Effects of Osthole on Progesterone Secretion in Chicken Preovulatory Follicles Granulosa Cells
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Isolation and Culture of Granulosa Cells
2.2. Identification of Granulosa Cells by Immunofluorescence
2.3. Cell Viability
2.4. P4, cAMP and PKA assay
2.5. Extraction of RNA and Quantitative Real-Time PCR
2.6. Western Blot
2.7. ROS Assay
2.8. Statistical Analyses
3. Results
3.1. Morphology of Granulosa Cells
3.2. Effect of Ost on Viability of Granulosa Cells
3.3. Effect of Ost on P4 Secretion in Granulosa Cells
3.4. Effect of Ost on mRNA Expression of PCNA, StAR, P450scc and 3β-HSD in Granulosa Cells
3.5. Effect of Ost on Protein Expression of StAR, P450scc and 3β-HSD in Granulosa Cells
3.6. Effect of Ost on cAMP and PKA Secretion in Granulosa Cells
3.7. Effect of Ost on ROS Expression in Granulosa Cells
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Chen, J.; Ying, G.G.; Deng, W.J. Antibiotic residues in food: Extraction, analysis, and human health concerns. J. Agric. Food. Chem. 2019, 67, 7569–7586. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zafar, S.; Sarfraz, I.; Rasul, A.; Shah, M.A.; Hussain, G.; Zahoor, M.K.; Shafiq, N.; Riaz, A.; Selamoglu, Z.; Sarker, S. Osthole: A multifunctional natural compound with potential anticancer, antioxidant and anti-inflammatory Activities. Mini-Rev. Med. Chem. 2020. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, X.W.; Zhang, D.S.; Xue, G.P.; Zhao, Y.J.; Jin, C. Experimental research on estrogenic effect of Osthole on rats. Chin. Pharm. Bull. 2013, 29, 1031–1032. [Google Scholar]
- Pan, Z.Q.; Fang, Z.Q.; Lu, W.L.; Liu, X.M.; Zhang, Y.Y. Osthole, a coumadin analog from Cnidium monnieri (L.) Cusson, stimulates corticosterone secretion by increasing steroidogenic enzyme expression in mouse Y1 adrenocortical tumor cells. J. Ethnopharmacol. 2015, 175, 456–462. [Google Scholar] [CrossRef] [Scilit]
- Ghanem, K.; Johnson, A.L. Response of hen pre-recruitment ovarian follicles to follicle stimulating hormone, in vivo. Gen. Comp. Endocrinol. 2019, 270, 41–47. [Google Scholar] [CrossRef] [Scilit]
- Huang, E.S.; Kao, K.J.; Nalbandov, A.V. Synthesis of sex steroids by cellular components of chicken follicles. Biol. Reprod. 1979, 20, 454–461. [Google Scholar] [CrossRef] [Scilit]
- Woods, D.C.; Schorey, J.S.; Johnson, A.L. Toll-like receptor signaling in hen ovarian granulosa cells is dependent on stage of follicle maturation. Reproduction 2009, 137, 987–996. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Johnson, A.L.; Solovieva, E.V.; Bridgham, J.T. Relationship between steroidogenic acute regulatory protein expression and progesterone production in hen granulosa cells during follicle development. Biol. Reprod. 2002, 67, 1313–1320. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Meng, B.; Cao, Z.; Gai, Y.; Liu, M.; Gao, M.; Chen, M.; Ning, Z.; Luan, X. Effects of recombinant goose adiponectin on steroid hormone secretion in Huoyan geese ovarian granulosa cells. Anim. Reprod. Sci. 2019, 205, 34–43. [Google Scholar] [CrossRef] [Scilit]
- Hosoya, T.; Otsuka, F.; Nakamura, E.; Terasaka, T.; Inagaki, K.; Tsukamoto-Yamauchi, N.; Hara, T.; Toma, K.; Komatsubara, M.; Makino, H. Regulatory role of BMP-9 in steroidogenesis by rat ovarian granulosa cells. J. Steroid Biochem. Mol. Biol. 2015, 147, 85–91. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, Y.; Gong, Y.J.; Xu, Q.Q.; Zou, X. Molecular mechanism of mercuric chloride inhibiting progesterone secretion in ovarian granulosa cells of laying hens. J. Anim. Physiol. Anim. Nutr. 2018, 102, 1533–1542. [Google Scholar] [CrossRef] [Scilit]
- Li, J.; Luo, W.; Huang, T.; Gong, Y. Growth differentiation factor 9 promotes follicle-stimulating hormone-induced progesterone production in chicken follicular granulosa cells. Gen. Comp. Endocrinol. 2019, 276, 69–76. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xiao, Y.Q.; Shao, D.; Tong, H.B.; Shi, S.R. Genistein increases progesterone secretion by elevating related enzymes in chicken granulosa cells. Poult. Sci. 2019, 98, 1911–1917. [Google Scholar] [CrossRef] [Scilit]
- Strzalka, W.; Ziemienowicz, A. Proliferating cell nuclear antigen (PCNA): A key factor in DNA replication and cell cycle regulation. Ann. Bot. 2011, 107, 1127–1140. [Google Scholar] [CrossRef] [Scilit]
- Allan, G.F.; Leng, X.; Tsai, S.Y.; Weigel, N.L.; Edwards, D.P.; Tsai, M.J.; O’Malley, B.W. Hormone and antihormone induce distinct conformational changes which are central to steroid receptor activation. J. Biol. Chem. 1992, 267, 19513–19520. [Google Scholar]
- Johnson, A.L.; Lee, J. Granulosa cell responsiveness to follicle stimulating hormone during early growth of hen ovarian follicles. Poult. Sci. 2016, 95, 108–114. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Askoxylaki, M.; Siristatidis, C.; Chrelias, C.; Vogiatzi, P.; Creatsa, M.; Salamalekis, G.; Vrantza, T.; Vrachnis, N.; Kassanos, D. Reactive oxygen species in the follicular fluid of subfertile women undergoing in vitro fertilization: A short narrative review. J. Endocrinol. Investig. 2013, 36, 1117–1120. [Google Scholar]
- Zheng, W.; Feng, N.; Wang, Y.; Noll, L.; Xu, S.; Liu, X.; Lu, N.; Zou, H.; Gu, J.; Yuan, Y.; et al. Effects of zearalenone and its derivatives on the synthesis and secretion of mammalian sex steroid hormones: A review. Food Chem. Toxicol. 2019, 126, 262–276. [Google Scholar] [CrossRef] [Scilit]
- Abidi, P.; Zhang, H.; Zaidi, S.M.; Shen, W.J.; Leers-Sucheta, S.; Cortez, Y.; Han, J.; Azhar, S. Oxidative stress-induced inhibition of adrenal steroidogenesis requires participation of p38 mitogen-activated protein kinase signaling pathway. J. Endocrinol. 2008, 198, 193–207. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gilbert, A.B.; Evans, A.J.; Perry, M.M.; Davidson, M.H. A method for separating the granulosa cells, the basal lamina and the theca of the preovulatory ovarian follicle of the domestic fowl (Gallus domesticus). J. Reprod. Fertil. 1977, 50, 179–181. [Google Scholar] [CrossRef] [Scilit]
- Su, J.; Zhang, F.; Li, X.; Liu, Z. Osthole promotes the suppressive effects of cisplatin on NRF2 expression to prevent drug-resistant cervical cancer progression. Biochem. Biophys. Res. Commun. 2019, 514, 510–517. [Google Scholar] [CrossRef] [Scilit]
- Dai, X.; Yin, C.; Zhang, Y.; Guo, G.; Zhao, C.; Wang, O.; Xiang, Y.; Zhang, X.; Liang, G. Osthole inhibits triple negative breast cancer cells by suppressing STAT3. J. Exp. Clin. Cancer Res. 2018, 37, 322. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Le, Z.T.; Wang, H.F.; Ren, T.; Shao, Z.Y.; Yuan, R.Y.; Gao, Y.; Zhang, Y.J.; Wang, X.A.; Liu, Y.B. Osthole inhibits the progression of human gallbladder cancer cells through JAK/STAT3 signal pathway both in vitro and in vivo. Anticancer Drugs 2019, 30, 1022–1030. [Google Scholar]
- Ma, Y.; Wang, L.; Zheng, S.; Xu, J.; Pan, Y.; Tu, P.; Sun, J.; Guo, Y. Osthole inhibits osteoclasts formation and bone resorption by regulating NF-κB signaling and NFATc1 activations stimulated by RANKL. J. Cell. Biochem. 2019, 120, 16052–16061. [Google Scholar] [CrossRef] [Scilit]
- Wang, P.; Ying, J.; Luo, C.; Jin, X.; Zhang, S.; Xu, T.; Zhang, L.; Mi, M.; Chen, D.; Tong, P.; et al. Osthole promotes bone fracture healing through activation of BMP signaling in chondrocytes. Int. J. Biol. Sci. 2017, 13, 996–1007. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, R.; Liu, Z.; Hou, J.; Huang, T.; Yang, M. Osthole improves collagen-induced arthritis in a rat model through inhibiting inflammation and cellular stress. Cell. Mol. Biol. Lett. 2018, 23, 19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kong, L.; Yao, Y.; Xia, Y.; Liang, X.; Ni, Y.; Yang, J. Osthole alleviates inflammation by down-regulating NF-κB signaling pathway in traumatic brain injury. Immunopharmacol. Immunotoxicol. 2019, 41, 349–360. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fan, H.; Gao, Z.; Ji, K.; Li, X.; Wu, J.; Liu, Y.; Wang, X.; Liang, H.; Liu, Y.; Li, X.; et al. The in vitro and in vivo anti-inflammatory effect of osthole, the major natural coumarin from Cnidium monnieri (L.) Cuss, via the blocking of the activation of the NF-κB and MAPK/p38 pathways. Phytomedicine 2019, 58, 152864. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kuai, Y.; Gao, X.; Yang, H.; Luo, H.; Xu, Y.; Liu, C.; Yu, H.; Wang, Y.; Zhang, C.; Ma, X.; et al. Pentachloronitrobenzene alters progesterone production and primordial follicle recruitment in cultured granulosa cells and rat ovary. Biol. Reprod. 2020, 102, 511–520. [Google Scholar] [CrossRef] [Scilit]
- Fujita, S.; Hasegawa, T.; Nishiyama, Y.; Fujisawa, S.; Nakano, Y.; Nada, T.; Iwata, N.; Kamada, Y.; Masuyama, H.; Otsuka, F. Interaction between orexin A and bone morphogenetic protein system on progesterone biosynthesis by rat granulosa cells. J. Steroid Biochem. Mol. Biol. 2018, 181, 73–79. [Google Scholar] [CrossRef] [Scilit]
- Xiao, Y.; Ni, Y.; Huang, Y.; Wu, J.; Grossmann, R.; Zhao, R. Effects of kisspeptin-10 on progesterone secretion in cultured chicken ovarian granulosa cells from preovulatory (F1-F3) follicles. Peptides 2011, 32, 2091–2097. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, J.; Tu, D.; Yuan, L.Y.; Yi, J.; Tian, Y. T-2 toxin regulates steroid hormone secretion of rat ovarian granulosa cells through cAMP-PKA pathway. Toxicol. Lett. 2015, 232, 573–579. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Boujrad, N.; Hudson, J.R.; Papadopoulos, V. Inhibition of hormone-stimulated steroidogenesis in cultured Leydig tumor cells by a cholesterol-linked phosphorothioate oligodeoxynucleotide antisense to diazepam-binding inhibitor. Proc. Natl. Acad. Sci. USA 1993, 90, 5728–5731. [Google Scholar] [CrossRef] [Scilit]
- Solish, S.B.; Picado-Leonard, J.; Morel, Y.; Kuhn, R.W.; Mohandas, T.K.; Hanukoglu, I.; Miller, W.L. Human adrenodoxin reductase: Two mRNAs encoded by a single gene on chromosome 17cen-q25 are expressed in steroidogenic tissues. Proc. Natl. Acad. Sci. USA 1988, 85, 7104–7108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miller, W.L. Minireview: Regulation of steroidogenesis by electron transfer. Endocrinology 2005, 146, 2544–2550. [Google Scholar] [CrossRef] [Scilit] [PubMed]









| Gene | cDNA Reference | Primer Sequences (5′→3′) | Annealing Temperature |
|---|---|---|---|
| β-Actin StAR P450scc 3β-HSD PCNA | NM_205518 NM_204686 NM_001001756 D43762 NM_204170.2 | F: ATGAAGCCCAGAGCAAAAGA R: GGGGTGTTGAAGGTCTCAAA F: AGGGTTGGGAAGGACACTCT R: ATACATGTGGGGCCGTTCTC F: TCCGCTTTGCCTTGGAGTCTGTG R: ATGAGGGTGACGGCGTCGATGAA F: GCTTTGCCTTGGAGTCTGTG R: TCGGTGCTCTTGCGTTGC F: ATGGGCGTCAACCTAAACAG R: ATTCCAAGCTGCTCCACATC | 60 °C 60 °C 60 °C 60 °C 60 °C |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sun, N.; Zhang, Y.; Hou, Y.; Yi, Y.; Guo, J.; Zheng, X.; Sun, P.; Sun, Y.; Khan, A.; Li, H. Effects of Osthole on Progesterone Secretion in Chicken Preovulatory Follicles Granulosa Cells. Animals 2020, 10, 2027. https://doi.org/10.3390/ani10112027
Sun N, Zhang Y, Hou Y, Yi Y, Guo J, Zheng X, Sun P, Sun Y, Khan A, Li H. Effects of Osthole on Progesterone Secretion in Chicken Preovulatory Follicles Granulosa Cells. Animals. 2020; 10(11):2027. https://doi.org/10.3390/ani10112027
Chicago/Turabian StyleSun, Na, Yutong Zhang, Yaxin Hou, Yanyan Yi, Jianhua Guo, Xiaozhong Zheng, Panpan Sun, Yaogui Sun, Ajab Khan, and Hongquan Li. 2020. "Effects of Osthole on Progesterone Secretion in Chicken Preovulatory Follicles Granulosa Cells" Animals 10, no. 11: 2027. https://doi.org/10.3390/ani10112027
APA StyleSun, N., Zhang, Y., Hou, Y., Yi, Y., Guo, J., Zheng, X., Sun, P., Sun, Y., Khan, A., & Li, H. (2020). Effects of Osthole on Progesterone Secretion in Chicken Preovulatory Follicles Granulosa Cells. Animals, 10(11), 2027. https://doi.org/10.3390/ani10112027
