Longitudinal Expression of Testicular TAS1R3 from Prepuberty to Sexual Maturity in Congjiang Xiang Pigs
Abstract
Simple Summary
Abstract
1. Introduction
2. Material and Methods
2.1. Animals and Ethics Statement
2.2. Experimental Design
2.3. Tissue Preparation
2.4. Testosterone Assay
2.5. Quantitative Real-Time PCR (q-PCR)
2.6. Histological Examination
2.7. Immunohistochemistry
2.8. Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis (SDS-PAGE) and WB
2.9. Statistical Analysis
3. Results
3.1. Changes in the Gonadosomatic Index and Testosterone Level during Development
3.2. Morphological Changes in the Testes during Development
3.3. Expression of T1R3 and PLCβ2 in Testes of Congjiang Xiang Pigs during Postnatal Development
3.4. Expression of T1R3 and PLCβ2 during the Spermatogenic Cycle
3.5. mRNA Expression of Umami Taste-Related Molecules in Testes of Congjiang Xiang Pigs during Development
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Nuemket, N.; Yasui, N.; Kusakabe, Y.; Nomura, Y.; Atsumi, N.; Akiyama, S.; Hosotani, M. Structural basis for perception of diverse chemical substances by T1r taste receptors. Nat. Commun. 2017, 8, 1–10. [Google Scholar] [CrossRef]
- Ekstrand, B.; Young, J.F.; Rasmussen, M.K. Taste receptors in the gut–A new target for health promoting properties in diet. Food Res. Int. 2017, 100, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Kiuchi, S.; Yamada, T.; Kiyokawa, N.; Saito, T.; Fujimoto, J.; Yasue, H. Genomic structure of swine taste receptor family 1 member 3, TAS1R3, and its expression in tissues. Cytogenet. Genome Res. 2006, 115, 51–61. [Google Scholar] [CrossRef]
- Li, F. Taste perception: From the tongue to the testis. Mol. Hum. Reprod. 2013, 19, 349–360. [Google Scholar] [CrossRef] [PubMed]
- Governini, L.; Semplici, B.; Pavone, V.; Crifasi, L.; Marrocco, C.; De Leo, V.; Piomboni, P. Expression of taste receptor 2 subtypes in human testis and sperm. J. Clin. Med. 2020, 9, 264. [Google Scholar] [CrossRef]
- Meyer, D.; Voigt, A.; Widmayer, P.; Borth, H.; Huebner, S.; Breit, A.; Marschall, S.; de Angelis, M.H.; Boehm, U.; Meyerhof, W.; et al. Expression of Tas1 taste receptors in mammalian spermatozoa: Functional role of Tas1r1 in regulating basal Ca2+ and cAMP concentrations in spermatozoa. PLoS ONE 2012, 7, e32354. [Google Scholar] [CrossRef]
- Feng, L.; Minliang, Z. Depletion of bitter taste transduction leads to massive spermatid loss in transgenic mice. Mol. Hum. Reprod. 2012, 18, 289–297. [Google Scholar]
- Lee, S.J.; Depoortere, I.; Hatt, H. Therapeutic potential of ectopic olfactory and taste receptors. Nat. Rev. Drug Discov. 2019, 18, 116–138. [Google Scholar] [CrossRef]
- Luddi, A.; Governini, L.; Wilmskötter, D.; Gudermann, T.; Boekhoff, I.; Piomboni, P. Taste receptors: New players in sperm biology. Int. J. Mol. Sci. 2019, 20, 967. [Google Scholar] [CrossRef] [PubMed]
- Mosinger, B.; Redding, K.M.; Parker, M.R.; Yevshayeva, V.; Yee, K.K.; Dyomina, K.; Li, Y.; Margolskee, R.F. Genetic loss or pharmacological blockade of testes-expressed taste genes causes male sterility. Proc. Natl. Acad. Sci. USA 2013, 110, 12319–12324. [Google Scholar] [CrossRef] [PubMed]
- Gong, T.; Wei, Q.W.; Mao, D.G.; Shi, F.X. Expression patterns of taste receptor type 1 subunit 3 and α-gustducin in the mouse testis during development. Acta Histochem. 2016, 118, 20–30. [Google Scholar] [CrossRef] [PubMed]
- Gong, T.; Wei, Q.W.; Mao, D.G.; Nagaoka, K.; Watanabe, G.; Taya, K.; Shi, F.X. Effects of daily exposure to saccharin and sucrose on testicular biologic functions in mice. Biol. Reprod. 2016, 95, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Liu, P.; Liu, R.; Zhang, Q. Chinese Xiang Pig; China Agriculture Press: Beijing, China, 2010. [Google Scholar]
- Tang, L.T.; Ran, X.Q.; Mao, N.; Zhang, F.P.; Niu, X.; Ruan, Y.Q.; Wang, J.F. Analysis of alternative splicing events by RNA sequencing in the ovaries of Xiang pig at estrous and diestrous. Theriogenology 2018, 119, 60–68. [Google Scholar] [CrossRef] [PubMed]
- Luo, Z.Y.; Dai, X.L.; Ran, X.Q.; Cen, Y.X.; Niu, X.; Li, S.; Huang, S.H.; Wang, J.F. Identification and profile of microRNAs in Xiang pig testes in four different ages detected by Solexa sequencing. Theriogenology 2018, 117, 61–71. [Google Scholar] [CrossRef]
- Lerman, L.O.; Kurtz, T.W.; Touyz, R.M.; Ellison, D.H.; Chade, A.R.; Crowley, S.D.; Mattson, D.L.; Mullins, J.J.; Osborn, J.; Eirin, A. Animal models of hypertension: A scientific statement from the American Heart Association. Hypertension 2019, 73, e87–e120. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.Y.; Meng, L.J.; Xu, Y.J.; Gong, T.; Yang, Y. Effects of 4% paraformaldehyde and modified Davidson’s fluid on the morphology and immunohistochemistry of Xiang pig testes. J. Toxicol. Pathol. 2020, 33, 97–104. [Google Scholar] [CrossRef]
- Fleige, S.; Pfaffl, M.W. RNA integrity and the effect on the real-time qRT-PCR performance. Mol. Aspects Med. 2006, 27, 126–139. [Google Scholar] [CrossRef]
- Nygard, A.B.; Jørgensen, C.B.; Cirera, S.; Fredholm, M. Selection of reference genes for gene expression studies in pig tissues using SYBR green qPCR. BMC Mol. Biol. 2007, 8, 67. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- King, G.; Payne, S.; Walker, F.; Murray, G.I. A highly sensitive detection method for immunohistochemistry using biotinylated tyramine. J. Pathol. 1997, 183, 237–241. [Google Scholar] [CrossRef]
- Wei, Q.W.; Ding, W.; Shi, F.X. Roles of poly (adp-ribose) polymerase (parp1) cleavage in the ovaries of fetal, neonatal, and adult pigs. Reproduction 2013, 146, 593–602. [Google Scholar] [CrossRef] [PubMed]
- Yomogida, K. Electroporation and Sonoporation in Developmental Biology; Springer: Tokyo, Japan, 2009; pp. 271–283. [Google Scholar]
- Liman, E.R.; Zhang, Y.V.; Montell, C. Peripheral coding of taste. Neuron 2014, 81, 984–1000. [Google Scholar] [CrossRef] [PubMed]
- Ren, D.; Xing, Y.; Lin, M.; Wu, Y.; Li, K.; Li, W.; Yang, S.; Guo, T.; Ren, J.; Ma, J. Evaluations of boar gonad development, spermatogenesis with regard to semen characteristics, libido and serum testosterone levels based on large White Duroc × Chinese Erhualian crossbred boars. Reprod. Domest. Anim. 2009, 44, 913–919. [Google Scholar] [CrossRef] [PubMed]
- Kangawa, A.; Otake, M.; Enya, S.; Yoshida, T.; Shibata, M. Histological changes of the testicular interstitium during postnatal development in microminipigs. Toxicol. Pathol. 2019, 47, 469–482. [Google Scholar] [CrossRef]
- Frolikova, M.; Otcenaskova, T.; Valasková, E.; Postlerova, P.; Stopkova, R.; Stopka, P.; Komrskova, K. The Role of Taste Receptor mTAS1R3 in Chemical Communication of Gametes. Int. J. Mol. Sci. 2020, 21, 2651. [Google Scholar] [CrossRef] [PubMed]
- Spinaci, M.; Bucci, D.; Gadani, B.; Porcu, E.; Tamanini, C.; Galeati, G. Pig sperm preincubation and gamete coincubation with glutamate enhance sperm-oocyte binding and in vitro fertilization. Theriogenology 2017, 95, 149–153. [Google Scholar] [CrossRef] [PubMed]
- Picut, C.A.; Remick, A.K.; de Rijk, E.P.; Simons, M.L.; Stump, D.G.; Parker, G.A. Postnatal development of the testis in the rat: Morphologic study and correlation of morphology to neuroendocrine parameters. Toxicol. Pathol. 2015, 43, 326–342. [Google Scholar] [CrossRef] [PubMed]
- Inoue, M.; Baba, T.; Morohashi, K.i. Recent progress in understanding the mechanisms of Leydig cell differentiation. Mol. Cell. Endocrinol. 2018, 468, 39–46. [Google Scholar] [CrossRef]
- Lervik, S.; Oskam, I.; Krogenæs, A.; Andresen, O.; Dahl, E.; Haga, H.A.; Tajet, H.; Olsaker, I.; Ropstad, E. Androsterone and testosterone levels and testicular morphology of Duroc boars related to estimated breeding value for androsterone. Theriogenology 2013, 79, 986–994. [Google Scholar] [CrossRef]
- Cormier, M.; Ghouili, F.; Roumaud, P.; Bauer, W.; Touaibia, M.; Martin, L.J. Influences of flavones on cell viability and cAMP-dependent steroidogenic gene regulation in MA-10 Leydig cells. Cell Biol. Toxicol. 2018, 34, 23–38. [Google Scholar] [CrossRef]
- Poderoso, C.; Duarte, A.; Cooke, M.; Orlando, U.; Gottifredi, V.; Solano, A.R.; Lemos, J.R.; Podestá, E.J. The spatial and temporal regulation of the hormonal signal. Role of mitochondria in the formation of a protein complex required for the activation of cholesterol transport and steroids synthesis. Mol. Cell. Endocrinol. 2013, 371, 26–33. [Google Scholar] [CrossRef]
- Hu, X.; Go, Y.M.; Jones, D.P. Omics integration for mitochondria systems biology. Antioxid. Redox Signal. 2020, 32, 853–872. [Google Scholar] [CrossRef] [PubMed]
- Martin, L.J. Cell interactions and genetic regulation that contribute to testicular Leydig cell development and differentiation. Mol. Reprod. Dev. 2016, 83, 470–487. [Google Scholar] [CrossRef] [PubMed]
- Bode, G.; Clausing, P.; Gervais, F.; Loegsted, J.; Luft, J.; Nogues, V.; Sims, J. The utility of the minipig as an animal model in regulatory toxicology. Pharmacol. Toxicol. Methods 2010, 62, 196–220. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.; Ran, X.; Wang, J.; Li, S.; Liu, J. Detection of genomic structural variations in Guizhou indigenous pigs and the comparison with other breeds. PLoS ONE 2018, 13, e0194282. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.; Ran, X.; Yu, C.; Xu, Q.; Niu, X.; Zhao, P.; Wang, J. Whole-genome analysis of structural variations between Xiang pigs with larger litter sizes and those with smaller litter sizes. Genomics 2019, 111, 310–319. [Google Scholar] [CrossRef] [PubMed]
- Huang, M.; Yang, B.; Chen, H.; Zhang, H.; Wu, Z.; Ai, H.; Ren, J.; Huang, L. The fine-scale genetic structure and selection signals of Chinese indigenous pigs. Evol. Appl. 2020, 13, 458–475. [Google Scholar] [CrossRef]
- Meng, L.J.; Wang, W.Y.; Xu, Y.J.; Gong, T.; Yang, Y. Postnatal differentiation and regional histological variations in the ductus epididymidis of the Congjiang Xiang pig. Tissue Cell 2020, 67, 101411. [Google Scholar] [CrossRef]
- Howroyd, P.C.; Peter, B.; de Rijk, E. Review of sexual maturity in the minipig. Toxicol. Pathol. 2016, 44, 607–611. [Google Scholar] [CrossRef]
- Schwarzenberger, F.; Toole, G.S.; Christie, H.L.; Raeside, J.I. Plasma levels of several androgens and estrogens from birth to puberty in male domestic pigs. Eur. J. Endocrinol. 1993, 128, 173–177. [Google Scholar] [CrossRef]
- França, L.R.; Silva, V.A., Jr.; Chiarini, H.; Garcia, S.K.; Debeljuk, L. Cell proliferation and hormonal changes during postnatal development of the testis in the pig. Biol. Reprod. 2000, 63, 1629–1636. [Google Scholar]
Gene Name | NCBI Reference Sequence | Oligonucleotide Primers (5′-3′) | Expected Products Size (bp) | Melting Temperature (Tm, °C) | Amplification Efficiency (%) |
---|---|---|---|---|---|
TAS1R3 | NM_031872.2 | Forward: TCATCACCTGGGTTTCCTT | 235 | 60 | 90.1 |
Reverse: GGGGTCATTTGTTTTTTCC | |||||
TAS1R1 | NC_010448.4 | Forward: GGAGATCCGCAAGGTCAAT | 167 | 58.4 | 101.6 |
Reverse: GCTGAACTGGCGACAACAAT | |||||
PLCB2 | XM_021097762 | Forward: CACCACCCTTTCTATTACGG | 239 | 59 | 98.6 |
Reverse: TGTTGCCTTCCTCCATCA | |||||
ACTB | XM_021086047.1 | Forward: AAGTACTCCGTGTGGATCGG | 61 | 60 | 102.0 |
Reverse: ACATCTGCTGGAAGGTGGAC |
Manufacturer | Protein/Name | Species Origin | Catalogue No. | Dilution * | |
---|---|---|---|---|---|
WB | IHC | ||||
Affinity Biosciences | T1R1 | Rabbit | DF10278 | − | − |
Abcam | T1R3 | Rabbit | ab150525 | 1/1000 | 1/150 |
Thermo Fisher Scientific | GNAT3 | Rabbit | PA5-50670 | − | − |
Thermo Fisher Scientific | PLCβ2 | Rabbit | PA5-75551 | − | 1/200 |
Affinity Biosciences | β-actin | Rabbit | AF7018 | 1/3000 | − |
ABclonal Technology | Second antibody | Rabbit | AC026 | 1/5000 | − |
Boster Biological Technology | SABC Kit | SA2002 | − | 1:300 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gong, T.; Wang, W.; Xu, H.; Yang, Y.; Chen, X.; Meng, L.; Xu, Y.; Li, Z.; Wan, S.; Mu, Q. Longitudinal Expression of Testicular TAS1R3 from Prepuberty to Sexual Maturity in Congjiang Xiang Pigs. Animals 2021, 11, 437. https://doi.org/10.3390/ani11020437
Gong T, Wang W, Xu H, Yang Y, Chen X, Meng L, Xu Y, Li Z, Wan S, Mu Q. Longitudinal Expression of Testicular TAS1R3 from Prepuberty to Sexual Maturity in Congjiang Xiang Pigs. Animals. 2021; 11(2):437. https://doi.org/10.3390/ani11020437
Chicago/Turabian StyleGong, Ting, Weiyong Wang, Houqiang Xu, Yi Yang, Xiang Chen, Lijie Meng, Yongjian Xu, Ziqing Li, Sufang Wan, and Qi Mu. 2021. "Longitudinal Expression of Testicular TAS1R3 from Prepuberty to Sexual Maturity in Congjiang Xiang Pigs" Animals 11, no. 2: 437. https://doi.org/10.3390/ani11020437
APA StyleGong, T., Wang, W., Xu, H., Yang, Y., Chen, X., Meng, L., Xu, Y., Li, Z., Wan, S., & Mu, Q. (2021). Longitudinal Expression of Testicular TAS1R3 from Prepuberty to Sexual Maturity in Congjiang Xiang Pigs. Animals, 11(2), 437. https://doi.org/10.3390/ani11020437