020, 5. [Google Scholar] [CrossRef] [Scilit]
| Resistance Phenotypes | C. Coli (n) | C. Jejuni (n) | Campylobacter Spp., (n) | % |
|---|---|---|---|---|
| CipEryTet | 10 | 7 | 17 | 8.5 |
| CipGenTet | 4 | 3 | 1 | 3.5 |
| EryGenTet | 1 | 0 | 1 | 0.5 |
| CipEry | 1 | 2 | 3 | 1.5 |
| CipTet | 5 | 9 | 14 | 7 |
| EryTet | 1 | 2 | 3 | 1.5 |
| Cip | 2 | 3 | 5 | 2.5 |
| Tet | 67 | 60 | 127 | 63.5 |
| Susceptible to all antibiotics | 9 | 14 | 23 | 11.5 |
| Total | 100 | 100 | 200 | 100 |
| Antibiotic | n, % | C. Coli * | C. Jejuni * | Campylobacter Spp. |
|---|---|---|---|---|
| Ciprofloxacin | n | 22 | 24 | 46 |
| % | 22 b | 24 b | 23 | |
| Erythromycin | n | 13 | 11 | 24 |
| % | 13 | 11 | 12 | |
| Tetracycline | n | 88 | 81 | 169 |
| % | 88 a | 81 a | 84.5 | |
| Gentamicin | n | 5 | 3 | 8 |
| % | 5 | 3 | 4 | |
| Meropenem | n | 0 | 0 | 0 |
| % | 0 | 0 | 0 |
| Antibiotics | n, % | Fluoroquinolones | Macrolides | Tetracyclines | Efflux Pumps | |||
|---|---|---|---|---|---|---|---|---|
| Genes/mutations | Thr-86-Ile | A2075G & A2074C | ermB | tet(O) | tet(A) | tet(O)& tet(A) | cmeB | |
| C. coli | n | 22 | 13 | 0 | 83 | 3 | 2 | 21 |
| % | 100 | 100 | 0 | 94.3 | 3.4 | 2.3 | 23.1 * | |
| C. jejuni | n | 24 | 11 | 0 | 73 | 8 | 0 | 4 |
| % | 100 | 100 | 0 | 90.1 | 9.9 | 0 | 4.7 * | |
| Campylobacter spp. | n | 46 | 24 | 0 | 156 | 11 | 2 | 25 |
| % | 100 | 100 | 0 | 92.3 | 6.5 | 1.2 | 14.1% | |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Papadopoulos, D.; Petridou, E.; Papageorgiou, K.; Giantsis, I.A.; Delis, G.; Economou, V.; Frydas, I.; Papadopoulos, G.; Hatzistylianou, M.; Kritas, S.K. Phenotypic and Molecular Patterns of Resistance among Campylobacter coli and Campylobacter jejuni Isolates, from Pig Farms. Animals 2021, 11, 2394. https://doi.org/10.3390/ani11082394
Papadopoulos D, Petridou E, Papageorgiou K, Giantsis IA, Delis G, Economou V, Frydas I, Papadopoulos G, Hatzistylianou M, Kritas SK. Phenotypic and Molecular Patterns of Resistance among Campylobacter coli and Campylobacter jejuni Isolates, from Pig Farms. Animals. 2021; 11(8):2394. https://doi.org/10.3390/ani11082394
Chicago/Turabian StylePapadopoulos, Dimitrios, Evanthia Petridou, Konstantinos Papageorgiou, Ioannis A. Giantsis, Georgios Delis, Vangelis Economou, Ilias Frydas, Georgios Papadopoulos, Maria Hatzistylianou, and Spyridon K. Kritas. 2021. "Phenotypic and Molecular Patterns of Resistance among Campylobacter coli and Campylobacter jejuni Isolates, from Pig Farms" Animals 11, no. 8: 2394. https://doi.org/10.3390/ani11082394
APA StylePapadopoulos, D., Petridou, E., Papageorgiou, K., Giantsis, I. A., Delis, G., Economou, V., Frydas, I., Papadopoulos, G., Hatzistylianou, M., & Kritas, S. K. (2021). Phenotypic and Molecular Patterns of Resistance among Campylobacter coli and Campylobacter jejuni Isolates, from Pig Farms. Animals, 11(8), 2394. https://doi.org/10.3390/ani11082394

