Analysis of Candidate Genes for Growth and Milk Performance Traits in the Egyptian Barki Sheep
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Management
2.2. Phenotypic Data
2.3. Blood Samples and DNA Extraction
2.4. Detection of Polymorphisms and Genotyping
2.5. Statistical Analysis
3. Results
3.1. Phenotypic Data of Growth and Milk Traits
3.2. Genetic Parameters
3.3. Association of SNPs with Milk Traits of Barki Ewes
3.4. Association of SNPs with Growth Traits of Barki Lambs
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Sallam, A.M.; Galal, S.; Rashed, M.A.; Alsheikh, S.M. Genetic diversity in Barki sheep breed in its native tract in Egypt. Egyp. J. Anim. Prod. 2012, 49, 19–28. [Google Scholar]
- Galal, S.; Abdel-Rasoul, F.; Anous, M.R.; Shaat, I. On-Station Characterization of Small Ruminant Breeds in Egypt. In Characterization of Small Ruminant Breeds in West Asia and North Africa; Iniguez, L.C., Ed.; ICARDA: Aleppo, Syria, 2005; Volume 2, pp. 141–193. [Google Scholar]
- FAOSTAT. Available online: http://www.fao.org/faostat/ar/#data/QA (accessed on 25 September 2019).
- El-Wakil, S.I.; Shemeis, A.R.; Ahmed, A.M.; Abdallah, O.Y. Genetic and phenotypic relationships involving body weight, degree of maturity and measurer of gain rate of Barki sheep without having recourse to fitting growth curves. J. Agric.Sci. Mansoura Univ. 2008, 33, 4835–4848. [Google Scholar]
- Ibrahim, A.H.M.; Tzanidakis, N.; Sotiraki, S.; Zhou, H.; Hickford, J.G.H. Identification of the association between FABP4 gene polymorphisms and milk production traits in Sfakia sheep. Arch. Anim. Breed. 2019, 62, 413–422. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Behzadi, S.; Miraei-Ashtiani, S.R.; Sadeghi, M.; Zamani, P.; Abdoli, R. Association of IGF-I gene polymorphisms with carcass traits in Iranian Mehraban sheep using SSCP analysis. Iran. J. Appl. Anim. Sci. 2015, 5, 121–126. [Google Scholar]
- Orford, M.; Tzamaloukas, O.; Papachristoforou, C.; Miltiadou, D. Technical note: A simplified PCR based assay for the characterization of two prolactin variants that affect milk traits in sheep breeds. J. Dairy. Sci. 2010, 93, 5996–5999. [Google Scholar] [CrossRef]
- Moioli, B.; D’Andrea, M.; Pilla, F. Candidate genes affecting sheep and goat milk quality. Small Ruminant Res. 2007, 68, 179–192. [Google Scholar] [CrossRef]
- Staiger, E.A.; Thonney, M.L.; Buchanan, J.W.; Rogers, E.R.; Oltenacu, P.A.; Mateescu, R.G. Effect of prolactin β-lactoglobulin and κ-casein genotype on milk yield in East Friesian sheep. J. Dairy. Sci. 2010, 93, 1736–1742. [Google Scholar] [CrossRef]
- Knight, C.H. Overview of prolactin’s role in farm animal lactation. Livest. Prod. Sci. 2001, 70, 87–93. [Google Scholar] [CrossRef]
- Choudhary, V.; Kumar, P.; Bhattacharya, T.K.; Bhushan, B.; Sharma, A. DNA polymorphism of leptin gene in Bos indicus and Bos Taurus cattle. Genet. Mol. Biol. 2005, 28, 740–742. [Google Scholar] [CrossRef]
- Nassiry, M.R.; Heravi, M.A.; Alashawkany, A.R.; Ghovati, S. Leptin Gene Polymorphism in Iranian Native Golpayegani and Taleshi Cows. Pak. J. Biol. Sci. 2007, 10, 3738–3741. [Google Scholar] [CrossRef]
- Jamuna, V.; Gupta, A.K.; Chakravarty, A.K.; Singh, A.; Patil, C.S.; Kumar, M.; Vohra, V. Leptin gene polymorphism in association with Lactation milk yield in Murrah Buffaloes. Indian J Anim Sci. 2016, 86, 95–97. [Google Scholar]
- Estany, J. Association of CA repeat polymorphism at intron 1 of insulin-like growth factor (IGF-I) gene with circulating IGF-I concentration, growth, and fatness in swine. Physiol. Genomics 2007, 31, 236–243. [Google Scholar] [CrossRef] [PubMed]
- Honarvar, M. Study of polymorphisms in the 5 flanking region of the ovine IGF-I gene in zel sheep. World Appl Sci J. 2012, 16, 726–728. [Google Scholar]
- Adam, C.L.; Gadd, T.S.; Findlay, P.A.; Wathes, D.C. IGF-I stimulation of luteinizing hormone secretion, IGF-binding proteins (IGFBPs) and expression of mRNAs for IGFs, IGF receptors and IGFBPs in the ovine pituitary gland. J. Endocrinol. 2000, 166, 247–254. [Google Scholar] [CrossRef] [Green Version]
- Shen, W.; Wisniowski, P.; Ahmed, L.; Boyle, D.W.; Denne, S.C. Protein anabolic effects of insulin and IGF-I in the ovine fetus. Am. J.Physiol. Endocrinol. Metab. 2003, 284, 48–56. [Google Scholar] [CrossRef] [Green Version]
- Chen, H.C.; Smith, S.J.; Ladha, Z.; Jensen, D.R.; Ferreira, L.D.; Pulawa, L.K. Increased insulin and leptin sensitivity in mice lacking acyl CoA:diacylglycerol acyltransferase 1. J. Clin. Investig. 2002, 109, 1049–1055. [Google Scholar] [CrossRef]
- Bole-Feysot, C.; Goffin, V.; Edery, M.; Binart, N.; Kelly, P.A. Prolactin (PRL) and its receptor: Actions signal transduction pathways and phenotypes observed in PRL receptor knockout mice. Endocr. Rev. 1998, 19, 225–268. [Google Scholar] [CrossRef]
- Haug, A.; Høstmark, A.T.; Harstad, O.M. Bovine milk in human nutrition—a review. Lipids Health Dis. 2007, 6, 1–16. [Google Scholar] [CrossRef] [Green Version]
- Caroli, A.; Chiatti, F.; Chessa, S.; Rignanese, D.; Bolla, P.; Pagnacco, G. Focusing on the goat casein complex. J. Dairy Sci. 2006, 89, 3178–3187. [Google Scholar] [CrossRef] [Green Version]
- Selvaggi, M.; Laudadio, V.; Dario, C.; Tufarelli, V. Major proteins in goat milk: An updated overview on genetic variability. Mol. Biol. Rep. 2014, 41, 1035–1048. [Google Scholar] [CrossRef]
- Ramunno, L.; Cosenza, G.; Pappalardo, M.; Longobardi, E.; Gallo, D.; Pastore, N.; Di Gregorio, P.; Rando, A. Characterization of two new alleles at the goat CSN1S2 locus. Anim. Genet. 2001, 32, 264–268. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Garrett, A.; Rincon, G.; Medrano, J.; Elzo, M.; Silver, G.; Thomas, M. Promoter region of the bovine growth hormone receptor gene: Single nucleotide polymorphism discovery in cattle and association with performance in Brangus bulls. J. Anim. Sci. 2008, 86, 3315–3323. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Waters, S.; McCabe, M.; Howard, D.; Giblin, L.; Magee, D.; MacHugh, D.; Berry, D. Associations between newly discovered polymorphisms in the Bos Taurus growth hormone receptor gene and performance traits in Holstein–Friesian dairy cattle. Anim. Genet. 2001, 42, 39–49. [Google Scholar] [CrossRef] [PubMed]
- Di Stasio, L.; Destefanis, G.; Brugiapaglia, A.; Albera, A.; Rolando, A. polymorphism of the GHR gene in cattle and relationships with meat production and quality. Anim. Genet. 2005, 36, 138–140. [Google Scholar] [CrossRef] [PubMed]
- Reardon, W.; Mullen, A.; Sweeney, T.; Hamill, R. Association of polymorphisms in candidate genes with colour, water-holding capacity, and composition traits in bovine M. longissimus and M. semimembranosus. Meat. Sci. 2010, 86, 270–275. [Google Scholar] [CrossRef]
- Ibrahim, A.H.M.; El-Betar, E.M. Effect of variation in the adrenergic receptor be-ta 3 (adrβ3) gene on wool traits in Barki sheep. Egypt. J. Genet. Cytol. 2015, 44, 61–73. [Google Scholar]
- Shehata, M.F.; Ismail, I.M.; Ibrahim, A.H.M. Variation in exon 10 of the ovine calpain3 gene and its association with growth and carcass traits in Egyptian Barki lambs. Egypt. J. Genet. Cytol. 2014, 43, 231–240. [Google Scholar] [CrossRef]
- Sallam, A.M.; Ibrahim, A.H.; Alsheikh, S.M. Estimation of genetic parameters and variance components of pre-weaning growth traits in Barki lambs. Small Ruminant Res. 2019, 173, 94–100. [Google Scholar] [CrossRef]
- Kalinowski, S.T.; Taper, M.L.; Marshall, T.C. Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Mol Ecol. 2007, 5, 1099–1106. [Google Scholar] [CrossRef]
- Hashemi, A.; Mardani, K.; Farhadian, M.; Ashrafi, I.; Ranjbari, M. Allelic polymorphism of Makoei sheep leptin gene Identified by polymerase chain reaction and single Strand conformation Polymorphism. Afr. J. Biotechnol. 2011, 10, 17903–17906. [Google Scholar] [CrossRef] [Green Version]
- Oravcová, M.; Margetín, M.; Peskovicová, D.; Dano, J.; Milerski, M.; Hetenyi, L.J.; Polak, P. Factors affecting ewe’s milk fat and protein content and relationships between milk yield and milk components. Czech J. Anim. Sci. 2007, 52, 189–198. [Google Scholar] [CrossRef] [Green Version]
- Zhou, H.; Hickford, J.G.H.; Gong, H. Identification of Allelic Polymorphism in the Ovine Leptin Gene. Mol. Biotechnol. 2009, 41, 22–25. [Google Scholar] [CrossRef] [PubMed]
- Friedman, J.M.; Halaas, J.L. Leptin and the regulation of body weight in mammals. Nature 1998, 395, 763–770. [Google Scholar] [CrossRef]
- Almeida, S.E.; Allmeida, E.A.; Moraes, J.C.F.; Weimer, T. Molecular marker in the LEP gene and reproductive performance of beef cattle. J Anim Breed Genet. 2003, 120, 106–113. [Google Scholar] [CrossRef]
- Mahmoud, A.; Saleh, A.; Almealamah, N.; Ayadi, M.; Matar, A.; Abou- Tarboush, F.; Aljumaah, R.; Abouheif, M. Polymorphism of leptin gene and its association with milk traits in Najdi sheep. J Appl Microbiol. 2014, 8, 2953–2959. [Google Scholar]
- Yang, D.; Chen, H.; Wang, X.; Tian, Z.; Tang, L.; Zhang, Z. Association of polymorphisms of leptin gene with body weight and body sizes indexes in Chinese indigenous cattle. J Genet Genomics. 2007, 34, 400–405. [Google Scholar] [CrossRef]
- Tahmoorespur, M.; Taheri, A.; Valeh, M.V.; Saghi, D.A.; Ansary, M. Assessment relationship between leptin and ghrelin genes polymorphisms and estimated breeding values (EBVs) of growth traits in Baluchi sheep. J. Anim. Vet. Adv. 2010, 9, 2460–2465. [Google Scholar]
- Le Provost, F.; Leroux, C.; Martin, P.; Gaye, P.; Djiane, J. Prolactin Gene Expression in Ovine and Caprine Mammary Gland. Neuroendocrinology. 1994, 60, 305–313. [Google Scholar] [CrossRef]
- Gutierrez-Gil, B.; El-Zarei, M.F.; Alvarez, L. Quantitative trait loci underlying milk production traits in sheep. Anim. Genet. 2009, 40, 423–434. [Google Scholar] [CrossRef]
- Barillet, F.; Arranz, J.J.; Carta, A. Mapping quantitative trait loci for milk production and genetic polymorphisms of milk proteins in dairy sheep. Genet. Sel. Evol. 2005, 37, 109–123. [Google Scholar] [CrossRef] [Green Version]
- Ramos, A.M.; Matos, C.A.P.; Russo-Almeida, P.A.; Bettencourt, C.M.V.; Matos, J.; Martins, A.; Pinheiro, C.; Rangel-Figueiredo, T. Candidate genes for milk production traits in Portuguese dairy sheep. Small Ruminant Res. 2009, 82, 117–121. [Google Scholar] [CrossRef]
- Cui, Y.; Riedlinger, G.; Miyoshi, K.; Tang, W.; Li, C.; Deng, C.X.; Hennighausen, L. Inactivation of Stat5 in mouse mammary epithelium during pregnancy reveals distinct functions in cell proliferation, survival, and differentiation. Mol. Cell. Biol. 2004, 24, 8037–8047. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brym, P.; Kaminski, S.; Rusc, A. New SSCP polymorphism within bovine STAT5A gene and its associations with milk performance traits in Black-and-White and Jersey cattle. J. Appl. Genet. 2004, 45, 445–452. [Google Scholar]
- Schennink, A.; Bovenhuis, H.; Léon-Kloosterziel, K.M.; Van Arendonk, J.A.; Visker, M.H. Effect of polymorphisms in the FASN, OLR1, PPARGC1A, PRL and STAT5A genes on bovine milk-fat composition. Anim. Genet. 2009, 40, 909–916. [Google Scholar] [CrossRef]
- An, X.P.; Hou, J.X.; Zhao, H.B.; Bai, L.; Peng, J.Y.; Zhu, C.M.; Yan, Q.M.; Song, Y.X.; Wang, J.G.; Cao, B.Y. Polymorphism identification in goat DGAT1 and STAT5A genes and association with milk production traits. Czech J. Anim. Sci. 2013, 58, 321–327. [Google Scholar] [CrossRef] [Green Version]
- Mayo, K.E. Molecular cloning and expression of a pituitary-specific receptor for growth hormone-releasing hormone. Mol. Endoc. 1992, 6, 1734–1744. [Google Scholar] [CrossRef]
- Pang, A.L.P.; Chan, W.Y. Molecular basis of diseases of the endocrine system. In Essential Concepts in Molecular Pathology; Coleman, W.B., Tsongalis, G.J., Eds.; Academic Press: San Diego, CA, USA, 2010; pp. 289–307. [Google Scholar]
- Andrea, G.; Johannes, D.V. Pathophysiology of the Neuroregulation of Growth Hormone Secretion in Experimental Animals and the Human. Endocr. Rev. 1998, 19, 717–797. [Google Scholar] [CrossRef]
- Godfrey, P.; Rahal, J.; Beamer, W. GHRH receptor of little mice contains a missense mutation in the extracellular domain that disrupts receptor function. Nat. Genet. 1993, 4, 227–232. [Google Scholar] [CrossRef]
- Gaylinn, B.D.; Harrison, J.K.; Zysk, J.R.; Lyons, C.E.; Lynch, K.R.; Thorner, M.O. Molecular cloning and expression of a human anterior pituitary receptor for growth hormone-releasing hormone. Mol. Endocrinol. 1993, 7, 77–84. [Google Scholar] [CrossRef] [Green Version]
- Dettori, M.; Pazzola, M.; Pira, E.; Stocco, G.; Vacca, G. Association between the GHR, GHRHR and IGF1 gene polymorphisms and milk coagulation properties in Sarda sheep. J. Dairy Res. 2019, 86, 331–336. [Google Scholar] [CrossRef]
- Vacca, G.M.; Dettori, M.L.; Balia, F.; Luridiana, S.; Mura, M.C.; Carcangiu, V. Sequence polymorphisms at the growth hormone GH1/GH2-N and GH2-Z gene copies and their relationship with dairy traits in domestic sheep (Ovis aries). Mol. Biol. Rep. 2013, 40, 5285–5294. [Google Scholar] [CrossRef] [PubMed]
- Hajihosseinlo, A. Effect of GH gene polymorphisms on biometric traits in Makeoi sheep. Ann. Biol. Res. 2013, 4, 351–355. [Google Scholar]
- Tahmoorespur, M.; Valeh, M.V.; Nassiry, M.R.; Moussavi, A.H.; Ansary, M. Association of the polymorphism in the 50 flanking region of the ovine IGF-I gene with growth traits in the Baluchi sheep. S. Afr. J. Anim. Sci. 2009, 39, 97–101. [Google Scholar] [CrossRef]
- Negahdary, M.; Hajihosseinlo, A.; Ajdary, M. PCR-SSCP variation of IGF1 and PIT1 genes and their association with estimated breeding values of growth traits in Makeoi Sheep. Genet. Res. Int. 2013, 6, 272346. [Google Scholar] [CrossRef]
- Gholibeikifard, A.; Aminafshar, M.; Hosseinpour, M.M. Polymorphism of IGF-I and ADRB3 Genes and Their Association with Growth Traits in the Iranian Baluchi Sheep. J. Agric. Sci. Technol. 2013, 15, 1153–1162. [Google Scholar]
- Su, R.; Sun, W.; Li, D.; Wang, Q.Z.; Lv, X.Y.; Musa, H.H.; Chen, L.; Zhang, Y.F.; Wu, W.Z. Association between DLK1 and IGF-I gene expression and meat quality in sheep. Genet. Mol. Res. 2014, 13, 10308–10319. [Google Scholar] [CrossRef]
- Negahdary, M.; Majdi, S.; Hajihosseinlo, A. Genetic effect of IGF1, PIT1 and Leptin genes on wool weights in Makeoi sheep. Electron. J. Biol. 2014, 10, 46–51. [Google Scholar]
- Scata, M.C.; Napolitano, F.; Casu, S.; Carta, A.; De Matteis, G. Ovine acyl CoA: Diacylglycerol acyltransferase 1-molecular characterization, polymorphisms and association with milk traits. Anim. Genet. 2009, 40, 737–742. [Google Scholar] [CrossRef]
- Xu, Q.L.; Chen, Y.L.; Ma, R.X.; Xu, P. Polymorphism of DGAT1 associated with intramuscular fat-mediated tenderness in sheep. J. Sci. Food Agric. 2009, 89, 232–237. [Google Scholar] [CrossRef]
Gene Name | Gene ID | Allele 2 | Primer Sequence | Product Size (bp) | Annealing Temperature (°C) |
---|---|---|---|---|---|
LEP1 | ENSOARG00000002407 | T/G(V181L) | F:AGGAAGCACCTCTACACTC R:CTTCAAGGCTTCAGCACC | 471 | 53 |
IGF1 | ENSOARG00000015856 | G/A | F:GTTCTGGAATGGCAGGTTTG R:GCCACTGTCTTTGGATTTTCTC | 570 | 60 |
DGAT1 | ENSOARG00000014070 | T/C | F:ACTGTGCTTCAGGGTGTCGG R:GAGTGATGGACTCTAGGAGGAAGG | 429 | 60 |
PRL | ENSOARG00000009137 | A/G | F:TGGAATTTAGATGACAAGCAACTG R:AATTGGTGGCTCAAGTGGTG | 745 | 63 |
CSN1S2 | ENSOARG00000010683 | A/C | F:CCCTGAAGGAATCTGCTGAAG R:AGCCAAGCAAAATGATATAGAAGC | 855 | 63 |
GHR | ENSOARG00000008837 | C/T(P448S) | F:TGATGACCCTGATGAGAAGACTG R:TTTTGTTCAGTTGGTCTGTGCTC | 857 | 63 |
GHRHR | ENSOARG00000007636 | C/T | F:TTGTTCTTGGAGGTGAGGACTG R:AACACGGGTGGCTCTCTTG | 759 | 63 |
STAT5A | ENSOARG00000000809 | G/A | F:GGGTGCATACAGGACAGTGC R:CCAGTCTCTGGCTTTCCCAA | 446 | 60 |
Trait | N | Mean | Standard Deviation | Minimum | Maximum |
---|---|---|---|---|---|
Total Milk Yield (kg) | 111 | 28.95 | 12.64 | 9.90 | 77.40 |
Fat (%) | 111 | 4.30 | 1.74 | 1.00 | 9.60 |
Protein (%) | 111 | 5.11 | 1.35 | 2.70 | 9.50 |
Lactose (%) | 111 | 6.34 | 1.42 | 0.81 | 9.90 |
Total Solids (%) | 111 | 18.72 | 5.38 | 12.14 | 34.70 |
Trait | N | Mean | Standard Deviation | Minimum | Maximum |
---|---|---|---|---|---|
Birth Weight (kg) | 140 | 3.71 | 0.58 | 2.42 | 5.04 |
Weaning Weight (kg) | 140 | 13.83 | 3.89 | 5.15 | 28.80 |
Average Daily Gain (kg/day) | 140 | 0.112 | 0.04 | 0.02 | 0.27 |
Gene | SNP Locus | Genotype | Genotypic Frequency | Allele | Allelic Frequency | He | Ho | PIC | HWE Test (p Value) |
---|---|---|---|---|---|---|---|---|---|
LEP | rs420693815 | TT | 0.15 | T G | 0.41 0.59 | 0.48 | 0.52 | 0.37 | 0.35 |
GT | 0.53 | ||||||||
GG | 0.32 | ||||||||
IGF1 | rs400398060 | GG | 0.47 | G A | 0.69 0.31 | 0.43 | 0.57 | 0.34 | 0.93 |
AG | 0.43 | ||||||||
AA | 0.10 | ||||||||
DGAT1 | rs409119650 | TT | 0.00 | T C | 0.10 0.90 | 0.18 | 0.82 | 0.16 | 0.49 |
CT | 0.19 | ||||||||
CC | 0.81 | ||||||||
STAT5A | rs161082816 | GG | 0.03 | G A | 0.14 0.86 | 0.24 | 0.76 | 0.21 | 0.34 |
AG | 0.22 | ||||||||
AA | 0.75 | ||||||||
PRL | rs422713690 | GG | 0.31 | G A | 0.53 0.47 | 0.50 | 0.50 | 0.37 | 0.26 |
AG | 0.44 | ||||||||
AA | 0.25 | ||||||||
CSN1S2 | rs420391387 | CC | 0.22 | C A | 0.50 0.50 | 0.50 | 0.50 | 0.38 | 0.20 |
AC | 0.56 | ||||||||
AA | 0.22 | ||||||||
GHR | rs413776054 | TT | 0.05 | T C | 0.21 0.79 | 0.33 | 0.67 | 0.28 | 0.70 |
CT | 0.32 | ||||||||
CC | 0.63 | ||||||||
GHRHR | rs414991449 | TT | 0.43 | T C | 0.66 0.34 | 0.45 | 0.55 | 0.35 | 0.39 |
CT | 0.47 | ||||||||
CC | 0.10 |
Gene | SNP locus | Genotype | Genotypic Frequency | Allele | Allelic Frequency | He | Ho | PIC | HWE Test (p Value) |
---|---|---|---|---|---|---|---|---|---|
LEP | rs420693815 | TT | 0.34 | T G | 0.56 0.44 | 0.49 | 0.51 | 0.37 | 0.13 |
GT | 0.43 | ||||||||
GG | 0.23 | ||||||||
IGF1 | rs400398060 | GG | 0.51 | G A | 0.70 0.30 | 0.42 | 0.58 | 0.33 | 0.54 |
AG | 0.39 | ||||||||
AA | 0.10 | ||||||||
DGAT1 | rs409119650 | TT | 0.01 | T C | 0.07 0.93 | 0.13 | 0.87 | 0.12 | 0.68 |
CT | 0.13 | ||||||||
CC | 0.86 | ||||||||
STAT5A | rs161082816 | GG | 0.04 | G A | 0.22 0.78 | 0.34 | 0.66 | 0.28 | 0.44 |
AG | 0.37 | ||||||||
AA | 0.59 | ||||||||
PRL | rs422713690 | GG | 0.39 | G A | 0.61 0.39 | 0.48 | 0.52 | 0.36 | 0.56 |
AG | 0.45 | ||||||||
AA | 0.16 | ||||||||
CSN1S2 | rs420391387 | CC | 0.38 | C A | 0.60 0.40 | 0.48 | 0.52 | 0.37 | 0.36 |
AC | 0.44 | ||||||||
AA | 0.18 | ||||||||
GHR | rs413776054 | TT | 0.01 | T C | 0.17 0.83 | 0.28 | 0.72 | 0.24 | 0.13 |
CT | 0.33 | ||||||||
CC | 0.66 | ||||||||
GHRHR | rs414991449 | TT | 0.49 | T C | 0.70 0.30 | 0.42 | 0.58 | 0.33 | 0.74 |
CT | 0.43 | ||||||||
CC | 0.08 |
Gene | SNP Locus | Genotype | Milk Yield (kg) | Fat % | Protein % | Lactose % | Total Solids % |
---|---|---|---|---|---|---|---|
LEP | rs420693815 | TT (15) | 35.55 ± 4.18 | 3.81 ± 0.32 | 5.33 ± 0.30 | 6.73 ± 0.24 | 19.17 ± 1.27 |
GT (55) | 26.67 ± 1.27 | 4.56 ± 0.26 | 5.24 ± 0.20 | 6.36 ± 0.22 | 19.05 ± 0.79 | ||
GG (33) | 29.77 ± 2.66 | 3.92 ± 0.20 | 4.67 ± 0.17 | 6.23 ± 0.17 | 17.24 ± 0.66 | ||
p value | 0.053 | 0.085 | 0.105 | 0.397 | 0.185 | ||
IGF1 | rs400398060 | GG (48) | 29.59 ± 1.93 | 4.22 ± 0.22 | 5.06 ± 0.19 | 6.61 ± 0.19 | 18.93 ± 0.76 |
AG (44) | 28.46 ± 2.07 | 4.22 ± 0.26 | 5.14 ± 0.20 | 6.22 ± 0.21 | 18.39 ± 0.76 | ||
AA (10) | 28.08 ± 1.83 | 3.90 ± 0.39 | 4.35 ± 0.25 | 5.71 ± 0.18 | 14.56 ± 0.46 | ||
p value | 0.940 | 0.969 | 0.467 | 0.583 | 0.572 | ||
DGAT1 | rs409119650 | TT (0) | -- | -- | -- | -- | -- |
CT (20) | 26.25 ± 2.39 | 4.44 ± 0.28 | 4.94 ± 0.30 | 6.18 ± 0.33 | 18.43 ± 1.05 | ||
CC (84) | 29.56 ± 1.45 | 4.20 ± 0.19 | 5.04 ± 0.14 | 6.38 ± 0.14 | 18.26 ± 0.56 | ||
p value | 0.287 | 0.607 | 0.643 | 0.282 | 0.807 | ||
STAT5A | rs161082816 | GG (3) | 34.97 ± 4.02 | 3.45 ± 0.55 | 4.84 ± 0.81 | 4.19 ± 1.30 | 19.28 ± 3.41 |
AG (21) | 30.39 ± 2.83 | 3.84 ± 0.31 | 4.58 ± 0.22 | 6.38 ± 0.23 | 17.01 ± 0.86 | ||
AA (73) | 28.62 ± 1.52 | 4.37 ± 0.19 | 5.21 ± 0.16 | 6.52 ± 0.15 | 18.98 ± 0.60 | ||
p value | 0.638 | 0.297 | 0.149 | 0.001 | 0.199 | ||
PRL | rs422713690 | GG (33) | 32.59 ± 2.98 | 4.21 ± 0.24 | 5.09 ± 0.23 | 6.61 ± 0.22 | 18.38 ± 0.92 |
AG (48) | 25.90 ± 1.23 | 3.95 ± 0.24 | 4.93 ± 0.18 | 6.20 ± 0.20 | 18.02 ± 0.71 | ||
AA (27) | 30.62 ± 2.14 | 4.79 ± 0.35 | 5.40 ± 0.28 | 6.18 ± 0.30 | 19.96 ± 1.07 | ||
p value | 0.052 | 0.125 | 0.411 | 0.152 | 0.322 | ||
CSN1S2 | rs420391387 | CC (23) | 31.44 ± 3.57 | 4.02 ± 0.32 | 5.05 ± 0.22 | 6.31 ± 0.25 | 17.56 ± 0.72 |
AC (58) | 28.61 ± 1.37 | 4.53 ± 0.25 | 5.12 ± 0.18 | 6.34 ± 0.19 | 19.56 ± 0.71 | ||
AA (22) | 25.33 ± 2.01 | 4.06 ± 0.30 | 5.09 ± 0.34 | 6.27 ± 0.31 | 17.47 ± 1.20 | ||
p value | 0.264 | 0.562 | 0.886 | 0.578 | 0.637 | ||
GHR | rs413776054 | TT (5) | 20.72 ± 2.77 | 4.93 ± 0.78 | 5.31 ± 0.37 | 6.51 ± 0.47 | 19.52 ± 2.53 |
CT (32) | 31.10 ± 2.57 | 4.25 ± 0.25 | 5.12 ± 0.21 | 5.98 ± 0.23 | 18.03 ± 0.86 | ||
CC (64) | 29.07 ± 1.50 | 4.20 ± 0.22 | 5.09 ± 0.19 | 6.49 ± 0.18 | 19.05 ± 0.68 | ||
p value | 0.249 | 0.556 | 0.791 | 0.450 | 0.667 | ||
GHRHR | rs414991449 | TT (43) | 28.61 ± 1.95 | 4.49 ± 0.26 | 5.32 ± 0.22 | 6.17 ± 0.23 | 19.26 ± 0.84 |
CT (48) | 29.71 ± 1.90 | 4.09 ± 0.25 | 4.96 ± 0.19 | 6.57 ± 0.19 | 18.71 ± 0.72 | ||
CC (10) | 26.44 ± 1.86 | 4.39 ± 0.35 | 5.12 ± 0.44 | 5.91 ± 0.44 | 16.76 ± 1.74 | ||
p value | 0.794 | 0.215 | 0.081 | 0.612 | 0.035 |
Gene | SNP locus | Genotype | Birth Weight (kg) | Weaning Weight (kg) | Average Daily Gain (g) |
---|---|---|---|---|---|
LEP | rs420693815 | TT (46) | 3.67 ± 0.09 | 13.25 ± 0.60 | 106.0 ± 6.0 |
GT (58) | 3.75 ± 0.07 | 14.40 ± 0.52 | 118.0 ± 5.0 | ||
GG (31) | 3.82 ± 0.10 | 14.32 ± 0.61 | 117.0 ± 6.0 | ||
p value | 0.589 | 0.075 | 0.076 | ||
IGF1 | rs400398060 | GG (67) | 3.75 ± 0.06 | 14.35 ± 0.42 | 118.0 ± 4.0 |
AG (52) | 3.73 ± 0.09 | 13.74 ± 0.60 | 111.0 ± 6.0 | ||
AA (13) | 3.63 ± 0.18 | 12.06 ± 0.92 | 93.0 ± 10.0 | ||
p value | 0.442 | 0.354 | 0.416 | ||
DGAT1 | rs409119650 | TT (1) @ | 4.29 | 14.00 | 108.0 |
CT (17) | 3.86 ± 0.14 | 14.92 ± 0.62 | 123.0 ± 7.0 | ||
CC (114) | 3.71 ± 0.05 | 13.73 ± 0.38 | 111.0 ± 4.0 | ||
p value | 0.519 | 0.170 | 0.163 | ||
STAT5A | rs161082816 | GG (4) | 3.15 ± 0.28 | 11.23 ± 1.76 | 85.8 ± 19.0 |
AG (41) | 3.81 ± 0.11 | 14.67 ± 0.67 | 120.7 ± 7.0 | ||
AA (66) | 3.71 ± 0.07 | 13.86 ± 0.42 | 112.8 ± 4.0 | ||
p value | 0.631 | 0.255 | 0.273 | ||
PRL | rs422713690 | GG (48) | 3.75 ± 0.07 | 13.52 ± 0.45 | 109.0 ± 9.0 |
AG (53) | 3.74 ± 0.09 | 14.31 ± 0.59 | 117.0 ± 6.0 | ||
AA (19) | 3.70 ± 0.11 | 14.16 ± 0.82 | 116.0 ± 5.0 | ||
p value | 0.965 | 0.593 | 0.567 | ||
CSN1S2 | rs420391387 | CC (35) | 3.79 ± 0.12 | 15.07 ± 0.75 | 125.3 ± 8.0 |
AC (40) | 3.86 ± 0.08 | 14.34 ± 0.48 | 116.5 ± 5.0 | ||
AA (17) | 3.72 ± 0.13 | 14.17 ± 0.63 | 116.1 ± 7.0 | ||
p value | 0.939 | 0.335 | 0.278 | ||
GHR | rs413776054 | TT (1) * | 3.5 | 20 | 183.3 |
CT (35) | 3.74 ± 0.11 | 14.77 ± 0.49 | 122.5 ± 5.0 | ||
CC (70) | 3.76 ± 0.07 | 14.31 ± 0.49 | 117.3 ± 5.0 | ||
p value | 0.608 | 0.446 | 0.309 | ||
GHRHR | rs414991449 | TT (49) | 3.72 ± 0.08 | 14.83 ± 0.58 | 123.4 ± 6.0 |
CT (43) | 3.79 ± 0.11 | 13.91 ± 0.58 | 112.4 ± 6.0 | ||
CC (8) | 3.73 ± 0.22 | 14.92 ± 0.81 | 124.4 ± 9.0 | ||
p value | 0.856 | 0.146 | 0.107 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Abousoliman, I.; Reyer, H.; Oster, M.; Muráni, E.; Mourad, M.; Abdel-Salam Rashed, M.; Mohamed, I.; Wimmers, K. Analysis of Candidate Genes for Growth and Milk Performance Traits in the Egyptian Barki Sheep. Animals 2020, 10, 197. https://doi.org/10.3390/ani10020197
Abousoliman I, Reyer H, Oster M, Muráni E, Mourad M, Abdel-Salam Rashed M, Mohamed I, Wimmers K. Analysis of Candidate Genes for Growth and Milk Performance Traits in the Egyptian Barki Sheep. Animals. 2020; 10(2):197. https://doi.org/10.3390/ani10020197
Chicago/Turabian StyleAbousoliman, Ibrahim, Henry Reyer, Michael Oster, Eduard Muráni, Mosaad Mourad, Mohamed Abdel-Salam Rashed, Ismail Mohamed, and Klaus Wimmers. 2020. "Analysis of Candidate Genes for Growth and Milk Performance Traits in the Egyptian Barki Sheep" Animals 10, no. 2: 197. https://doi.org/10.3390/ani10020197
APA StyleAbousoliman, I., Reyer, H., Oster, M., Muráni, E., Mourad, M., Abdel-Salam Rashed, M., Mohamed, I., & Wimmers, K. (2020). Analysis of Candidate Genes for Growth and Milk Performance Traits in the Egyptian Barki Sheep. Animals, 10(2), 197. https://doi.org/10.3390/ani10020197