Dynamics of the Inbreeding Coefficient and Homozygosity in Thoroughbred Horses in Russia
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection, Genomic DNA Isolation, and Inbreeding Recording
2.2. PCR Amplification and Genotyping Microsatellite Loci
2.3. Statistical Analyses
3. Results
Association between the Inbreeding Coefficient and Level of the Heterozygosity
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Edwards, E.H. The Ultimate Horse Book; Dorling Kindersley Ltd.: London, UK, 1991; pp. 34–35. [Google Scholar]
- Budyonny, C.M. The Thoroughbred horse. In The Book about the Horse; Selkhozgiz: Moskow, Russia, 1952; Volume 1, pp. 383–412. [Google Scholar]
- Barmintsev, Y.N. Horse Breeding and Equestrian Sport the USSR; Kolos: Moscow, Russia, 1972; pp. 41–43. [Google Scholar]
- Cunningham, E.P.; Dooley, J.J.; Splan, R.K.; Bradley, D.G. Microsatellite diversity, pedigree relatedness and the contributions of founder lineages to thoroughbred horses. Anim. Genet. 2001, 32, 360–364. [Google Scholar] [CrossRef] [PubMed]
- Binns, M.M.; Boehler, D.A.; Bailey, E.; Lear, T.L.; Cardwell, G.M.; Lambert, D.H. Inbreeding in the Thoroughbred horse. Anim. Genet. 2012, 43, 340–342. [Google Scholar] [CrossRef] [PubMed]
- Schaefer, R.J.; Schubert, M.; Bailey, E.; Bannasch, D.L.; Barrey, E.; Bar-Gal, G.K.; Brem, G.; Brooks, S.A.; Distl, O.; Fries, R.; et al. Developing a 670k genotyping array to tag ~2M SNPs across 24 horse breed. BMC Genom. 2017, 18, 565. [Google Scholar] [CrossRef] [PubMed]
- Kuznetsov, V.M. Inbreeding in Livestock: Methods of Assessment and Forecast; NIISH of the North-East: Kirov, Russia, 2000; pp. 33–43. [Google Scholar]
- Nicholas, F.M. Introduction to Veterinary Genetics, 2nd ed.; Blackwell Publishing: Hoboken, NJ, USA; Oxford University Press: Oxford, UK, 2008; pp. 183–189. [Google Scholar]
- Pern, E.M. The role of inbreeding in the improvement of horse and trotter breeds of horses. In The Use of Inbreeding in Animal Husbandry; Nauka: Moscow, Russia, 1977; pp. 46–52. [Google Scholar]
- Sørensen, M.K.; Sørensen, A.C.; Baumung, R.; Borchersen, S.; Berg, P. Optimal genetic contribution selection in Danish Holstein depends on pedigree quality. Livest. Sci. 2008, 118, 212–222. [Google Scholar] [CrossRef]
- FAO Molecular tool for exploring genetic diversity. In The Second Report on the State of the World’s Animal Genetic Recourses for Food and Agriculture Organization of the United Nations; Scherf, B.D., Pilling, D., Eds.; FAO Commission on Genetic Resources for Food and Agriculture Assessments: Rome, Italy, 2015; pp. 431–449. Available online: http://www.fao.org/3/a-i4787e.pdf (accessed on 15 December 2016).
- Canon, J.; Checa, M.L.; Carleos, C.; Vega-Pla, J.L.; Vallejo, M.; Dunner, S. The genetic structure of Spanish Celtic horse breeds inferred from microsatrllite data. Anim. Genet. 2000, 31, 39–48. [Google Scholar] [CrossRef]
- Kalashnikov, V.V.; Khrabrova, L.A.; Zaitcev, A.M.; Zaitceva, M.A.; Kalinkova, L.V. Polymorphism of microsatellite DNA in horses of stud and local breeds. Agric. Biol. 2011, 2, 41–45. [Google Scholar]
- Ling, Y.H.; Guan, W.J.; Cheng, Y.J.; Wang, Y.P.; Han, J.L.; Mang, L.; Zhao, Q.J.; He, X.H.; Pu, Y.B.; Fu, B.L. Evaluation of the genetic diversity and population structure of Chinese indigenous horse breeds using 27 microsatellite loci. Anim. Genet. 2011, 42, 56–63. [Google Scholar] [CrossRef]
- Putnova, L.; Stohl, R.; Vrtkova, I. Genetic monitoring of horses in the Czech Republic: A large scale study with a focus on the Czech autochthonous breeds. J. Anim. Breed. Genet. 2018, 135, 73–83. [Google Scholar] [CrossRef]
- Cosenza, M.; La Rosa, V.; Rosati, R.; Chiofalo, V. Genetic diversity of the Italian thoroughbred horse population. Ital. J. Anim. Sci. 2019, 1, 538–545. [Google Scholar] [CrossRef]
- Curik, I.; Zechner, P.; Solkner, J.; Achmann, R.; Bodo, I.; Dovc, P.; Kavar, T.; Marti, E.; Brem, G. Inbreeding, microsatellite heterozygosity and morphological traits in Lipizzan horses. J. Hered. 2003, 94, 125–132. [Google Scholar] [CrossRef]
- Khrabrova, L.A.; Blochina, N.V.; Ustiantseva, A.V. Inbreeding and the level of homozygosis of microsatellite loci in horses (Equus caballus) of Orlov Trotter breed. Agric. Biol. 2014, 49, 35–41. [Google Scholar] [CrossRef]
- Langlois, B. A review on the methods of parentage and inbreeding analysis with molecular markers. In Conservation Genetics of Endangered Horse Breeds; EAAP Publication: Bled, Slovenia, 2005; Volume 116, pp. 35–54. [Google Scholar]
- Pirault, P.; Danvy, S.; Verrier, E.; Leroy, G. Genetic structure and gene flows within horses: A genealogical study at the Franch population scale. PLoS ONE 2013, 8, 615448. [Google Scholar] [CrossRef] [PubMed]
- Khrabrova, L.A. Monitoring of the genetic structure of breeds in horse breeding. Rus. Agric. Sci. 2008, 34, 261–263. [Google Scholar] [CrossRef]
- Khrabrova, L.A.; Blohina, N.V.; Suleymanov, O.I.; Rozhdestvenskaya, G.A.; Pustovoy, V.F. Assessment of line differentiation in the Thoroughbred horsebreed using DNA microsatellite loci. Vavilov J. Genet. Breed. 2019, 23, 569–574. [Google Scholar] [CrossRef]
- Van de Goor, L.H.P.; Panneman, H.; Van Haeringen, W.A. A proposal for standardization in forensic equine DNA typing: Allele nomenclature for 17 equine-specific STR loci. Anim. Genet. 2010, 41, 122–127. [Google Scholar] [CrossRef]
- Weir, B.S. Genetic Data Analysis II; Sinauer Associates: Sunderland, MA, USA, 1996. [Google Scholar]
- Khrabrova, L.A. Theoretical and Practical Aspects of Genetic Monitoring in Horse Breeding; ARRIH: Divovo, Russia, 2011; pp. 29–30. [Google Scholar]
- Rukavina, D.; Hasanbasic, D.; Ramic, J.; Zahirovic, A.; Ajanovic, A.; Beganovic, K.; Durnic-Pasic, A.; Kalamujic, B.; Pojskic, N. Genetic diversity of Thoroughbred horse population from Bosnia and Herzegovina based on 17 microsatellite markers. Jpn. J. Vet. Res. 2016, 64, 215–220. [Google Scholar]
- Jungwoo, E.; Jeong-An, G.; Bong-Hwan, C.; Kfoals-Tag, D.; Byung-Wook, C.; Heui-Soo, K. Genetic profiling of Thoroughbred racehorses by microsatellite marker analysis. Genes Genom. 2014, 36, 119–123. [Google Scholar]
- Shelyov, A.V.; Melnyk, O.V.; Suprun, I.O.; Spyrydonov, S.V.; Melnychuk, S.D.; Dzitsiuk, V.V.; Gorka, B.M. The comparative analysis of the allele pool of Thoroughbred horses in different countries. Iran. J. Appl. Anim. Sci. 2014, 4, 637–641. [Google Scholar]
- Khrabrova, L.A.; Blohina, N.V. Genetic monitoring of the Thoroughbred breed on loci of DNA microsatellite. J. Genet. Breed. Anim. 2018, 3, 11–16. [Google Scholar] [CrossRef]
- Levontin, R.C. The Genetic Basis of Evolutionary Change; Mir: Moscow, Russia, 1978; p. 351. [Google Scholar]
- Altukhov, Y.P. Genetic Processes in Populations; Mir: Moscow, Russia, 2003; p. 247. [Google Scholar]
- Blochina, N.V.; Khrabrova, L.A. Characteristics of Thoroughbred stallions of different lines by microsatellite loci. Genet. Sel. Anim. 2019, 3, 11–17. [Google Scholar] [CrossRef]
- Todd, E.T.; Ho, S.W.; Thomson, P.C.; And, R.A.; Velie, B.D.; Hamiton, N.A. Founder-specific inbreeding depression affects racing performance in Thoroughbred horses. Sci. Rep. 2018, 8, 6167. [Google Scholar] [CrossRef] [PubMed]

| Locus | No. of Alleles | Chromosome Location | Amplicon Length (bp) | Primer Sequences (5′–3′) | Reference |
|---|---|---|---|---|---|
| AHT4 | 11 | 24 | 140–166 | F: AACCGCCTGAGCAAGGAAGT R: CCCAGAGAGTTTACCCT | Binns et al., 1995 [5] |
| AHT5 | 9 | 8 | 126–147 | F: ACGGACACATCCCTGCCTGC R: GCAGGCTAAGGGGGCTCAGC | Binns et al., 1995 |
| ASB2 | 15 | 15 | 237–268 | F: CCTTCCGTAGTTTAAGCTTCTG R: CACAACTGAGTTCTCTGATAGG | Breen et al., 1997 |
| ASB17 | 19 | 2 | 104–116 | F: GAGGGCGGTACCTTTGTACC R: ACCAGTCAGGATCTCCACCG | Breen et al., 1995 |
| ASB23 | 14 | 3 | 176–212 | F: GAGGTTTGTAATTGGAATG R: GAGAAGTCATTTTTAACACCT | Breen et al., 1995 |
| CA425 | 11 | 28 | 224–247 | F: AGCTGCCTCGTTAATTCA R: CTCATGTCCGCTTGTCTC | Der Valle A. et al., 1997 |
| HMS1 | 7 | 15 | 166–178 | F: CATCACTCTTCATGTCTGCTTGG R: TTGACATAAATGCTTATCCTATGGC | Guerin et al., 1994 |
| HMS2 | 12 | 10 | 218–238/ | F: ACGGTGGCAACTGCCAAGGAAG R: CTTGCAGTCGAATGTGTATTAAATG | Guerin et al., 1994 |
| HMS3 | 10 | 9 | 146–170 | F: CCAACTCTTTGTCACATAACAAGA R: CCATCCTCACTTTTTCACTTTGTT | Guerin et al., 1994 |
| HMS6 | 7 | 4 | 154–170 | F: GAAGCTGCCAGTATTCAACCATTG R: CTCCATCTTGTGAAGTGTAACTCA | Guerin et al., 1994 |
| HMS7 | 9 | 1 | 167–186 | F: CAGGAAACTCATGTTGATACCATC R: GTTGTTGAAACATACCTTGACTGT | Guerin et al., 1994 |
| HTG4 | 7 | 9 | 116–137 | F: CTATCTCAGTCTTCATTGCAGGAC R: CTCCCTCCCTCCCTCTGTTCTC | Ellegren et.al, 1992 |
| HTG6 | 9 | 1 | 73–103 | F: CCTGCTTGGAGGCTGTGATAAGAT R: GTTCACTGAATGTCAAATTCTGCT | Ellegren et.al, 1992 |
| HTG7 | 5 | 4 | 114–126 | F: CCTGAAGCAGAACATCCCTCCTTG R: TAAAGTGTCTGGGCAGAGCTGCT | Marklund et al., 1994 |
| HTG10 | 13 | 21 | 83–105 | F: CAATTCCCGCCCCACCCCCGGCA R: TTTTTATTCTGATCTGTCACATTT | Marklund et al., 1994 |
| LEX3 | 12 | Xq | 137–160 | F: ACATCTAACCAGTGCTGAGACT R: AAGGAAAAAAAGGAGGAAGAC | Coogle L.et al, 1996 |
| VHL20 | 10 | 30 | 83–102 | F: CAAGTCCTCTTACTTGAAGACTAG R: AACTCAGGGAGAATCTTCCTCAG | Van Haeringen et al., 1994 |
| Locus | First Period (1990–1999) | Second Period (2000–2009) | Third Period (2010–2018) | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Na | Ae | Ho | Na | Ae | Ho | Na | Ae | Ho | |
| AHT4 | 4 | 3.549 | 0.721 | 4 | 3.498 | 0.716 | 4 | 3.538 | 0.715 |
| AHT5 | 5 | 3.657 | 0.736 | 5 | 3.468 | 0.710 | 5 | 3.241 | 0.686 |
| ASB17 | 6 | 4.116 | 0.764 | 7 | 4.133 | 0.781 | 7 | 4.031 | 0.763 |
| ASB2 | 9 | 6.554 | 0.847 | 9 | 6.415 | 0.867 | 9 | 5.701 | 0.854 |
| ASB23 | 6 | 4.142 | 0.762 | 6 | 4.505 | 0.770 | 6 | 4.599 | 0.781 |
| CA425 | 7 | 2.114 | 0.524 | 7 | 2.359 | 0.582 | 7 | 2.288 | 0.547 |
| HMS1 | 3 | 2.598 | 0.615 | 4 | 2.660 | 0.634 | 3 | 2.754 | 0.623 |
| HMS2 | 5 | 2.180 | 0.537 | 5 | 2.025 | 0.508 | 5 | 1.710 | 0.417 |
| HMS3 | 6 | 2.707 | 0.643 | 6 | 2.678 | 0.621 | 6 | 2.503 | 0.591 |
| HMS6 | 5 | 2.257 | 0.561 | 5 | 2.424 | 0.579 | 5 | 2.542 | 0.604 |
| HMS7 | 6 | 4.865 | 0.809 | 6 | 4.674 | 0.787 | 6 | 4.551 | 0.785 |
| HTG10 | 7 | 4.461 | 0.751 | 7 | 4.496 | 0.746 | 7 | 4.922 | 0.793 |
| HTG4 | 5 | 2.371 | 0.573 | 5 | 2.298 | 0.569 | 5 | 2.233 | 0.569 |
| HTG6 | 6 | 2.612 | 0.614 | 6 | 2.542 | 0.607 | 6 | 2.556 | 0.623 |
| HTG7 | 4 | 2.742 | 0.665 | 4 | 2.710 | 0.631 | 4 | 2.714 | 0.651 |
| LEX3 | 7 | 4.904 | 0.794 | 7 | 4.667 | 0.748 | 8 | 4.210 | 0.762 |
| VHL20 | 6 | 3.813 | 0.732 | 6 | 3.914 | 0.744 | 5 | 3.886 | 0.726 |
| Average | 5.71 | 3.508 | 0.685 | 5.82 | 3.498 | 0.682 | 5.77 | 3.411 | 0.676 |
| Period | N | Na | Ae | Ho | He | Fis |
|---|---|---|---|---|---|---|
| 1990–1999 | 1338 | 5.71 | 3.508 | 0.685 | 0.682 | −0.003 *** |
| 2000–2009 | 5008 | 5.82 | 3.498 | 0.682 | 0.684 | 0.002 *** |
| 2010–2018 | 3334 | 5.77 | 3.411 | 0.676 | 0.674 | −0.002 *** |
| Group | N | Inbreeding Coefficient Fx (%) | Heterozygosity (He) | |
|---|---|---|---|---|
| M ± m | Lim | |||
| 1990–1999 | ||||
| Stallions | 201 | 0.520 ± 0.0652 | 0–7.23 | 0.677 ± 0.0133 |
| Mares | 754 | 0.738 ± 0.0459 | 0–12.50 | 0.687 ± 0.0038 |
| Foals | 383 | 0.662 ± 0.0616 | 0–12.50 | 0.685 ± 0.0054 |
| Total | 1338 | 0.683 ± 0.0328 | 0–12.50 | 0.685 ± 0.0017 |
| 2000–2009 | ||||
| Stallions | 833 | 0.758 ± 0.0427 | 0–13.28 | 0.671 ± 0.0064 |
| Mares | 2579 | 0.821 ± 0.0249 | 0–12.70 | 0.688 ± 0.0020 |
| Foals | 1596 | 0.826 ± 0.0296 | 0–12.70 | 0.678 ± 0.0025 |
| Total | 5008 | 0.812 ± 0.0324 | 0–13.28 | 0.682 ± 0.0016 |
| 2010–2018 | ||||
| Stallions | 651 | 0.903 ± 0.0496 | 0–9.77 | 0.672 ± 0.0063 |
| Mares | 1689 | 0.899 ± 0.0331 | 0–12.70 | 0.677 ± 0.0024 |
| Foals | 994 | 0.904 ± 0.0413 | 0–9.77 | 0.677 ± 0.0037 |
| Total | 3334 | 0.900 ± 0.0413 | 0–12.70 | 0.676 ± 0.0019 |
| Level of Homozygosity (%) | Inbreeding Level (Fx) | ||||||
|---|---|---|---|---|---|---|---|
| 0 | 0.1–1.0 | 1.1–2.0 | 2.1–3.0 | 3.1–4.0 | >4.0 | Total | |
| 0,0 | 20 | 28 | 17 | 7 | 3 | 0 | 75 |
| 0.1–6.25 | 8 | 12 | 7 | 0 | 0 | 3 | 30 |
| 6.26–12.5 | 171 | 177 | 75 | 22 | 12 | 10 | 467 |
| 12.6–18.75 | 423 | 432 | 164 | 60 | 44 | 31 | 1154 |
| 18.76–25.27 | 675 | 532 | 186 | 77 | 76 | 24 | 1570 |
| 25.28–31.52 | 791 | 703 | 310 | 81 | 106 | 49 | 2040 |
| 31.53–37.77 | 263 | 364 | 152 | 58 | 51 | 14 | 902 |
| 37.78–44.02 | 618 | 528 | 217 | 48 | 73 | 47 | 1531 |
| 44.03–50.27 | 466 | 393 | 170 | 46 | 50 | 30 | 1131 |
| 50.28–56.52 | 162 | 211 | 71 | 14 | 22 | 15 | 495 |
| 56.53–62.77 | 71 | 70 | 28 | 10 | 10 | 3 | 192 |
| 62.78–69.02 | 6 | 12 | 4 | 6 | 5 | 0 | 33 |
| 69.03–75.27 | 7 | 5 | 5 | 1 | 7 | 1 | 26 |
| 75.28–76.92 | 1 | 5 | 4 | 0 | 0 | 0 | 10 |
| Total | 3658 | 3472 | 1410 | 430 | 459 | 227 | 9680 |
| % | 37.88 | 35.96 | 14.60 | 4.45 | 4.75 | 2.35 | 100 |
| Inbreeding Coefficient | Stallions | Mares | Foals | |||
|---|---|---|---|---|---|---|
| N | Homozygosity | N | Homozygosity | N | Homozygosity | |
| 0 | 638 | 31.69 ± 0.0184 | 1954 | 31.50 ± 0.0105 | 1077 | 32.29 ± 0.0142 |
| 0.1–1.0 | 630 | 31.23 ± 0.0185 | 1761 | 31.98 ± 0.0111 | 1090 | 32.25 ± 0.0142 |
| 1.1–2.0 | 251 | 32.71 ± 0.0296 | 702 | 31.30 ± 0.0175 | 458 | 33.38 ± 0.0220 |
| 2.1–3.0 | 56 | 28.93 ± 0.0606 | 225 | 31.22 ± 0.0309 | 150 | 31.65 ± 0.0380 |
| 3.1–4.0 | 72 | 32.99 ± 0.0554 | 253 | 34.53 ± 0.0299 | 136 | 31.82 ± 0.0399 |
| >4.0 | 38 | 32.89 ± 0.0762 | 127 | 32.54 ± 0.0416 | 62 | 33.32 ± 0.0599 |
| Total | 1685 | 31.66 ± 0.0113 | 5022 | 31.81 ± 0.0066 | 2973 | 32.41 ± 0.0086 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kalashnikov, V.; Khrabrova, L.; Blohina, N.; Zaitcev, A.; Kalashnikova, T. Dynamics of the Inbreeding Coefficient and Homozygosity in Thoroughbred Horses in Russia. Animals 2020, 10, 1217. https://doi.org/10.3390/ani10071217
Kalashnikov V, Khrabrova L, Blohina N, Zaitcev A, Kalashnikova T. Dynamics of the Inbreeding Coefficient and Homozygosity in Thoroughbred Horses in Russia. Animals. 2020; 10(7):1217. https://doi.org/10.3390/ani10071217
Chicago/Turabian StyleKalashnikov, Valery, Lyudmila Khrabrova, Nina Blohina, Alexander Zaitcev, and Tatyana Kalashnikova. 2020. "Dynamics of the Inbreeding Coefficient and Homozygosity in Thoroughbred Horses in Russia" Animals 10, no. 7: 1217. https://doi.org/10.3390/ani10071217
APA StyleKalashnikov, V., Khrabrova, L., Blohina, N., Zaitcev, A., & Kalashnikova, T. (2020). Dynamics of the Inbreeding Coefficient and Homozygosity in Thoroughbred Horses in Russia. Animals, 10(7), 1217. https://doi.org/10.3390/ani10071217

