The Laetiporus sulphureus Fermented Product Enhances the Antioxidant Status, Intestinal Tight Junction, and Morphology of Broiler Chickens
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Laetiporus sulphureus Culture, Inoculum Preparation, and Solid-State Fermentation
2.2. Experimental Birds and Housing
2.3. Collection of Serum, Intestinal Content, and Organs
2.4. Determination of Serum Antioxidant Indexes
2.5. RNA Extraction and Quantitative Reverse Transcription-Polymerase Chain Reaction
2.6. Intestinal Morphology Evaluation
2.7. Statistical Analysis
3. Results
3.1. Growth Performance
3.2. Serum Antioxidant Profiles
3.3. Expression of Selected Antioxidant Genes
3.4. Selected Tight Junction (TJ) Gene Expression
3.5. Intestinal Morphology
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
WB | Wheat bran |
FL | L. sulphureus fermented product |
TJ | Tight junction |
NSPs | Non-starch polysaccharides |
MEB | Malt extract broth |
MEA | Malt extract agar |
RT | Room temperature |
DPPH | 1,1-diphenyl-2-picrylhydrazyl |
BHT | Butylated hydroxytoluene |
chPBMC | Chicken peripheral blood mononuclear cells |
AAPH | 2,2′-Azobis (2-amidinopropane) dihydrochloride |
LPS | Lipopolysaccharide |
FCR | Feed conversion ratio |
SOD | Superoxide dismutase |
CAT | Catalase |
MDA | Malondialdehyde |
GPx | Glutathionine peroxidase |
GSH | Glutathione |
GSSG | Glutathione disulfide |
HO-1 | Heme oxygenase -1 |
Nrf2 | Nuclear factor (erythroid-derived 2)-like 2 |
CAT | Catalase |
GPx | Glutathione peroxidase |
ZO-1 | Zonula occludens-1 |
CLDN-1 | Claudin-1 |
MUC-2 | Mucin-2 |
OCLN | Occludin |
References
- Giannenas, I.; Pappas, I.S.; Mavridis, S.; Kontopidis, G.; Skoufos, J.; Kyriazakis, I. Performance and antioxidant status of broiler chickens supplemented with dried mushrooms (Agaricus bisporus) in their diet. Poult. Sci. 2010, 89, 303–311. [Google Scholar] [CrossRef]
- Sahin, K.; Orhan, C.; Smith, M.; Sahin, N. Molecular targets of dietary phytochemicals for the alleviation of heat stress in poultry. World’s Poult. Sci. J. 2013, 69, 113–124. [Google Scholar] [CrossRef] [Green Version]
- Zaviezo, R. Nutritional management of birds affected by heat. Rev. Indust. Avi. 1999, 46, 42–46. [Google Scholar]
- Tellez, G., Jr.; Tellez-Isaias, G.; Dridi, S. Heat stress and gut health in broilers: Role of tight junction proteins. Adv. Food Technol. Nutr. Sci. Open J. 2017, 3, e1–e4. [Google Scholar]
- Johansson, M.E.V.; Sjövall, H.; Hansson, G.C. The gastrointestinal mucus system in health and disease. Nat. Rev. Gastroenterol. Hepatol. 2013, 10, 352–361. [Google Scholar] [CrossRef] [Green Version]
- Robinson, K.; Deng, Z.; Hou, Y.; Zhang, G. Regulation of the intestinal barrier function by host defense peptides. Front. Vet. Sci. 2015, 2, 57. [Google Scholar] [CrossRef]
- Mujahid, A.; Pumford, N.R.; Bottje, W.; Nakagawa, K.; Miyazawa, T.; Akiba, Y.; Toyomizu, M. Mitochondrial Oxidative Damage in Chicken Skeletal Muscle Induced by Acute Heat Stress. J. Poult. Sci. 2007, 44, 439–445. [Google Scholar] [CrossRef] [Green Version]
- Lai, L.P.; Lee, M.T.; Chen, C.S.; Yu, B.; Lee, T.-T. Effects of co-fermented Pleurotus eryngii stalk residues and soybean hulls by Aureobasidium pullulans on performance and intestinal morphology in broiler chickens. Poult. Sci. 2015, 94, 2959–2969. [Google Scholar] [CrossRef]
- Chen, L.; Feng, L.; Jiang, W.-D.; Jiang, J.; Wu, P.; Zhao, J.; Kuang, S.-Y.; Tang, L.; Tang, W.-N.; Zhang, Y.-A.; et al. Dietary riboflavin deficiency decreases immunity and antioxidant capacity, and changes tight junction proteins and related signaling molecules mRNA expression in the gills of young grass carp (Ctenopharyngodon idella). Fish. Shellfish Immunol. 2015, 45, 307–320. [Google Scholar] [CrossRef]
- Hölker, U.; Höfer, M.; Lenz, J. Biotechnological advances of laboratory-scale solid-state fermentation with fungi. Appl. Microbiol. Biotechnol. 2004, 64, 175–186. [Google Scholar] [CrossRef]
- Lee, M.T.; Lin, W.C.; Lin, L.-J.; Wang, S.Y.; Chang, S.C.; Lee, T.-T. Effects of dietary Antrodia cinnamomea fermented product supplementation on antioxidation, anti-inflammation, and lipid metabolism in broiler chickens. Asian-Australas. J. Anim. Sci. 2020, 33, 1113–1125. [Google Scholar] [CrossRef] [PubMed]
- Hernández, J.S.; Aguilera-Carbó, A.F.; Rodríguez Herrera, R.; Martínez, J.L.; Aguilar, C.N. Kinetic production of the anti-oxidant ellagic acid by fungal solid state culture. In Proceedings of the 10th International Chemical and Biological Engineering Conference; Portuguese Engineers Association: Lisboa, Portugal, 2008; pp. 1849–1854. [Google Scholar]
- Chu, Y.T.; Lo, C.T.; Chang, S.C.; Lee, T.T. Effects of Trichoderma fermented wheat bran on growth performance, intestinal morphology and histological findings in broiler chickens. Ital. J. Anim. Sci. 2016, 16, 82–92. [Google Scholar] [CrossRef] [Green Version]
- Lin, W.C.; Lee, M.T.; Lo, C.T.; Chang, S.C.; Lee, T.-T. Effects of dietary supplementation of Trichoderma pseudokoningii fermented enzyme powder on growth performance, intestinal morphology, microflora and serum antioxidantive status in broiler chickens. Ital. J. Anim. Sci. 2017, 17, 153–164. [Google Scholar] [CrossRef] [Green Version]
- Lee, M.T.; Lin, W.C.; Lin, L.-J.; Wang, S.Y.; Chang, S.C.; Lee, T.-T. Effects of dietary Antrodia cinnamomea fermented product supplementation on metabolism pathways of antioxidant, inflammatory, and lipid metabolism pathways-a potential crosstalk. Asian-Australas. J. Anim. Sci. 2020, 33, 1167–1179. [Google Scholar] [CrossRef]
- Ríos, J.-L.; Andújar, I.; Recio, M.-C.; Giner, R.-M. Lanostanoids from Fungi: A Group of Potential Anticancer Compounds. J. Nat. Prod. 2012, 75, 2016–2044. [Google Scholar] [CrossRef]
- Lin, W.; Lee, T.-T. Laetiporus sulphureus–fermented wheat bran enhanced the broiler growth performance by improving the intestinal microflora and inflammation status. Poult. Sci. 2020, 99, 3606–3616. [Google Scholar] [CrossRef]
- Lung, M.Y.; Wei, Z.H. Production, purification and tumor necrosis factor-α (TNF-α) release capability of exopolysaccharide from Laetiporus sulphureus (Bulliard: Fries) Bondartsev & Singer in submerged cultures. Proc. Biochem. 2011, 46, 433–439. [Google Scholar]
- Jayasooriya, R.G.; Kang, C.H.; Seo, M.J.; Choi, Y.H.; Jeong, Y.K.; Kim, G.Y. Exopolysaccharide of Laetiporus sulphureus var. miniatus downregulates LPS-induced production of NO, PGE₂, and TNF-α in BV2 microglia cells via suppression of the NF-κB pathway. Food Chem. Toxicol. 2011, 49, 2758–2764. [Google Scholar] [CrossRef]
- Fan, Q.Y.; Yin, X.; Li, Z.H.; Li, Y.; Liu, J.K.; Feng, T.; Zhao, B.H. Mycophenolic acid derivatives from cultures of the mushroom Laetiporus sulphureus. Chin. J. Nat. Med. 2014, 12, 685–688. [Google Scholar]
- Saba, E.; Son, Y.; Jeon, B.R.; Kim, S.-E.; Lee, I.-K.; Yun, B.-S.; Rhee, M.H. Acetyl Eburicoic Acid from Laetiporus sulphureus var. miniatus Suppresses Inflammation in Murine Macrophage RAW 264.7 Cells. Mycobiology 2015, 43, 131–136. [Google Scholar] [CrossRef] [Green Version]
- Wang, J.; Zhang, P.; He, H.; Se, X.; Sun, W.; Chen, B.; Zhang, L.; Yan, X.; Zou, K. Eburicoic acid from Laetiporus sulphureus (Bull.:Fr.) Murrill attenuates inflammatory responses through inhibiting LPS-induced activation of PI3K/Akt/mTOR/NF-κB pathways in RAW264.7 cells. Naunyn-Schmiedeberg’s Arch. Pharmacol. 2017, 390, 845–856. [Google Scholar]
- Petrović, J.; Glamočlija, J.; Stojković, D.S.; Ćirić, A.; Nikolić, M.; Bukvicki, D.; Guerzoni, M.E.; Soković, M.D. Laetiporus sulphureus, edible mushroom from Serbia: Investigation on volatile compounds, in vitro antimicrobial activity and in situ control of Aspergillus flavus in tomato paste. Food Chem. Toxicol. 2013, 59, 297–302. [Google Scholar] [CrossRef]
- Lin, W.C.; Lee, M.T.; Lin, L.J.; Chang, S.C.; Lee, T.T. Immunomodulation properties of solid-state fermented Laetiporus sul-phureus ethanol extracts in chicken peripheral blood monocytes in vitro. Braz. J. Poult. Sci. 2019, 21, 1–10. [Google Scholar] [CrossRef] [Green Version]
- NRC (National Research Council). Nutrient Requirements of Poultry, 9th Revised ed.; The National Academies Press: Washington, DC, USA, 1994. [Google Scholar]
- AOAC—Association of Official Analytical Chemists. Official Methods of Analysis of the Association of the Analytical Chemists; AOAC: Rockville, VA, USA, 2016. [Google Scholar]
- Wheeler, C.R.; Salzman, J.A.; Elsayed, N.M.; Omaye, S.T.; Korte, W., Jr. Automated assays for superoxide dismutase, catalase, glutathione peroxidase, and glutathione reductase activity. Anal. Biochem. 1990, 184, 193–199. [Google Scholar] [CrossRef]
- Yagi, K. Simple Assay for the Level of Total Lipid Peroxides in Serum or Plasma. Free Radic. Antioxid. Protoc. 2003, 108, 101–106. [Google Scholar] [CrossRef]
- Paglia, D.E.; Valentine, W.N. Studies on the quantitative and qualitative characterization of erythrocyte glutathione perox-idase. J. Lab. Clin. Med. 1967, 70, 158–169. [Google Scholar]
- Baker, M.A.; Cerniglia, G.J.; Zaman, A. Microtiter plate assay for the measurement of glutathione and glutathione disulfide in large numbers of biological samples. Anal. Biochem. 1990, 190, 360–365. [Google Scholar] [CrossRef]
- Lin, C.C.; Lin, L.J.; Wang, S.D.; Chiang, C.J.; Chao, Y.P.; Lin, J.; Kao, S.T. The effect of serine protease inhibitors on airway inflammation in a chronic allergen-Induced asthma mouse model. Mediat. Inflamm. 2014, 2014, 879326. [Google Scholar] [CrossRef]
- McMahon, M.; Thomas, N.; Itoh, K.; Yamamoto, M.; Hayes, J.D. Dimerization of substrate adaptors can facilitate cul-lin-mediated ubiquitylation of proteins by a “tethering” mechanism: A two-site interaction model for the Nrf2-Keap1 complex. J. Biol. Chem. 2006, 281, 24756–24768. [Google Scholar] [CrossRef] [Green Version]
- Calabrese, V.; Butterfield, D.A.; Scapagnini, G.; Stella, A.G.; Maines, M.D. Redox Regulation of Heat Shock Protein Expression by Signaling Involving Nitric Oxide and Carbon Monoxide: Relevance to Brain Aging, Neurodegenerative Disorders, and Longevity. Antioxid. Redox Signal. 2006, 8, 444–477. [Google Scholar] [CrossRef]
- Arellano-Buendía, A.S.; Tostado-González, M.; García-Arroyo, F.E.; Cristóbal-García, M.; Loredo-Mendoza, M.L.; Tapia, E.; Sánchez-Lozada, L.G.; Osorio-Alonso, H. Anti-Inflammatory Therapy Modulates Nrf2-Keap1 in Kidney from Rats with Diabetes. Oxidative Med. Cell. Longev. 2016, 2016, 1–11. [Google Scholar] [CrossRef] [Green Version]
- Lin, W.C.; Lee, M.T.; Chang, Y.L.; Shih, C.H.; Chang, S.C.; Yu, B.; Lee, T.T. Effects of mulberry leaves on production per-formance and the potential modulation of antioxidative status in laying hens. Poult. Sci. 2017, 96, 1191–1203. [Google Scholar] [CrossRef] [PubMed]
- Sumida, S.; Tanaka, K.; Kitao, H.; Nakadomo, F. Exercise-induced lipid peroxidation and leakage of enzymes before and after vitamin E supplementation. Int. J. Biochem. 1989, 21, 835–838. [Google Scholar]
- Cardona, F.; Lacueva, M.C.A.; Tulipani, S.; Tinahones, F.J.; Queipo-Ortuño, M.I. Benefits of polyphenols on gut microbiota and implications in human health. J. Nutr. Biochem. 2013, 24, 1415–1422. [Google Scholar] [CrossRef] [Green Version]
- Turner, J.R. Intestinal mucosal barrier function in health and disease. Nat. Rev. Immunol. 2009, 9, 799–809. [Google Scholar] [CrossRef]
- Parlato, M.; Yeretssian, G. NOD-Like Receptors in Intestinal Homeostasis and Epithelial Tissue Repair. Int. J. Mol. Sci. 2014, 15, 9594–9627. [Google Scholar] [CrossRef] [Green Version]
- Heazlewood, C.K.; Cook, M.C.; Eri, R.; Price, G.R.; Tauro, S.B.; Taupin, D.; Thornton, D.J.; Png, C.W.; Crockford, T.L.; Cornall, R.J.; et al. Aberrant Mucin Assembly in Mice Causes Endoplasmic Reticulum Stress and Spontaneous Inflammation Resembling Ulcerative Colitis. PLoS Med. 2008, 5, e54. [Google Scholar] [CrossRef] [Green Version]
- Zhao, Z.; Qu, W.; Wang, K.; Chen, S.; Zhang, L.; Wu, D.; Chen, Z. Bisphenol A inhibits mucin 2 secretion in intestinal goblet cells through mitochondrial dysfunction and oxidative stress. Biomed. Pharmacother. 2019, 111, 901–908. [Google Scholar] [CrossRef]
- Kurutas, E.B. The importance of antioxidants which play the role in cellular response against oxidative/nitrosative stress: Current state. Nutr. J. 2015, 15, 1–22. [Google Scholar] [CrossRef] [Green Version]
- Sun, K.; Lei, Y.; Wang, R.; Wu, Z.; Wu, G. Cinnamicaldehyde regulates the expression of tight junction proteins and amino acid transporters in intestinal porcine epithelial cells. J. Anim. Sci. Biotechnol. 2017, 8, 1–8. [Google Scholar] [CrossRef] [Green Version]
- Osho, S.; Adeola, O. Chitosan oligosaccharide supplementation alleviates stress stimulated by in-feed dexamethasone in broiler chickens. Poult. Sci. 2020, 99, 2061–2067. [Google Scholar] [CrossRef] [PubMed]
- Damiano, S.; Sasso, A.; De Felice, B.; Di Gregorio, I.; La Rosa, G.; Lupoli, G.A.; Belfiore, A.; Mondola, P.; Santillo, M. Quercetin Increases MUC2 and MUC5AC Gene Expression and Secretion in Intestinal Goblet Cell-Like LS174T via PLC/PKCα/ERK1-2 Pathway. Front. Physiol. 2018, 9, 357. [Google Scholar] [CrossRef] [Green Version]
- Xu, Z.R.; Hu, C.H.; Xia, M.S.; Zhan, A.X.; Wang, M.Q. Effects of dietary fructooligosaccharide on digestive enzyme activities, intestinal microflora and morphology of male broilers. Poult. Sci. 2003, 82, 1030–1036. [Google Scholar] [CrossRef] [PubMed]
- Parsaie, S.; Shariatmadari, F.; Zamiri, M.; Khajeh, K. Influence of wheat-based diets supplemented with xylanase, bile acid and antibiotics on performance, digestive tract measurements and gut morphology of broilers compared with a maize-based diet. Br. Poult. Sci. 2007, 48, 594–600. [Google Scholar] [CrossRef] [PubMed]
- Viveros, A.; Chamorro, S.; Pizarro, M.; Arija, I.; Brenes, A. Effects of dietary polyphenol-rich grape productson intestinal microflora and gut morphology in broiler chicks. Poult. Sci. 2011, 90, 566–578. [Google Scholar] [CrossRef] [PubMed]
Ingredients | Starter Phase (Days 1–21) | ||||
---|---|---|---|---|---|
Control | 5% WB | 5% FL | 10% WB | 10% FL | |
g/kg | |||||
Corn | 524.9 | 458.7 | 458.4 | 392.5 | 391.9 |
WB | 0 | 50.0 | 0 | 100.0 | 0 |
FL | 0 | 0 | 50.0 | 0 | 100.0 |
Soybean meal, CP 44% | 320.0 | 167.3 | 167.3 | 14.8 | 14.7 |
Fish meal, CP 60% | 50.0 | 50.0 | 50.0 | 50.0 | 50.0 |
Full fat soybean meal | 41.4 | 209.8 | 210.1 | 377.9 | 378.7 |
Soybean oil | 30.0 | 30.0 | 30.0 | 30.0 | 30.0 |
Limestone | 11.6 | 11.6 | 11.6 | 11.5 | 11.5 |
Monocalcium phosphate | 11.2 | 11.2 | 11.2 | 11.2 | 11.2 |
DL-Methionine | 3.4 | 3.7 | 3.7 | 4.1 | 4.1 |
Sodium chloride | 2.9 | 2.8 | 2.8 | 2.8 | 2.8 |
L-Lysine HCl | 1.8 | 2.1 | 2.1 | 2.4 | 2.3 |
Choline-Cl (60%) | 0.8 | 0.8 | 0.8 | 0.8 | 0.8 |
Vitamin premix 1 | 1.0 | 1.0 | 1.0 | 1.0 | 1.0 |
Mineral premix 2 | 1.0 | 1.0 | 1.0 | 1.0 | 1.0 |
Total | 1000.0 | 1000.0 | 1000.0 | 1000.0 | 1000.0 |
Calculated nutrient value | |||||
ME, kcal/kg | 3050.0 | 3050.0 | 3050.0 | 3050.0 | 3050.0 |
Dry matter, % | 88.28 | 88.85 | 89.11 | 89.42 | 89.95 |
Crude protein, % | 23.0 | 23.0 | 23.0 | 23.0 | 23.0 |
Crude fat, % | 6.04 | 8.86 | 8.64 | 11.68 | 11.25 |
Calcium, % | 1.05 | 1.05 | 1.05 | 1.05 | 1.05 |
Total phosphorus, % | 0.73 | 0.73 | 0.73 | 0.72 | 0.72 |
Available phosphorus, % | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 |
Lysine, % | 1.43 | 1.43 | 1.43 | 1.43 | 1.43 |
Methionine, % | 0.73 | 0.74 | 0.74 | 0.76 | 0.76 |
Cysteine, % | 0.34 | 0.32 | 0.32 | 0.31 | 0.31 |
Ingredients | Finisher Phase (Days 22–35) | ||||
---|---|---|---|---|---|
Control | 5% WB | 5% FL | 10% WB | 10% FL | |
g/kg | |||||
Corn | 549.5 | 482.9 | 482.9 | 416.3 | 416.3 |
WB | 0 | 50.0 | 0 | 100.0 | 0 |
FL | 0 | 0 | 50.0 | 0 | 100.0 |
Soybean meal, CP 44% | 16.6 | 185.6 | 185.6 | 354.4 | 354.4 |
Fish meal, CP 60% | 320.6 | 167.8 | 167.8 | 15.1 | 15.1 |
Full fat soybean meal | 30.0 | 30.0 | 30.0 | 30.0 | 30.0 |
Soybean oil | 10.6 | 10.6 | 10.6 | 10.6 | 10.6 |
Limestone | 12.2 | 12.2 | 12.2 | 12.2 | 12.2 |
Monocalcium phosphate | 3.4 | 3.3 | 3.3 | 3.2 | 3.2 |
DL-Methionine | 50.0 | 50.0 | 50.0 | 50.0 | 50.0 |
Sodium chloride | 1.3 | 1.5 | 1.5 | 1.8 | 1.8 |
L-Lysine HCl | 3.0 | 3.3 | 3.3 | 3.6 | 3.6 |
Choline-Cl (60%) | 0.8 | 0.8 | 0.8 | 0.8 | 0.8 |
Vitamin premix 1 | 1.0 | 1.0 | 1.0 | 1.0 | 1.0 |
Mineral premix 2 | 1.0 | 1.0 | 1.0 | 1.0 | 1.0 |
Total | 1000.0 | 1000.0 | 1000.0 | 1000.0 | 1000.0 |
Calculated nutrient value | |||||
ME, kcal/kg | 3175.0 | 3175.0 | 3175.0 | 3175.0 | 3175.0 |
Dry matter, % | 88.31 | 88.88 | 89.15 | 89.45 | 89.98 |
Crude protein, % | 21.0 | 21.0 | 21.0 | 21.0 | 21.0 |
Crude fat, % | 7.56 | 10.39 | 10.17 | 13.22 | 12.78 |
Calcium, % | 0.90 | 0.90 | 0.90 | 0.90 | 0.90 |
Total phosphorus, % | 0.68 | 0.67 | 0.67 | 0.67 | 0.67 |
Available phosphorus, % | 0.45 | 0.45 | 0.45 | 0.45 | 0.45 |
Lysine, % | 1.25 | 1.25 | 1.25 | 1.25 | 1.25 |
Methionine, % | 0.65 | 0.66 | 0.66 | 0.67 | 0.67 |
Cysteine, % | 0.31 | 0.30 | 0.30 | 0.29 | 0.29 |
Genes | Forward Primer (from 5′ to 3′) | NCBI GenBank |
---|---|---|
Reverse Primer (from 5′ to 3′) | ||
β-actin | CTGGCACCTAGCACAATGAA | X00182.1 |
ACATCTGCTGGAAGGTGGAC | ||
HO-1 | AGCTTCGCACAAGGAGTGTT | X56201.1 |
GGAGAGGTGGTCAGCATGTC | ||
SOD | GCCACCTACGTGAACAACCT | NM_204211.1 |
AGTCACGTTTGATGGCTTCC | ||
Nrf2 | GGAAGAAGGTGCTTTTCGGAGC | NM_205117.1 |
GGGCAAGGCAGATCTCTTCCAA | ||
CAT | CCACGTGGACCTCTTCTTGT | NM_001031215.1 |
AAACACTTTCGCCTTGCAGT | ||
GPx | CAGCAAGAACCAGACACCAA | NM_001163245.1 |
CCAGGTTGGTTCTTCTCCAG | ||
ZO-1 | AGGTGAAGTGTTTCGGGTTG | XM_015278975.1 |
CCTCCTGCTGTCTTTGGAAG | ||
CLDN-1 | GGAGGATGACCAGGTGAAGA | NM_001013611.2 |
TCTGGTGTTAACGGGTGTGA | ||
MUC-2 | GCTACAGGATCTGCCTTTGC | NM_001318434.1 |
AATGGGCCCTCTGAGTTTTT | ||
OCLN | GTCTGTGGGTTCCTCATCGT | NM_205128.1 |
GTTCTTCACCCACTCCTCCA |
Items | Treatments | SEM | p-Values | ||||
---|---|---|---|---|---|---|---|
Control | 5% WB | 10% WB | 5% FL | 10% FL | |||
SOD (U/mL) | 9.18 bc | 9.36 b | 8.96 c | 9.82 a | 9.40 b | 0.05 | 0.001 |
CAT (U/mL) | 15.35 | 15.82 | 15.57 | 15.81 | 15.53 | 0.11 | 0.86 |
MDA (μM) | 28.52 a | 25.76 b | 29.66 a | 23.53 c | 24.17 bc | 0.21 | <0.0001 |
GPx (U/mL) | 146.42 ab | 148.14 a | 141.51 b | 151.66 a | 151.13 a | 0.84 | 0.005 |
GSH (mg/mL) | 2.01 | 2.17 | 2.13 | 2.21 | 2.19 | 0.04 | 0.71 |
GSSG (mg/mL) | 0.11 | 0.12 | 0.14 | 0.13 | 0.11 | 0.005 | 0.72 |
GSH:GSSG | 20.65 | 19.14 | 16.52 | 21.08 | 21.71 | 0.65 | 0.51 |
Items | Treatments | SEM | p-Values | ||||
---|---|---|---|---|---|---|---|
Control | 5% WB | 10% WB | 5% FL | 10% FL | |||
Jejunum | |||||||
Villus height (μm) | 1210.72 bc | 1207.34 bc | 1157.55 c | 1325.91 a | 1255.74 ab | 10.29 | 0.001 |
Crypt depth | 270.72 a | 203.38 c | 216.52 bc | 244.50 ab | 212.41 bc | 5.28 | 0.002 |
Villi:crypt ratio | 5.10 | 5.98 | 5.52 | 5.78 | 5.96 | 0.12 | 0.16 |
Ileum | |||||||
Villus height | 1058.68 b | 1118.71 b | 1032.24 b | 1126.53 a | 113047 a | 8.10 | 0.04 |
Crypt depth | 198.27 a | 190.01 ab | 188.03 ab | 178.80 ab | 170.71 b | 2.23 | 0.04 |
Villi:crypt ratio | 5.98 b | 5.99 b | 5.51 b | 6.50 a | 6.24 a | 0.07 | 0.03 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lin, W.C.; Lee, T.T. The Laetiporus sulphureus Fermented Product Enhances the Antioxidant Status, Intestinal Tight Junction, and Morphology of Broiler Chickens. Animals 2021, 11, 149. https://doi.org/10.3390/ani11010149
Lin WC, Lee TT. The Laetiporus sulphureus Fermented Product Enhances the Antioxidant Status, Intestinal Tight Junction, and Morphology of Broiler Chickens. Animals. 2021; 11(1):149. https://doi.org/10.3390/ani11010149
Chicago/Turabian StyleLin, Wei Chih, and Tzu Tai Lee. 2021. "The Laetiporus sulphureus Fermented Product Enhances the Antioxidant Status, Intestinal Tight Junction, and Morphology of Broiler Chickens" Animals 11, no. 1: 149. https://doi.org/10.3390/ani11010149
APA StyleLin, W. C., & Lee, T. T. (2021). The Laetiporus sulphureus Fermented Product Enhances the Antioxidant Status, Intestinal Tight Junction, and Morphology of Broiler Chickens. Animals, 11(1), 149. https://doi.org/10.3390/ani11010149