Next Article in Journal
Dwarf and Tall Elephantgrass Genotypes under Irrigation as Forage Sources for Ruminants: Herbage Accumulation and Nutritive Value
Previous Article in Journal
Effects of Condensed Tannins Supplementation on Animal Performance, Phylogenetic Microbial Changes, and In Vitro Methane Emissions in Steers Grazing Winter Wheat
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

MiRNA-34c Regulates Bovine Sertoli Cell Proliferation, Gene Expression, and Apoptosis by Targeting the AXL Gene

1
College of Animal Science, Jilin University, Changchun 130062, China
2
College of Coastal Agricultural Sciences, Guangdong Ocean University, Zhanjiang 524088, China
*
Authors to whom correspondence should be addressed.
Hao Sun and Haibin Yu contributed equally to this work.
Animals 2021, 11(8), 2393; https://doi.org/10.3390/ani11082393
Submission received: 15 June 2021 / Revised: 31 July 2021 / Accepted: 6 August 2021 / Published: 13 August 2021
(This article belongs to the Section Animal Genetics and Genomics)

Abstract

:

Simple Summary

Fertility is one of the essential reproduction traits of bulls, and accurate prediction of fertility potential using a semen sample from a donor bull for artificial insemination is crucial to achieve consistently high reproductive efficiency. Somatic cells, such as Sertoli cells and Leydig cells, are important in testis formation and provide a nurturing and regulatory environment for spermatogenesis. Furthermore, it was suggested that non-coding RNAs, such as microRNAs, long non-coding RNAs, circular RNAs, and Piwi-interacting RNA, function as important regulators of gene expression at post-transcriptional level in spermatogenesis. In this study, microRNA-34c was verified to specifically regulate the AXL gene by targeting a sequence in the 3’ UTR; miRNA-34c can also influence the proliferation, apoptosis, and relative abundance of the transcript of male-reproduction-related genes. Therefore, microRNA-34c can be considered an essential regulator in the process of bull spermatogenesis. These results identify a key microRNA and functional genes in the process of cattle male reproduction, providing useful information for future marker-assisted selection of bulls with excellent sperm quality.

Abstract

MicroRNAs (miRNAs) play significant roles in mammalian spermatogenesis. Sertoli cells can provide a stable microenvironment and nutritional factors for germ cells, thus playing a vital role in spermatogenesis. However, few studies elucidate the regulation of bovine testicular Sertoli cells by miRNAs. Here, we have reported that miRNA-34c (miR-34c) regulates proliferation, apoptosis, and relative transcripts abundance gene in bovine Sertoli cells. In bovine Sertoli cells, overexpression of miR-34c inhibited proliferation and relative abundance of gene transcripts while promoting apoptosis of Sertoli cells, and the effects were the opposite when miR-34c was knocked down. Receptor tyrosine kinase (AXL) was identified as a direct target gene of miR-34c in Sertoli cells, validated by analysis of the relative abundance of AXL transcript and dual-luciferase reporter assay. The relative abundance of the transcript of genes related to male reproduction in Sertoli cells was changed after the AXL gene was overexpressed, as demonstrated by the RT2 Profiler PCR Array results. In summary, miR-34c specifically regulated the AXL gene by targeting a sequence in the 3′-UTR, which could influence proliferation, apoptosis, and relative abundance of the transcript of male reproduction-related genes. Therefore, miR-34c could be considered an essential regulator in the process of bull spermatogenesis.

1. Introduction

MicroRNAs (miRNAs) belong to the small non-coding molecules that regulate the various biological process [1], including fat metabolism, biosynthesis, proliferation, apoptosis, and cell differentiation through targeting their genes [2,3,4,5]. miRNAs are present in spermatogonia, Sertoli cell and Leydig cells within the testis and are present in mature spermatozoa, which indicated miRNAs have important roles in the proper functioning of the male reproductive system [6,7,8].
MiR-34 consists of three members, including miR-34a, miR-34b, and miR-34c, highly evolutionarily conserved and belong to the same miRNA family [9,10]. According to our previous transcriptome sequencing data, miR-34c is one of the differentially expressed miRNAs between immature and mature bovine testes. The relative expression abundance in adult bovine testes is higher than immature testes in newborns. A previous study reported that miR-34c plays essential roles in many biological processes and can regulate proliferation and differentiation in many kinds of cells [11,12,13]. MiR-34c was reported to promote apoptosis by increasing the abundance of transcripts of various apoptosis-related genes in germline stem cells. This may impact the reproductive function of the goat [14]. Research results show that miR-34c can promote the differentiation of murine embryonic stem cells (mESCs) into male germ cells in mice [15]. Overall, many studies have demonstrated that miR-34c is involved in biological processes. However, there are relatively few studies on the effects of Sertoli cells in cattle, so in our research work, we explored the role of miR-34c in bovine Sertoli cells.
The testis is an organ where sperm cells are produced and contain various cells, including Sertoli cells, interstitial cells, and germ cells. Sertoli cells are irregular conical cells with prominent nucleoli and two satellite nucleosomes outside the nucleus [16]. Sertoli cells have various biological functions, such as basal tight junctions between adjacent Sertoli cells to form the blood-testis barrier, providing a stable microenvironment for germ cells, preventing toxins from entering the epithelium, and delivering energy to the sperm [17]. Sertoli cells can also secrete androgen-binding proteins (ABPs), and ABPs binds to androgens that are synthesized and secreted by interstitial cells, which, in turn, exert their biological functions [18]. Another vital role of Sertoli cells in the synthesis and secretion of cytokines, such as glial cell line-derived neurotrophic factor (GDNF) [19,20], bone morphogenetic protein 4 (BMP4) [21,22]. Inhibition of immature Sertoli cell proliferation may cause Sertoli cell-only syndrome (SCOS), germ cell dysplasia, and even azoospermia. Overall, immature Sertoli cells are closely related to germ cell development and spermatogenesis. Some studies have reported that the receptor tyrosine kinase (AXL) gene affects testicular immune function. It has been reported that AXL promotes zika virus (ZIKV) entry and negatively regulates the antiviral state of human Sertoli cells to augment ZIKV infection of the testes [23]. The previous study has shown that AXL in mouse Sertoli cells plays an important role in maintaining the stability of testicular immune function and the production of germ cells, which can affect mouse reproductive function [24]. However, there are relatively few studies on cattle reproduction. Therefore, this study investigated the effects of miR-34c on Sertoli cells, including cell proliferation, apoptosis, and secretory functions, and validated the target relationships with the AXL gene and the regulatory effect of the AXL gene on the relative transcript abundance of reproduction-related genes. This study provides the theoretical basis to improve cattle reproduction performance.

2. Materials and Methods

2.1. Ethics Statement

According to the guidelines established by the Jilin University Animal Care and Use Committee the experiments were performed (Permit number: SY201901007).

2.2. Cell Culture

The cells were isolated by the Animal Genetic Breeding and Reproduction Laboratory in the College of Animal Science of Jilin University. The cell identification results showed that immature bovine testicular Sertoli cells were successfully isolated. Briefly, we identified the isolated Sertoli cells by Feulgen staining, immunofluorescence, and detection of marker genes expression levels. The morphological structure of Sertoli cells was identified by Feulgen staining; Inhibin protein was detected by immunofluorescence staining. The superimposed image showed that inhibin protein was expressed in almost all Sertoli cells, which further showed that the isolated and purified Sertoli cells were close to 100%. Thus, the above experimental results can fully prove that the cells we isolated are Sertoli cells, and their purity can be close to 100%. The results of this study are published in our previous study [25]. After the vial of cells was removed from the liquid nitrogen storage, they were quickly placed in a 37 °C water bath for 3–5 min. When the cryotube liquid was thawed entirely, the cryotubes were centrifuged at 800 g/min for 8 min. Sertoli cells were incubated in DMEM/F12 medium (HyClone, Logan, OH, USA) containing 10% fetal bovine serum (FBS; HyClone, Logan, OH, USA) and 1% penicillin-streptomycin (HyClone, Logan, OH, USA) and maintained at 37 °C in a humidified 5% CO2 incubator (Thermo, Marietta, OH, USA). Then, Sertoli cells were cultured in a six-well plate. When the cell density reached approximately 75%, the vectors containing miR-34c mimics, miR-34c inhibitor, and negative control were transfected into the cells.

2.3. Vector Construction and Target Genes Prediction

We obtained the coding sequence (CDS) of the AXL gene by nested polymerase chain reaction (nested PCR) (the primers for nested PCR are shown in Table 1) and then ligated the CDS region to the pBI-CMV3 vector (Clonetech, #631632, Mountain View, CA USA). The AXL gene overexpression vector was successfully constructed using the pBI-CMV3 expression vector. MiR-34c mimics, miR-34c inhibitors, and NC plasmids have been constructed by Gene Pharma (Suzhou, China). The miR-34c mimics capable of expressing the natural pre-miRNA sequence and the miR-34c inhibitor including the miRNA sponge sequence were used to up-regulate and down-regulate the expression level of miR-34c in cells, respectively. The specific sequence information was shown in Table S1. The DNA-binding sites and target genes of miR-34c were predicted by miRBase (Available online: http://www.mirbase.org (accessed on 19 May 2018)) [26] and TargetScan (Available online: http://www.targetscan.org (accessed on 19 May 2018)) [27].Potential binding site fragments of the 3′UTR of the AXL gene, whether the wild-type (WT) or a mutant (Mut) version, were inserted into the pmirGLO dual-luciferase reporter vector to construct the pmirGLO-AXL-WT and pmirGLO-AXL-mut vectors, which were verified to be correctly built. The insert sequences of the wild-type (WT) or a mutant (Mut) version were in Table S2.

2.4. Cell Transfection

MiR-34c mimics, miR-34c inhibitor, Negative Control (NC), pBI-CMV3-AXL, or pBI-CMV3 were transfected into Sertoli cells using FuGENE HD Transfection Reagent (Prmega, Madison, WI, USA), with three replicates in each group. Each sample included 150 μL Opti-MEM (Gibico, Waltham, MA, USA), 7.5 μL FuGENE HD Transfection Reagent, and 3 μg vector, and incubates in a 1.5 mL centrifuge tube for 15 min at 25 °C. The pmirGLO-AXL-3′UTR-WT, pmirGLO-AXL-mut, and pmirGLO plasmids were co-transfected into Sertoli cells along with the miR-34c mimics, and each sample included 150 μL Opti-MEM, 7.5 μL FuGENE HD Transfection Reagent, and 3 μg vector, and incubate in a 1.5 mL centrifuge tube for 15 min at 25 °C.

2.5. RNA Extraction and Real-Time Quantitative PCR (qRT-PCR)

The miR-34c mimics, inhibitor or NC, and the AXL overexpression vector were co-transfected into bovine Sertoli cells, and fluorescence was observed 24 h. RNAiso Plus (Takara, Dalian, China) was used to extract total RNA from the cells after 48 h, the spectrophotometer ND-2000 was used to measure the concentration and quality of total RNA, and 1 μg total RNA was reverse transcribed to cDNA by a PrimeScript™ RT Reagent Kit (Takara, Dalian, China), the first step (remove the genomic DNA): Add 2 μL 5 × gDNA Eraser Buffer, 1 μL gDNA Eraser and 1μg total RNA to 10 μL, 42 °C for 2 min; the second step: add 1 μL Prime Script RT Enzyme mix I and 1 μL RT Primer Mix/ specific miRNA primers, add 4 μL 5 × Prime Script Buffer 2 and 4 μL enzyme-free water, incubate at 37 °C for 15 min, 85 °C for 5 s. The qRT-PCR system was as follows: 5 μL FastStart Universal SYBR Green Master (Roche Diagnostics, Mannheim, Germany), 1 μL cDNA, 0.2 μL primer-F (10 μm/μL), 0.2 μL primer-R (10 μm/μL), and 3.6 μL RNase-free water. qRT-PCR was performed using PCRmax Eco 48 (PCRmax, Staffordshire, UK). Reactions were incubated at 95 °C for 10 min, followed by 40 cycles of 95 °C for 10 s and 60 °C for 30 s. Each sample was tested in triplicate. Quantitative primers for miR-34c, AXL, U6, β-actin, proliferating cell nuclear antigen (PCNA), GDNF, BMP4, C-X-C motif chemokine ligand 12 (CXCL12), BCL-2-Associated X (BAX), and PARP1 binding protein (PARPBP) were designed by Primer 6.0, and all the primers were synthesized by Sangon Biotech (Changchun, China). The details of primers for qRT-PCR are shown in Table 2. The Ct value of U6 small nuclear RNA was used as the internal control to assess the relative abundance of miR-34c. Additionally, β-actin gene was used as the internal control to assess the gene mRNA expression levels, respectively. MiR-34c and the relative abundance of the gene transcripts were calculated using the 2 − ΔΔCT method, and ΔΔCT = (Ct (positive) − Ct (reference)) − (Ct (control) − Ct (reference)) [28].

2.6. EdU Assay

For the EdU assay, Sertoli cells were cultured in 24-well plates, transfected with miR-34c mimics, inhibitor, or NC when the cell density reached approximately 70%. Fluorescence was observed after 24 h, and EdU was detected at 48 h. According to the manufacturer’s instructions of BeyoClick EdU-555 Cell Proliferation Assay Kit (Beyotime Biotechnology, Shanghai, China), a 20 μM EdU working solution was prepared. An equal volume was added to a 24-well plate, whereby the concentration of EdU in the 24-well plate was 10 μM incubation was continued for 2.5 h. The culture solution was removed, and the cells were fixed with 0.5 mL of 4% paraformaldehyde and then permeabilized with a permeabilizing solution. After using the Click reaction solution, the cells were incubated in the dark for 30 min. Nuclear staining was performed using Hoechst 33342 to facilitate observation of the proportion of cell proliferation detected. Observed under a microscope (Olympus, Tokyo, Japan) with a magnification of 100 times, it can be found that the cell nucleus is stained blue, while the proliferating cells are red.

2.7. Flow Cytometry

According to the manufacturer’s instructions, cell apoptosis rate was analyzed using flow cytometry (BD Biosciences, Heidelberg, Germany) with PE/7-AAD Apoptosis Detection Reagent Box (BD biosciences, San Diego, CA, USA). Sertoli cells were seeded in a six-well plate, cultured, and transfected with miR-34c mimics, inhibitor, or NC. Sertoli cells were harvested and washed with cold PBS twice. At room temperature, 100 μL of cell suspension was stained with 5 μL of PE/Annexin V and 7-aminoactinomycin (7-AAD) for about 25 min in the dark. The GCs were washed three times with cold 1 × phosphate-buffered saline. The laser wavelength of PE and 7AAD was set at 488 nm and 546 nm, respectively. The parameters of sheath rate were set at 80 μL/min. Each sample detected 105 cells, and each sample was repeated three times. The cells were scored as follows: viable cells were PE/Annexin V- and 7-AAD-negative; cells that were in early apoptosis were PE/Annexin V-positive and 7-AAD-negative; cells that were in late apoptosis or already dead were both PE/Annexin V- and 7-AAD-positive. Data were analyzed using the BD FACSDiva™ Software v. 6.1.3 (BD Biosciences, Heidelberg, Germany).

2.8. TUNEL Assay

Sertoli cells were cultured in 24-well plates, transfected with miR-34c mimics, inhibitor, or NC when the cell density reached approximately 70%. Fluorescence was observed 24 h when the cells are 48 h after transfection on the culture plate. According to the manufacturer’s instructions, apoptotic Sertoli cells were detected using the One-step TUNEL apoptosis detection kit (Beyotime Biotechnology, Beijing, China). Nuclear staining was performed using Hoechst 33342 to facilitate the measurement of the proportion of apoptosis cells. We used a fluorescence microscope with a magnification of 100 times to observe about 12,000 cells in the field of view. The experiment consisted of 3 repeated experiments.

2.9. RT2 Profiler PCR Array Detection of the Relative Transcript Abundance of Reproduction-Related Genes

After 48 h of transfection with pBI-CMV3 (negative control) or pBI-CMV3-AXL, total RNA was extracted, and 3 μg of total RNA was reverse transcribed with RT2 First Strand Kit (Qiagen, Frederick, MD, USA). The reaction contained 3 μg total RNA, 2.0 μL 5 × gDNA Elimination Buffer, and DNase/RNase-Free Water up to 10 μL. After 42 °C for 5 min, a mix of 4 μL of 5 × RT Buffer3, 1 μL Primers and External Control Mix, 2 μL RT Enzyme Mix3, and 3 μL DNase/RNase-Free Water was added. The solution was incubated at 42 °C for 15 min, 95 °C for 5 min, and 91 μL DNase/RNase-Free Water was added. According to the manufacturer’s instructions, RT2 SYBR Green ROX qPCR Master Mix (Qiagen, Qiagen, Frederick, MD, USA) was used. Then, the RT2 Profiler PCR Array (CAPB13964, Qiagen, Frederick, MD, USA) was used to detect 80 genes related to reproduction. The RT2 Profiler PCR Array was carried out with the Mx3005p (Stratagene, La Jolla, CA, USA), and the reactions were incubated at 95 °C for 10 min followed by 40 cycles of 95 °C for 10 s and 60 °C for 1 min. Data of gene expressions were analyzed by RT2 Profiler PCR Array data analysis online software (Available online: https://geneglobe.qiagen.com/cn/analyze (accessed on 1 May 2021)).

2.10. Statistical Analysis

All experiments were carried out in triplicate, and statistical analysis was performed with GraphPad Prism 6 software and carried out by one-way analysis of variance (ANOVA) with Dunnett’s multiple comparisons tests and Student’s t-test. The results are expressed as the mean ± Standard Error of Mean (SEM), and the values were considered significant at * p < 0.05; ** p < 0.01; *** p < 0.001; and **** p < 0.0001.

3. Results

3.1. MiR-34c Inhibits Proliferation and Secretion in Sertoli Cells

Experimental results showed that when miR-34c mimics were transfected, the relative abundance of the transcript of miR-34c was significantly increased (p < 0.0001). In contrast, the relative abundance of miR-34c was decreased when miR-34c inhibitors were transfected (Figure 1A). The qRT-PCR results for PCNA showed that miR-34c overexpression significantly decreased the relative abundance of PCNA mRNA (p < 0.01). In contrast, the relative transcript abundance of PCNA was significantly increased when miR-34c was inhibited (p < 0.01) (Figure 1B). The overexpression of miR-34c significantly decreased the relative transcript abundance of the Sertoli cell-secreted factors, including GDNF, BMP4, and CXCL12 (p < 0.01) (Figure 1C). The inhibition of miR-34c significantly increased their relative transcript abundance of GDNF and CXCL12 (p < 0.0001), and the relative abundance of BMP4 mRNA not significantly changed (Figure 1C).
DNA replication is inevitable in cell proliferation so that DNA synthesis can be used as a marker for Sertoli cell proliferation. EdU (5-Ethynyl-2′-deoxyuridine) is a thymidine analog, which can label newly formed DNA so that proliferating cells can be observed through a fluorescence microscope. The EdU staining results indicated that the number of positive cells was reduced in the miR-34c mimics group, indicating that the Sertoli cell proliferation rate was significantly decreased compared to the negative control group (p < 0.0001). The number of positive cells in the miR-34c inhibitor group was gained, indicating that the Sertoli cell proliferation rate was increased significantly compared to the negative control group (p < 0.001) (Figure 2). The above results indicate that miR-34c inhibits cell proliferation and the relative abundance of secreted transcription factors in bovine testicular Sertoli cells.

3.2. MiR-34c Increases the Apoptosis of Sertoli Cells

The results after staining with PE/7-AAD showed that after miR-34c was upregulated, the apoptotic rate of bovine testicular Sertoli cells increased from 25.1% to 31.4%. In contrast, when miR-34c was inhibited, the apoptosis rate decreased from 25.1% to 11.9% (Figure 3A–D). As a cell undergoes apoptosis, specific phenomena can be observed, such as fragmented genomic DNA, which can be detected using the TUNEL assay. When miR-34c was upregulated, the apoptotic rate of bovine Sertoli cells increased, while when miR-34c was inhibited, the apoptotic rate was reduced (Figure 3E–H). Besides, overexpression of miR-34c could upregulate the relative transcript abundance of the apoptosis-related genes BAX and PARPBP. Simultaneously, the results were reversed when miR-34c was downregulated (Figure 3I,J), indicating that miR-34c could promote the relative transcript abundance of apoptotic genes in Sertoli cells.

3.3. Characterization of the Target Relationship of MiR-34c and AXL

The AXL gene is a direct target of miR-34c. Binding sequences for miR-34c were found in the 3′UTR of the AXL gene (Figure 4A). The qRT-PCR results showed that when miR-34c was overexpressed, the relative abundance of AXL mRNA was significantly decreased (p < 0.001), and the relative abundance of AXL mRNA was significantly increased (p < 0.01) when miR-34c was inhibited (Figure 4B). The result indicated that the relative transcript abundance of miR-34c and AXL were negatively correlated. The dual-luciferase reporter assay results showed that the miR-34c mimics and pmirGLO-AXL3′UTR-WT co-transfection group had significantly reduced luciferase activity (p < 0.001) compared to the miR-34c mimics and pmirGLO-AXL3′UTR-mut co-transfection group (Figure 4C). These results indicated that AXL is a direct target gene of miR-34c.

3.4. The Effect of the AXL Gene on the Relative Transcript Abundance of Marker Genes Related to Male Reproduction

We constructed an AXL overexpression vector, and the relative abundance of the transcript of AXL increased significantly (p < 0.0001) post-transfection with pBI-CMV3-AXL (Figure 5A). The detecting genes of the RT2 Profiler PCR Array are essential to male animals’ reproductive function. The relative transcript abundance of 80 genes related to male reproduction was detected by the RT2 Profiler PCR Array. Among the 80 genes we tested, a total of 6 genes showed up-regulation, and four genes showed down-regulation (Fold change > 2 or <−2) (Table 3). The relative transcript abundance of tripartite motif containing 36 (TRIM36), histone deacetylase 1 (HDAC1), DEAD-box helicase 25 (DDX25), SRSF protein kinase 1 (SRPK1), transition protein 1 (TNP1), and cAMP responsive element binding protein 1 (CREB1) was upregulated, while relative transcript abundance of cysteine dioxygenase type 1 (CDO1), superoxide dismutase 2 (SOD2), PDZ domain containing 8 (PDZD8), and DnaJ member C28 (DNAJC28) was downregulated (Figure 5B). The analysis data of all 80 genes are shown in Table S3. The results showed that the AXL gene could affect the relative transcript abundance of reproductive marker genes.

4. Discussion

Although many studies show that miR-34c plays a vital role in many life activities, few studies on whether miR-34c also has an essential function in bovine testes. In our present study, when miR-34c was overexpressed, Sertoli cell proliferation was inhibited, and Sertoli cell apoptosis was increased. Meanwhile, the proliferation was promoted, and apoptosis was decreased when miR-34c was inhibited. The number of normal sperm has a significant positive correlation with the number of mature Sertoli cells; each mature Sertoli cell, which is generated by immature Sertoli cell proliferation, can only support a limited number of germ cells for spermatogenesis, so the number of immature Sertoli cells also determines the reproductive capacity and spermatogenic efficiency of an individual animal [29,30,31]. Because a vital function of Sertoli cells provides a stable microenvironment, nutrition, and physical support for germ cells [32,33], and miR-34c can increase the apoptosis of bovine Sertoli cells and inhibit their proliferation, we speculate miR-34c may indirectly affect spermatogenesis by affecting the proliferation and apoptosis of Sertoli cells, but the specific results need further research.
A critical function of supporting cells is to synthesize and secrete cytokines. In our results, when miR-34c was overexpressed, the relative transcript abundance of secreted factors GDNF, BMP4, and CXCL12 was decreased; when miR-34c was knocked down, the relative transcript abundances of secreted factors GDNF and CXCL12 was increased. It has been reported that the factor GDNF is critical for spermatogonial stem cell’s self-renewal and maintenance [19]. Studies have shown that BMP4 can regulate diverse cellular responses, such as cell differentiation, migration, adhesion, and proliferation [34]. Besides, it has been reported that CXCL12 can promote the growth of mouse spermatogonial stem cells [35]. Therefore, miR-34c may have an impact on spermatogonial stem cells of male animals by reducing the expression of these secreted factors directly or indirectly.
AXL is a member of the receptor tyrosine kinase subfamily, which includes three genes, TYRO3 protein tyrosine kinase (TYRO3), AXL, and MER proto-oncogene, and tyrosine kinase (MERTK) (TAM). Some studies indicated that TYRO3, AXL, and MERTK receptor tyrosine kinase triple knockout (TAM-/-) mice have male sterility due to impaired sperm development [15]. This result indicates that the AXL gene has a specific effect on the production of sperm. Studies have also shown that AXL plays a vital role in various cellular functions, including hematopoiesis, innate immune responses, platelet aggregation, phagocytosis of apoptotic cells, viral infection, vascular integrity, and permeability regulation, and cell survival [36]. In our results, after the AXL gene was overexpressed, the relative transcript abundances of TRIM36, HDAC1, DDX25, SRPK1, TNP1, and CREB1 were increased. It has been reported that TRIM36 deficiency causes morphological abnormalities in spermatozoa [37], and the DDX25 gene plays a role in sperm maturation [38]. TNP1 plays a crucial role in sperm nuclear condensation, and some studies have shown that TNP1 is also essential for sperm formation [39,40]. CREB1 is expressed during mitosis and spermatogenesis and is a necessary regulator of testicular development and spermatogenesis [41,42]. According to the results of previous studies, it is shown that male reproductive traits could benefit from TRIM36 [37], HDAC1 [43], DDX25 [38], TNP1 [39,40], CREB1 [41,42], CDO1 [44], SOD2 [45] in mice or human, while AXL downregulated the relative transcript abundances of CDO1 and SOD2. This result may be due to the genes highly expressed in spermatogonial stem cells or other cell types to improve male reproduction and differences in gene expression and regulatory mechanisms between different cell types. Therefore, we can speculate that the AXL gene can directly or indirectly affect spermatogenesis in male animals, but the specific results need further research.

5. Conclusions

This result demonstrates the effect of miR-34c targeting the AXL gene on proliferation, apoptosis, and relative gene abundance of transcripts of reproduction-associated secreted factors in primary bovine testicular Sertoli cells (Figure 6). Our study shows that miR-34c and AXL genes have a potential function on reproductive traits of bulls, and the result helps design excellent marker-assisted selection programs in bull breeding.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/ani11082393/s1, Table S1: The insert sequences of miR-34c mimics, miR-34c inhibitor and NC, Table S2: The insert sequences of the wild-type (WT) and a mutant (Mut), Table S3: The expression fold changes of reproduction-related genes in bovine Sertoli cells.

Author Contributions

In this research, H.S. and H.Y. were the main contributors to completing the experiments and writing the manuscript. Z.Z., R.Y., and X.F. proposed the experimental design and ideas. Z.B. and M.G. provided help with the experimental process. L.X. and P.J. assisted in the data analysis. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (No. 31772562, 31802034, and 31672389), the National Major Special Project on New Varieties Cultivation for Transgenic Organisms (2016ZX08009003-006), the Science and Technology Project of Jilin Provincial Education Department (JJKH20211132KJ), and the Graduate Innovation Fund of Jilin University (101832020CX332).

Institutional Review Board Statement

Animal care and experiments were performed according to the guidelines established by the care and use of laboratory animals of the Jilin University Animal Care and Use Committee (Permit number: SY201901007).

Data Availability Statement

Not applicable.

Acknowledgments

We are grateful to the Branch of Animal Science, Jilin Academy of Agricultural Sciences, for animal sampling.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Ambros, V. The functions of animal micrornas. Nature 2004, 431, 350–355. [Google Scholar] [CrossRef]
  2. Bartel, D.P. Micrornas: Genomics, biogenesis, mechanism, and function. Cell 2004, 116, 281–297. [Google Scholar] [CrossRef] [Green Version]
  3. Lewis, B.P.; Burge, C.B.; Bartel, D.P. Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microrna targets. Cell 2005, 120, 15–20. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Yao, C.; Liu, Y.; Sun, M.; Niu, M.; Yuan, Q.; Hai, Y.; Guo, Y.; Chen, Z.; Hou, J.; Liu, Y.; et al. Micrornas and DNA methylation as epigenetic regulators of mitosis, meiosis and spermiogenesis. Reproduction 2015, 150, R25–R34. [Google Scholar] [CrossRef] [Green Version]
  5. Zhou, H.; Hu, H.; Lai, M. Non-coding rnas and their epigenetic regulatory mechanisms. Biol. Cell 2010, 102, 645–655. [Google Scholar] [CrossRef]
  6. Pratt, S.L.; Calcatera, S.M. Expression of microrna in male reproductive tissues and their role in male fertility. Reprod. Fertil. Dev. 2016, 29, 24–31. [Google Scholar] [CrossRef]
  7. Barbu, M.G.; Thompson, D.C.; Suciu, N.; Voinea, S.C.; Cretoiu, D. The roles of micrornas in male infertility. Int. J. Mol. Sci. 2021, 22, 2910. [Google Scholar] [CrossRef]
  8. Khawar, M.B.; Mehmood, R.; Roohi, N. Micrornas: Recent insights towards their role in male infertility and reproductive cancers. Bosn. J. Basic Med. Sci. 2019, 19, 31–42. [Google Scholar] [CrossRef]
  9. Corney, D.C.; Flesken-Nikitin, A.; Godwin, A.K.; Wang, W.; Nikitin, A.Y. Microrna-34b and microrna-34c are targets of p53 and cooperate in control of cell proliferation and adhesion-independent growth. Cancer Res. 2007, 67, 8433–8438. [Google Scholar] [CrossRef] [Green Version]
  10. He, X.; He, L.; Hannon, G.J. The guardian’s little helper: Micrornas in the p53 tumor suppressor network. Cancer Res. 2007, 67, 11099–11101. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  11. Li, R.; Zhang, H.; Zheng, X. Mir-34c induces apoptosis and inhibits the viability of m4e cells by targeting bcl2. Oncol. Lett. 2018, 15, 3357–3361. [Google Scholar] [CrossRef] [Green Version]
  12. Huang, P.; Gu, X.J.; Huang, M.Y.; Tan, J.H.; Wang, J. Down-regulation of linc00667 hinders renal tubular epithelial cell apoptosis and fibrosis through mir-34c. Clin. Transl. Oncol. 2021, 23, 572–581. [Google Scholar] [CrossRef]
  13. Jones, P.H.; Deng, B.; Winkler, J.; Zirnheld, A.L.; Ehringer, S.; Shetty, V.; Cox, M.; Nguyen, H.; Shen, W.J.; Huang, T.T. Over-expression of mir-34c leads to early-life visceral fat accumulation and insulin resistance. Sci. Rep. 2019, 9, 13844. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Li, M.; Yu, M.; Liu, C.; Zhu, H.; He, X.; Peng, S.; Hua, J. Mir-34c works downstream of p53 leading to dairy goat male germline stem-cell (mgscs) apoptosis. Cell Prolif. 2013, 46, 223–231. [Google Scholar] [CrossRef]
  15. Zhang, S.; Yu, M.; Liu, C.; Wang, L.; Hu, Y.; Bai, Y.; Hua, J. Mir-34c regulates mouse embryonic stem cells differentiation into male germ-like cells through rarg. Cell Biochem. Funct. 2012, 30, 623–632. [Google Scholar] [CrossRef] [PubMed]
  16. Ma, C.; Song, H.; Guan, K.; Zhou, J.; Xia, X.; Li, F. Characterization of swine testicular cell line as immature porcine sertoli cell line. In Vitro Cell. Dev. Biol. Anim. 2016, 52, 427–433. [Google Scholar] [CrossRef]
  17. Walker, W.H.; Cheng, J. Fsh and testosterone signaling in sertoli cells. Reproduction 2005, 130, 15–28. [Google Scholar] [CrossRef] [Green Version]
  18. Schlatt, S.; Ehmcke, J. Regulation of spermatogenesis: An evolutionary biologist’s perspective. Semin. Cell Dev. Biol. 2014, 29, 2–16. [Google Scholar] [CrossRef]
  19. Meng, X.; Lindahl, M.; Hyvönen, M.E.; Parvinen, M.; de Rooij, D.G.; Hess, M.W.; Raatikainen-Ahokas, A.; Sainio, K.; Rauvala, H.; Lakso, M.; et al. Regulation of cell fate decision of undifferentiated spermatogonia by gdnf. Science 2000, 287, 1489–1493. [Google Scholar] [CrossRef]
  20. He, Z.; Jiang, J.; Kokkinaki, M.; Golestaneh, N.; Hofmann, M.C.; Dym, M. Gdnf upregulates c-fos transcription via the ras/erk1/2 pathway to promote mouse spermatogonial stem cell proliferation. Stem Cells 2008, 26, 266–278. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  21. Carlomagno, G.; van Bragt, M.P.; Korver, C.M.; Repping, S.; de Rooij, D.G.; van Pelt, A.M. Bmp4-induced differentiation of a rat spermatogonial stem cell line causes changes in its cell adhesion properties. Biol. Reprod. 2010, 83, 742–749. [Google Scholar] [CrossRef] [Green Version]
  22. Hu, J.; Chen, Y.X.; Wang, D.; Qi, X.; Li, T.G.; Hao, J.; Mishina, Y.; Garbers, D.L.; Zhao, G.Q. Developmental expression and function of bmp4 in spermatogenesis and in maintaining epididymal integrity. Dev. Biol. 2004, 276, 158–171. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Strange, D.P.; Jiyarom, B.; Pourhabibi Zarandi, N.; Xie, X. Axl promotes zika virus entry and modulates the antiviral state of human sertoli cells. MBio 2019, 10, e01372-19. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Lu, Q.; Gore, M.; Zhang, Q.; Camenisch, T.; Boast, S.; Casagranda, F.; Lai, C.; Skinner, M.K.; Klein, R.; Matsushima, G.K.; et al. Tyro-3 family receptors are essential regulators of mammalian spermatogenesis. Nature 1999, 398, 723–728. [Google Scholar] [CrossRef] [PubMed]
  25. Gao, Y.; Qin, L.; Yang, Y.; Dong, X.; Zhao, Z.; Zhang, G.; Zhao, Z. Pdpn gene promotes the proliferation of immature bovine sertoli cells in vitro. Anim. Reprod. Sci. 2017, 179, 35–43. [Google Scholar] [CrossRef]
  26. Kozomara, A.; Birgaoanu, M.; Griffiths-Jones, S. Mirbase: From microrna sequences to function. Nucleic Acids Res. 2019, 47, D155–D162. [Google Scholar] [CrossRef]
  27. Agarwal, V.; Bell, G.W.; Nam, J.W.; Bartel, D.P. Predicting effective microrna target sites in mammalian mrnas. Elife 2015, 4, e05005. [Google Scholar] [CrossRef]
  28. Nie, Y.W.; Ding, X.B.; Ge, X.G.; Fan, H.L.; Liu, Z.W.; Guo, H. Enhanced expression of myf5 and myod1 in fibroblast cells via the forced expression of bos taurus myf5. Cell Biol. Int. 2013, 37, 972–976. [Google Scholar] [CrossRef] [PubMed]
  29. Griswold, M.D. The central role of sertoli cells in spermatogenesis. Semin. Cell Dev. Biol. 1998, 9, 411–416. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  30. Aranha, I.; Bhagya, M.; Yajurvedi, H.N. Testis of the lizard mabuya carinata: A light microscopic and ultrastructural seasonal study. J. Submicrosc. Cytol. Pathol. 2006, 38, 93–102. [Google Scholar]
  31. Lui, W.Y.; Lee, W.M.; Cheng, C.Y. Transforming growth factor-beta3 perturbs the inter-sertoli tight junction permeability barrier in vitro possibly mediated via its effects on occludin, zonula occludens-1, and claudin-11. Endocrinology 2001, 142, 1865–1877. [Google Scholar] [CrossRef]
  32. Guan, Y.; Liang, G.; Hawken, P.A.; Meachem, S.J.; Malecki, I.A.; Ham, S.; Stewart, T.; Guan, L.L.; Martin, G.B. Nutrition affects Sertoli cell function but not Sertoli cell numbers in sexually mature male sheep. Reprod. Fertil. Dev. 2014, 28, 1152–1163. [Google Scholar] [CrossRef] [PubMed]
  33. Ning, Q.; Ogawa, Y.; Kuramasu, M.; Nagahori, K.; Kou, S.; Itoh, M. Immunological microenvironment in the testis. Reprod. Med. Biol. 2020, 19, 24–31. [Google Scholar]
  34. Massagué, J.; Blain, S.W.; Lo, R.S. Tgfbeta signaling in growth control, cancer, and heritable disorders. Cell 2000, 103, 295–309. [Google Scholar] [CrossRef] [Green Version]
  35. Yang, Q.E.; Kim, D.; Kaucher, A.; Oatley, M.J.; Oatley, J.M. Cxcl12-cxcr4 signaling is required for the maintenance of mouse spermatogonial stem cells. J. Cell Sci. 2013, 126, 1009–1020. [Google Scholar]
  36. Kitamura, K.; Tanaka, H.; Nishimune, Y. Haprin, a novel haploid germ cell-specific ring finger protein involved in the acrosome reaction. J. Biol. Chem. 2003, 278, 44417–44423. [Google Scholar] [CrossRef] [Green Version]
  37. Aoki, Y.; Tsujimura, A.; Kaseda, K.; Okabe, M.; Tokuhiro, K.; Ohta, T.; O’Bryan, M.K.; Okuda, H.; Kitamura, K.; Ogawa, Y.; et al. Haprin-deficient spermatozoa are incapable of in vitro fertilization. Mol. Reprod. Dev. 2020, 87, 534–541. [Google Scholar] [CrossRef] [PubMed]
  38. Yang, R.; Tsai-Morris, C.H.; Kang, J.H.; Dufau, M.L. Elucidation of rna binding regions of gonadotropin-regulated testicular rna helicase (grth/ddx25) to transcripts of a chromatin remodeling protein essential for spermatogenesis. Horm. Mol. Biol. Clin. Investig. 2015, 22, 119–130. [Google Scholar] [CrossRef] [PubMed]
  39. Hammadeh, M.E.; Hamad, M.F.; Montenarh, M.; Fischer-Hammadeh, C. Protamine contents and p1/p2 ratio in human spermatozoa from smokers and non-smokers. Hum. Reprod. (Oxf. Engl.) 2010, 25, 2708–2720. [Google Scholar] [CrossRef] [Green Version]
  40. García-Peiró, A.; Martínez-Heredia, J.; Oliver-Bonet, M.; Abad, C.; Amengual, M.J.; Navarro, J.; Jones, C.; Coward, K.; Gosálvez, J.; Benet, J. Protamine 1 to protamine 2 ratio correlates with dynamic aspects of DNA fragmentation in human sperm. Fertil. Steril. 2011, 95, 105–109. [Google Scholar] [CrossRef]
  41. Don, J.; Stelzer, G. The expanding family of creb/crem transcription factors that are involved with spermatogenesis. Mol. Cell. Endocrinol. 2002, 187, 115–124. [Google Scholar] [CrossRef]
  42. Kim, J.S.; Song, M.S.; Seo, H.S.; Yang, M.; Kim, S.H.; Kim, J.C.; Kim, H.; Saito, T.R.; Shin, T.; Moon, C. Immunohistochemical analysis of camp response element-binding protein in mouse testis during postnatal development and spermatogenesis. Histochem. Cell Biol. 2009, 131, 501–507. [Google Scholar] [CrossRef]
  43. Zheng, L.; Zhai, Y.; Li, N.; Ma, F.; Zhu, H.; Du, X.; Li, G.; Hua, J. The modification of tet1 in male germline stem cells and interact with pcna, hdac1 to promote their self-renewal and proliferation. Sci. Rep. 2016, 6, 37414. [Google Scholar] [CrossRef] [PubMed]
  44. Asano, A.; Roman, H.B.; Hirschberger, L.L.; Ushiyama, A.; Nelson, J.L.; Hinchman, M.M.; Stipanuk, M.H.; Travis, A.J. Cysteine dioxygenase is essential for mouse sperm osmoadaptation and male fertility. FEBS J. 2018, 285, 1827–1839. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  45. Zhu, P.R.; Wu, Q.Y.; Yu, M.M.; Zhang, M.C.; Xu, H.Q. Nucleotide polymorphism rs4880 of the sod2 gene and the risk of male infertility. Zhonghua Nan Ke Xue/Natl. J. Androl. 2017, 23, 137–141. [Google Scholar]
Figure 1. MiR-34c inhibits the proliferation-related gene expression in bovine Sertoli cells. (A) MiR-34c was upregulated in Sertoli cells after transfection with miR-34c mimics, and miR-34c was downregulated in Sertoli cells after transfection with the miR-34c inhibitor for 48 h. U6 was used as a reference. (B) Detection of the relative expression level of PCNA after transfection with miR-34c mimics, miR-34c inhibitor or Negative Control for 48 h. β-actin was used as a reference gene. (C) After transfection for 48 h, qRT-PCR was used to detect the relative abundance of the transcript of GDNF, BMP4 and CXCL12 in bovine Sertoli cells, and β-actin was used as a reference gene. * p < 0.05; ** p < 0.01; **** p <0.0001.
Figure 1. MiR-34c inhibits the proliferation-related gene expression in bovine Sertoli cells. (A) MiR-34c was upregulated in Sertoli cells after transfection with miR-34c mimics, and miR-34c was downregulated in Sertoli cells after transfection with the miR-34c inhibitor for 48 h. U6 was used as a reference. (B) Detection of the relative expression level of PCNA after transfection with miR-34c mimics, miR-34c inhibitor or Negative Control for 48 h. β-actin was used as a reference gene. (C) After transfection for 48 h, qRT-PCR was used to detect the relative abundance of the transcript of GDNF, BMP4 and CXCL12 in bovine Sertoli cells, and β-actin was used as a reference gene. * p < 0.05; ** p < 0.01; **** p <0.0001.
Animals 11 02393 g001
Figure 2. MiR-34c inhibits the proliferation of bovine Sertoli cells. (AC) EdU and Hoechst 33342 staining of Sertoli cells. (D) Ralative EdU positive cell rate. The EdU-positive cells in bovine Sertoli cells after transfection and cell nuclei were counterstained with Hoechst 33342 (100×), Scale bar = 200 μm. Data were presented as means ± SEM. Standard Error of Mean (SEM) was indicated by error bars. p < 0.05 was considered to be statistically significant. *** p < 0.001; **** p < 0.0001.
Figure 2. MiR-34c inhibits the proliferation of bovine Sertoli cells. (AC) EdU and Hoechst 33342 staining of Sertoli cells. (D) Ralative EdU positive cell rate. The EdU-positive cells in bovine Sertoli cells after transfection and cell nuclei were counterstained with Hoechst 33342 (100×), Scale bar = 200 μm. Data were presented as means ± SEM. Standard Error of Mean (SEM) was indicated by error bars. p < 0.05 was considered to be statistically significant. *** p < 0.001; **** p < 0.0001.
Animals 11 02393 g002
Figure 3. MiR-34c promotes the apoptosis of bovine Sertoli cells. (AD) The rate of apoptosis in Sertoli cells was detected by flow cytometry, and apoptosis in Sertoli cells was analyzed by flow cytometry. (EH) The TUNEL assay showed apoptotic cells among bovine Sertoli cells after transfection, and cell nuclei were counterstained with Hoechst 33342 (100×), Scale bar = 200 μm. (I,J) Data were presented as means ± SEM. Standard Error of Mean (SEM) was indicated by error bars. p < 0.05 was considered to be statistically significant. * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001.
Figure 3. MiR-34c promotes the apoptosis of bovine Sertoli cells. (AD) The rate of apoptosis in Sertoli cells was detected by flow cytometry, and apoptosis in Sertoli cells was analyzed by flow cytometry. (EH) The TUNEL assay showed apoptotic cells among bovine Sertoli cells after transfection, and cell nuclei were counterstained with Hoechst 33342 (100×), Scale bar = 200 μm. (I,J) Data were presented as means ± SEM. Standard Error of Mean (SEM) was indicated by error bars. p < 0.05 was considered to be statistically significant. * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001.
Animals 11 02393 g003
Figure 4. Verification of the target relationship between miR-34c and the AXL gene. (A) Sequence information of the binding site in the 3′UTR of AXL by TargetScanHuman 7.2. (B) The relative abundance of the transcript of the AXL gene. (C) Firefly and Renilla luciferase activities were measured after 48 h of transfection in Sertoli cells. *** p < 0.001; **** p < 0.0001.
Figure 4. Verification of the target relationship between miR-34c and the AXL gene. (A) Sequence information of the binding site in the 3′UTR of AXL by TargetScanHuman 7.2. (B) The relative abundance of the transcript of the AXL gene. (C) Firefly and Renilla luciferase activities were measured after 48 h of transfection in Sertoli cells. *** p < 0.001; **** p < 0.0001.
Animals 11 02393 g004
Figure 5. The effect of the AXL gene on male reproductive function genes. (A) The relative abundance of the transcript of AXL in Sertoli cells. (B) The relative abundance of the transcript of 10 male reproduction-related genes. Data were presented as means ± SEM. Standard Error of Mean (SEM) was indicated by error bars. p < 0.05 was considered to be statistically significant. **** p < 0.0001.
Figure 5. The effect of the AXL gene on male reproductive function genes. (A) The relative abundance of the transcript of AXL in Sertoli cells. (B) The relative abundance of the transcript of 10 male reproduction-related genes. Data were presented as means ± SEM. Standard Error of Mean (SEM) was indicated by error bars. p < 0.05 was considered to be statistically significant. **** p < 0.0001.
Animals 11 02393 g005
Figure 6. A schematic illustration of miR-34c targeting the AXL gene affects proliferation, apoptosis, and relative gene abundance of transcripts of reproduction-associated secreted factors in Sertoli cells.
Figure 6. A schematic illustration of miR-34c targeting the AXL gene affects proliferation, apoptosis, and relative gene abundance of transcripts of reproduction-associated secreted factors in Sertoli cells.
Animals 11 02393 g006
Table 1. The primers for Nested PCR.
Table 1. The primers for Nested PCR.
Primer IDPrimer Sequence (5′–3′)Product Length
AXL-1FTACCAGACGAGCACGGAGA3172 bp
AXL-1RTCAGGCGCCGTCCTCCTG
AXL-2FATGGGCAAGGTCCTGTTGGC2664 bp
AXL-2RTCAGGCGCCGTCCTCCTG
Table 2. Primers of qRT-PCR.
Table 2. Primers of qRT-PCR.
Primer ID.Primer Sequence (5′–3′)Product Length
PCNA-FCTCGTCTCATGTCTCCTTGGT137 bp
PCNA-RTGTCTTCATTGCCAGCACATT
BAX-FCGGAGATGAATTGGACAGTAACA123 bp
BAX-RCAGTTGAAGTTGCCGTCAGAA
PARPBP-FAGAGAATACGCAGTAGACGATGA167 bp
PARPBP-RAGAATATGAGCCAGAGCCAAGT
GDNF-FCTCACCGCCGTGCATCTAA160 bp
GDNF-RTGTCACTCACCAGCCTTCTAC
BMP4-FGGCTGGAATGACTGGATTGTG105 bp
BMP4-RGGCGTGGTTGGTTGAGTTG
CXCL12-FATGCCCTTGCCGATTCTTTG124 bp
CXCL12-RCACTTGCCTATTGTTGTTCTTCAG
AXL-FCCGTTATGGAGAGGTGTT107 bp
AXL-RGTTCAAGGTGGCTTCAGT
β-actin-FAGAGCAAGAGAGGCATCC103 bp
β-actin-RTCGTTGTAGAAGGTGTGGT
Table 3. Differently expressed genes related to male reproduction.
Table 3. Differently expressed genes related to male reproduction.
Gene SymbolFold RegulationExpression
tripartite motif containing 36 (TRIM36)2.2up
histone deacetylase 1 (HDAC1)3.78up
DEAD-box helicase 25 (DDX25)3.18up
transition protein 1 (TNP1)3.01up
SRSF protein kinase 1 (SRPK1)3.01up
cAMP responsive element binding protein 1 (CREB1)2.69up
cysteine dioxygenase type 1 (CDO1)−2.58down
superoxide dismutase 2 (SOD2)−4.56down
PDZ domain containing 8 (PDZD8)−2.16down
DnaJ member C28 (DNAJC28)−2.07down
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Sun, H.; Yu, H.; Xia, L.; Jiang, P.; Bai, Z.; Gao, M.; Zhao, Z.; Yang, R.; Fang, X. MiRNA-34c Regulates Bovine Sertoli Cell Proliferation, Gene Expression, and Apoptosis by Targeting the AXL Gene. Animals 2021, 11, 2393. https://doi.org/10.3390/ani11082393

AMA Style

Sun H, Yu H, Xia L, Jiang P, Bai Z, Gao M, Zhao Z, Yang R, Fang X. MiRNA-34c Regulates Bovine Sertoli Cell Proliferation, Gene Expression, and Apoptosis by Targeting the AXL Gene. Animals. 2021; 11(8):2393. https://doi.org/10.3390/ani11082393

Chicago/Turabian Style

Sun, Hao, Haibin Yu, Lixin Xia, Ping Jiang, Zitong Bai, Ming Gao, Zhihui Zhao, Runjun Yang, and Xibi Fang. 2021. "MiRNA-34c Regulates Bovine Sertoli Cell Proliferation, Gene Expression, and Apoptosis by Targeting the AXL Gene" Animals 11, no. 8: 2393. https://doi.org/10.3390/ani11082393

APA Style

Sun, H., Yu, H., Xia, L., Jiang, P., Bai, Z., Gao, M., Zhao, Z., Yang, R., & Fang, X. (2021). MiRNA-34c Regulates Bovine Sertoli Cell Proliferation, Gene Expression, and Apoptosis by Targeting the AXL Gene. Animals, 11(8), 2393. https://doi.org/10.3390/ani11082393

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop